ID: 1161373677

View in Genome Browser
Species Human (GRCh38)
Location 19:3927917-3927939
Sequence CTGACCAGGACTTTGGGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161373677_1161373687 8 Left 1161373677 19:3927917-3927939 CCCTCCCCCAAAGTCCTGGTCAG 0: 1
1: 0
2: 5
3: 22
4: 254
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161373677 Original CRISPR CTGACCAGGACTTTGGGGGA GGG (reversed) Exonic
900098185 1:948867-948889 CTTCCCAGGATTTTGGGAGAGGG - Intronic
900767977 1:4518206-4518228 CTGATCATGCCTTTGAGGGAGGG - Intergenic
904336531 1:29801782-29801804 CTGACCATCACCCTGGGGGAAGG - Intergenic
904611550 1:31728592-31728614 CAGACCTGGACTTTGAGGTAAGG - Exonic
906517425 1:46447993-46448015 CTGACTAGGACGTTACGGGAAGG + Intergenic
906532718 1:46532802-46532824 CTACCCAGGAGTTTGGGAGATGG + Intergenic
907982109 1:59493617-59493639 GTTACCAGGGATTTGGGGGAAGG + Intronic
911019935 1:93375844-93375866 CTGCCCAGGACTTGGGGTGGGGG + Intergenic
911236870 1:95421478-95421500 AAGAACAGGACTCTGGGGGAGGG - Intergenic
912321775 1:108720359-108720381 CTGACCAGTGCTTTGGCAGAAGG + Intronic
913271157 1:117094853-117094875 CTAACCTGTACTTTGGGGGTTGG + Intronic
915946454 1:160155821-160155843 CTGACCAGGAATTTTGCTGACGG + Intronic
916239537 1:162625117-162625139 CTGGCCAGGTCTATAGGGGAGGG + Intergenic
917575631 1:176318609-176318631 CTGAGCAGGACTTTAGGGGATGG + Intergenic
919165535 1:193887139-193887161 CTCTCTTGGACTTTGGGGGATGG - Intergenic
920965372 1:210696715-210696737 GTTACCAGGACTTGGGGAGAGGG + Intronic
1065525104 10:26612118-26612140 AATACCAGTACTTTGGGGGACGG - Intergenic
1067470154 10:46530714-46530736 CTGAGCAGCATTTTGGGGCATGG + Intergenic
1067472852 10:46548910-46548932 CTGCCCAGGTCTTTAGGGAAGGG - Intergenic
1071569105 10:86686845-86686867 CTGCACTGGGCTTTGGGGGAGGG + Intronic
1071788361 10:88928375-88928397 CAGAGAAGGACTCTGGGGGAGGG + Intronic
1072551759 10:96483656-96483678 CTGGACAGGACTTTGGGGAAAGG + Intronic
1074375721 10:112939378-112939400 CTCAACAGGACTGTGGGGGCTGG + Intergenic
1076882429 10:133246036-133246058 CTGACGAGGACTCTGGCTGAAGG + Intergenic
1077430417 11:2513426-2513448 CTGCCCAGCACTTTGAGGGCAGG - Intronic
1080880158 11:36312289-36312311 CTGACCATGACTTTGGGAAAGGG + Intronic
1083260168 11:61518430-61518452 CGGAGCTGGACTGTGGGGGATGG + Exonic
1083679306 11:64343922-64343944 CCGGCCAGGACCCTGGGGGAGGG - Intronic
1084083588 11:66844402-66844424 CAGTCCAGGACATTGGGGCAGGG + Intronic
1084084059 11:66846729-66846751 CACACTAGGACTTTGGGGCATGG - Intergenic
1085018821 11:73192383-73192405 TTGGGCAGGACTTTGTGGGAGGG - Intergenic
1085305773 11:75485171-75485193 CTGTCAAGGACTCAGGGGGAAGG + Intronic
1085793408 11:79515826-79515848 CTGTCCAGGATTTGGGGGGATGG - Intergenic
1087107406 11:94423938-94423960 CAGACCAGCACTGTGGAGGAAGG - Intronic
1088008237 11:104968484-104968506 CTGACTAGGAGTTTGGGAGTAGG - Intronic
1089864483 11:121619904-121619926 CTGACCAGGACTTGGTGAGTGGG + Exonic
1090082689 11:123624568-123624590 TTGTCCAGGCCTTTGGGTGAGGG + Intronic
1090267792 11:125364461-125364483 CTAGGCAGGACTTTGGGGAAAGG - Intronic
1090360567 11:126169735-126169757 AAGACCAGGTCTTGGGGGGAGGG + Intergenic
1090642559 11:128741723-128741745 CTGAGCAGGAATCGGGGGGAGGG - Intronic
1090743793 11:129691339-129691361 CTGAGCAGGAGGCTGGGGGAGGG - Intergenic
1090869211 11:130727960-130727982 ATGAACAGGAATTTGGGGAAAGG - Intergenic
1090932697 11:131312579-131312601 AAGACCAGGGCTTTGGGGAATGG + Intergenic
1091554885 12:1565284-1565306 CTGACCTGGGCTTTGGGTGTAGG - Intronic
1096179532 12:49542946-49542968 CTTGCCAGCACTTTGGGGGTTGG + Intronic
1097676893 12:62612693-62612715 CTGACCATGACTTTTGGAGAAGG - Intergenic
1098112450 12:67137473-67137495 CTGGGCAGGACTTAGTGGGATGG + Intergenic
1098461897 12:70741615-70741637 AAGGCCAGGACTTTGGTGGAAGG + Intronic
1098693264 12:73517821-73517843 CTGGCCAGGAGTTTGGCAGATGG - Intergenic
1098727376 12:73984674-73984696 CTGTCATGGACTTTGTGGGAAGG + Intergenic
1101812575 12:108120605-108120627 CTGAGCAGGAGTTTGTTGGATGG + Intergenic
1101866980 12:108527508-108527530 GTGATCAGGACTGTGGGAGATGG - Intronic
1102375262 12:112416824-112416846 CTGGCCAGGATTTAGGGAGAGGG + Intronic
1105210309 13:18253446-18253468 AGGAAGAGGACTTTGGGGGACGG - Intergenic
1107194368 13:37630842-37630864 ATGCCCTGTACTTTGGGGGAAGG - Intergenic
1116909411 14:50443724-50443746 CTTACCAGAACTTTTGGGGTGGG + Exonic
1117613106 14:57504402-57504424 CTTACCAGGCCTTGGGAGGAAGG - Intergenic
1118908142 14:70038129-70038151 TTGACCAGTACTTTTGGGCAAGG - Intergenic
1119160266 14:72446571-72446593 CGGACCAGGGTTGTGGGGGATGG + Intronic
1122081927 14:99272667-99272689 CGGACTTGGACTTTGGGGGTGGG + Intergenic
1122768411 14:104086289-104086311 CTGACCAGGACCCCAGGGGACGG - Intronic
1122841117 14:104463752-104463774 TTGACCAGCTCTTTTGGGGAAGG - Intergenic
1123091233 14:105743237-105743259 CTGACCTTGGCTTTGGGGCAGGG - Intergenic
1123097006 14:105771577-105771599 CTGACCTTGGCTTTGGGGCAGGG - Intergenic
1123436541 15:20258685-20258707 GTTGCCAGGACTTAGGGGGAGGG + Intergenic
1123701216 15:22916120-22916142 CAGACCATGACGTGGGGGGAAGG - Intronic
1125242325 15:37589601-37589623 GTTACCAGGGGTTTGGGGGAGGG - Intergenic
1126395784 15:48215646-48215668 CTGAACATGACTTTGGGTGGAGG - Intronic
1127040221 15:54967029-54967051 CTGACCAGGACTTTGTCTGCAGG + Intergenic
1128045391 15:64613414-64613436 CTGACAAGAGCTTTGTGGGAAGG + Intronic
1129644347 15:77417097-77417119 CTGACTCAGACTTCGGGGGATGG - Intronic
1130995918 15:88904062-88904084 ATGACCATGACTTGGGGTGAGGG - Intronic
1131269553 15:90938608-90938630 ATGCCCAGGACTCTGGGGGGTGG + Intronic
1132210352 15:100017358-100017380 CTGGCCAGAACTTGGGGGGAGGG - Intronic
1132367311 15:101266947-101266969 GTTACCAGGACCTGGGGGGAGGG - Intergenic
1132498504 16:274806-274828 CGGTCCAGGACTTTTGGGGAGGG + Intronic
1133312465 16:4858722-4858744 CTGACCAGGAAGCTGGGGGTGGG + Intronic
1133808250 16:9141905-9141927 CTGAGCAGGACTTTGGGAAAAGG + Intergenic
1133987571 16:10680144-10680166 GTGAGCAGGACTTTGGGGGCTGG - Intronic
1134060367 16:11195966-11195988 AGGACCAGCACTTTGGGAGATGG - Intergenic
1136043846 16:27600597-27600619 CTCACCAGGAGAATGGGGGAGGG - Intronic
1136481997 16:30547909-30547931 CTGACAAGGACGGTGGGAGAGGG + Intronic
1136848030 16:33592168-33592190 GTTGCCAGGACTTAGGGGGAGGG - Intergenic
1137720754 16:50625990-50626012 CTGCCCAGGAGCTTGGGGGTGGG + Intronic
1139797322 16:69494087-69494109 GTGACCAGGAGTTTAGGGGAGGG + Intergenic
1203109738 16_KI270728v1_random:1440817-1440839 GTTGCCAGGACTTAGGGGGAGGG - Intergenic
1143689441 17:8549014-8549036 CTTAACAGGAGTTTTGGGGATGG + Intronic
1143964788 17:10749504-10749526 CTGACCTAGCCTTTGGGGAAGGG + Intergenic
1146795165 17:35775344-35775366 CTGGCCAGGAGTTTGGGTCAGGG - Intronic
1147239301 17:39080061-39080083 ATGCCCACTACTTTGGGGGATGG + Intronic
1147318669 17:39633138-39633160 CTGAGCAGGTCTTTGGAGGCTGG + Intronic
1147422162 17:40327262-40327284 CTGACCCAGCCTTTGGGGGTCGG - Intronic
1147967070 17:44199389-44199411 CTGACCCAGACCTGGGGGGAGGG + Intronic
1148104858 17:45113732-45113754 CCCACCATGACTTTAGGGGAGGG + Intronic
1148128603 17:45249125-45249147 CAGGCCAGGATTTTGTGGGAAGG + Intergenic
1149659536 17:58327102-58327124 AGGAACAGGACTTTGGGGGAGGG - Intronic
1151706475 17:75771515-75771537 CTGGCCAGGAAATGGGGGGAGGG - Intergenic
1152028919 17:77829962-77829984 CTGATCAGGACTTCCAGGGATGG - Intergenic
1152133714 17:78492113-78492135 CTGACCAGGAGCCTAGGGGAGGG - Intronic
1152375639 17:79917514-79917536 CTACCCAGGACTGTGAGGGAAGG + Intergenic
1153325224 18:3811731-3811753 CGGTCCAGGACGTTGGAGGAGGG + Intronic
1155481643 18:26295391-26295413 CAGACCAGGATTGAGGGGGAGGG + Intronic
1156558240 18:38091697-38091719 CTCACCAGCACTTTGGTAGATGG - Intergenic
1157553415 18:48597024-48597046 GAGACCAGGAATTTGGGGCAGGG - Intronic
1159787035 18:72726860-72726882 CTGTCCAGAACTTGGGGGGAGGG + Intergenic
1160066366 18:75578228-75578250 CTGACCAGAACTTAGGGGTGAGG - Intergenic
1160221966 18:76984490-76984512 CTGACCTTGACTCTGGGGCAGGG - Intronic
1160380614 18:78452118-78452140 CTGATCAGGACTGCGGGGGCAGG - Intergenic
1160867336 19:1261687-1261709 GTGGCCTGGACTTTGGGGGGCGG + Intronic
1160938892 19:1610738-1610760 CTGACCTGGGCTTGGGGGAAGGG - Exonic
1161038689 19:2098816-2098838 CTGACCTGGACTTCAGGGGGAGG + Intronic
1161076371 19:2287852-2287874 CCCTCCAGGACTTTGCGGGAAGG - Intronic
1161274730 19:3409502-3409524 CTCGCCAGGCCTTGGGGGGATGG - Intronic
1161373677 19:3927917-3927939 CTGACCAGGACTTTGGGGGAGGG - Exonic
1163050974 19:14683277-14683299 ATGCCCATGACTTTGGGGGTAGG + Intronic
1165032608 19:33009091-33009113 GTTGCCAGGACTTAGGGGGAGGG + Intronic
1165407900 19:35642075-35642097 TTGCCCAGGCCCTTGGGGGAGGG + Exonic
1165444178 19:35847992-35848014 GTGGCCAGGAATGTGGGGGAAGG - Intronic
1166602077 19:44105116-44105138 CTGGCCACGCCTTTGGGGGTCGG - Intronic
1167051972 19:47084930-47084952 CTGGCCAGCCCTTTGGGGGGTGG + Intronic
1167390336 19:49190534-49190556 CTGGCCATGGCTCTGGGGGAAGG + Intronic
1168236863 19:55069089-55069111 CTTCCCAGGTCTCTGGGGGATGG - Intronic
925727157 2:6884262-6884284 CGGACATGGACTGTGGGGGAGGG + Intronic
926062632 2:9813735-9813757 CTGGCCAGGCCTTTGGAGGAAGG - Intergenic
927185454 2:20479026-20479048 CTGACCTTCCCTTTGGGGGATGG - Intergenic
931360897 2:61577145-61577167 CTCACCAGCACTTTGGGAGGTGG + Intergenic
933088125 2:78082644-78082666 GTTACCAGGGCTTTGGGAGAAGG - Intergenic
933751934 2:85608381-85608403 CTGCTCAGGACTTTGGAGGTGGG - Exonic
933998324 2:87686176-87686198 TTGAGCAGGACTTTGCAGGATGG - Intergenic
934988905 2:98907384-98907406 CTGGCCAGGACATTGTGGGGAGG - Intronic
935045621 2:99479394-99479416 CAGACCTGGAATTTGGGGTAAGG - Intronic
935348379 2:102130614-102130636 AAAACCAAGACTTTGGGGGAAGG - Intronic
935634219 2:105237529-105237551 TTGACCAGGCCTTAGGAGGACGG + Intergenic
936091224 2:109502547-109502569 CTGGCCAGTACTCTGGGGGCTGG + Intronic
936295524 2:111264697-111264719 TTGAGCAGGACTTTGCAGGATGG + Intergenic
938236596 2:129710927-129710949 CTGAGCAGGCCCTTGGAGGAGGG - Intergenic
939457978 2:142462796-142462818 CTGACAAGGACTCTGTGAGATGG - Intergenic
941735082 2:168965303-168965325 CTTCCCAGGAGTCTGGGGGAGGG - Intronic
946176581 2:217925798-217925820 GTAACCAGGGGTTTGGGGGAGGG - Intronic
947900854 2:233720283-233720305 CTGACCAGGAGTTGGGGGTCTGG + Intronic
948139396 2:235661515-235661537 CTGGCCAGGGCTGTGGGGGTGGG + Intronic
948876671 2:240833184-240833206 CCCAACAGGGCTTTGGGGGATGG - Intergenic
1168878525 20:1186666-1186688 CTGCACAGAACTTTGGAGGAGGG - Intronic
1169308710 20:4517237-4517259 CTGACCAGGACCTGGTGGCATGG - Intergenic
1169310932 20:4539214-4539236 TTGCCAAGGACTGTGGGGGAAGG + Intergenic
1169705804 20:8503348-8503370 CTTACCAGGAATTTGAGGAAAGG - Intronic
1170278842 20:14623438-14623460 CTGGCAAGGGCTTTGGGAGATGG + Intronic
1170818900 20:19739444-19739466 CTGGCCACGGGTTTGGGGGATGG + Intergenic
1171350408 20:24497996-24498018 CTGCCCAGGCCTTTGGCTGATGG - Intronic
1171962465 20:31504605-31504627 GTGAACAGGAATTTGTGGGAAGG - Intergenic
1172573204 20:35986468-35986490 CTCACCATGACCTTGGGAGAAGG - Intronic
1172869225 20:38125564-38125586 CTGCCCAGGCCTGTTGGGGAGGG + Intronic
1173904944 20:46619791-46619813 CTGACCAGGACTTTAGGGTGGGG - Intronic
1174324471 20:49768252-49768274 CTGACCCAGACTTTGGGGGAAGG + Intergenic
1174449064 20:50608854-50608876 CCCGCCAGGTCTTTGGGGGACGG - Intronic
1174709787 20:52692342-52692364 CTAATCAAGACTTTGGGGCAAGG - Intergenic
1174902938 20:54520150-54520172 ATGACAAGGACTTACGGGGAGGG - Intronic
1176343364 21:5718412-5718434 CTGTCCCTGACTTAGGGGGAAGG - Intergenic
1176501463 21:7606044-7606066 CTGTCCCTGACTTAGGGGGAAGG + Intergenic
1176537685 21:8116481-8116503 CTGTCCCTGACTTAGGGGGAAGG - Intergenic
1176808611 21:13515623-13515645 CTGACCAGCAGCTGGGGGGAGGG - Intergenic
1178932900 21:36835063-36835085 CCGGCCAGGACATTGGGGAATGG - Intronic
1179056508 21:37940648-37940670 GTTACCAGGGGTTTGGGGGAGGG - Intergenic
1179122213 21:38558436-38558458 CTGACAAGGACCTTGAGAGAAGG - Intronic
1179795081 21:43777956-43777978 CATCCCAGCACTTTGGGGGATGG - Intergenic
1179940526 21:44636741-44636763 CTGACCAGGGCTCCAGGGGATGG + Intronic
1180765946 22:18345957-18345979 AGGAAGAGGACTTTGGGGGACGG + Intergenic
1180780367 22:18516421-18516443 AGGAAGAGGACTTTGGGGGACGG - Exonic
1180813083 22:18773742-18773764 AGGAAGAGGACTTTGGGGGACGG - Intergenic
1180957147 22:19746192-19746214 CTGACCAGGGTTGTGGGGCAAGG - Intergenic
1181199260 22:21208058-21208080 AGGAAGAGGACTTTGGGGGACGG - Exonic
1181235295 22:21444854-21444876 CGGACCAGGGCTCTGGGGCAGGG - Intronic
1181537521 22:23554243-23554265 CTGGGCAGGCCCTTGGGGGATGG + Intergenic
1181553684 22:23655382-23655404 GTGCCCAGGACTGGGGGGGAGGG + Intergenic
1181560967 22:23699600-23699622 CTGCCCAGGACTTCTGGAGAAGG - Intergenic
1181966021 22:26657333-26657355 CTGGCCAGGACTCTGGGCGCGGG + Intergenic
1182145742 22:27995799-27995821 CTCGCCAGGACCCTGGGGGAAGG - Intronic
1182575458 22:31270008-31270030 CTTACCAGACATTTGGGGGATGG + Intronic
1184554384 22:45225302-45225324 CTGACGAGGCACTTGGGGGAGGG + Intronic
1203227565 22_KI270731v1_random:86848-86870 AGGAAGAGGACTTTGGGGGACGG + Intergenic
1203242631 22_KI270733v1_random:32836-32858 CTGTCCCTGACTTAGGGGGAAGG - Intergenic
950701657 3:14754448-14754470 CTGAGCAGGGCTTTGAGGGATGG + Intronic
950708223 3:14796968-14796990 CTGCACAGCACTGTGGGGGAGGG - Intergenic
955096108 3:55799945-55799967 CTGACCAGGACTTTTGTTTAAGG - Intronic
958933567 3:100233409-100233431 ATTGCCAGGGCTTTGGGGGAGGG + Intergenic
960635583 3:119781515-119781537 CTGACCAGGAGTGGGGAGGATGG - Intronic
961557720 3:127708035-127708057 GTGAGCAGGACTATGGGGGATGG - Intronic
962971266 3:140404105-140404127 CTGACCAGGTCTGCGGGGGTGGG - Intronic
964453483 3:156835835-156835857 CAGAGCAAGACTTGGGGGGAGGG - Intronic
964667989 3:159194789-159194811 CTGCCAAGGACTTTGGGGGATGG - Intronic
966267506 3:178063916-178063938 CTTACTAGGACTTTGGTGGTGGG - Intergenic
968077275 3:195823399-195823421 GTGACCAGGGCTTTGGGGATTGG - Intergenic
968739635 4:2320899-2320921 TTGAGCCGGACTCTGGGGGAGGG - Intronic
969316348 4:6383471-6383493 GTGGCCAGGACTTTTGGGAAAGG - Intronic
969346962 4:6575805-6575827 CTGCTCAGGACCTTGGGCGAGGG + Intronic
969474832 4:7415931-7415953 CTGAACTGGACTTTGAAGGATGG + Intronic
973729634 4:53810956-53810978 CTCAACAGGACTTGGTGGGAAGG + Intronic
974122839 4:57660713-57660735 TTGAGCAGGACTTAGGGGAAAGG + Intergenic
975473859 4:74799272-74799294 CTTACCAAGAAGTTGGGGGAAGG - Intergenic
976745430 4:88398545-88398567 CTGTCCAGGACTGTGAAGGAAGG + Intronic
977888480 4:102279456-102279478 TTGACCAGGACTATCGGGAAGGG - Intronic
978617746 4:110612989-110613011 CTGCCCAGGACTGTGTGCGAGGG + Intergenic
979498493 4:121411659-121411681 CTGGCCAGAACTCAGGGGGAGGG - Intergenic
980167172 4:129242885-129242907 CTGAATTGGACTTTGGGAGATGG + Intergenic
981751656 4:148098045-148098067 CTCCCCAGGAGTTTGGGGCAGGG - Intronic
983238804 4:165208104-165208126 CTGCCCAGGATTTCTGGGGAAGG + Intronic
986812345 5:11373593-11373615 CAGACCAGGACCTCAGGGGAGGG + Intronic
991633312 5:68678858-68678880 CTGGCCAAGACTTTGGAGGTCGG + Intergenic
992323436 5:75636779-75636801 GTGACCAGGACTTGGGGAGAGGG + Intronic
992331889 5:75725532-75725554 CTGCCCAGGAGTTTGGGGCTAGG + Intergenic
995486276 5:112643513-112643535 CTGCCCAGCACTTTGGACGATGG - Intergenic
997264682 5:132488308-132488330 AAAACCAGGGCTTTGGGGGAGGG - Intronic
997825173 5:137099902-137099924 CTGACCATGACTCCGGGGGGTGG - Intronic
997913963 5:137905016-137905038 CTGATCAGGACTGTTGGGAAGGG - Intronic
997990235 5:138538512-138538534 CTAACCAACAGTTTGGGGGAAGG + Intronic
998108341 5:139482430-139482452 CTCATCAGGGCTTTGAGGGAAGG - Intronic
1000212285 5:159118973-159118995 CTCACCAGCACTTTGGGAGGCGG - Intergenic
1000230827 5:159313674-159313696 CTGGCCAGAAATTTGGGGAAAGG + Intergenic
1003485374 6:6571523-6571545 GTTACCAGGAACTTGGGGGAGGG - Intergenic
1007496239 6:42261815-42261837 CTGAGCAGGATTTTGAAGGAAGG - Intronic
1007699764 6:43759691-43759713 CAGCCCAGGAGTCTGGGGGAAGG + Intergenic
1007717175 6:43864120-43864142 CTGAGCAGCACTTTGGGGCCTGG + Intergenic
1011201698 6:84843995-84844017 CTGAACAGGACTTGTGGGGCAGG - Intergenic
1013186102 6:107759782-107759804 CTGTGCAGAACTTTGGGAGAGGG + Intronic
1014985815 6:128007541-128007563 CTAAGCAAGATTTTGGGGGAAGG - Intronic
1015651833 6:135470781-135470803 CTGTCAGGGAGTTTGGGGGAGGG + Intronic
1016846201 6:148570785-148570807 CTGACTAGCAGTTTTGGGGAAGG + Intergenic
1017884899 6:158590863-158590885 TTGCCAAGGACTGTGGGGGAGGG - Intronic
1018669583 6:166167759-166167781 CGGACCAAGACTTGGGGGGAGGG + Exonic
1019815221 7:3194990-3195012 CTGCACTGGACTTTGTGGGAGGG + Intergenic
1020017751 7:4841399-4841421 GTGGACAGGGCTTTGGGGGAGGG - Intronic
1020756510 7:12210643-12210665 ATGACCTAGACGTTGGGGGAGGG + Intergenic
1021840463 7:24717940-24717962 CTCACCAGGACATCGTGGGAAGG - Intronic
1022480085 7:30737398-30737420 GTTACCAGGGGTTTGGGGGAAGG - Intronic
1023056017 7:36290655-36290677 CTCACCAGGACTTGGGGACAGGG + Intronic
1024226055 7:47327773-47327795 CTGGGCAGGACTTGGGAGGAGGG - Intronic
1024596633 7:50943422-50943444 CTGAGCAGGGCTGTGGTGGAGGG + Intergenic
1024621210 7:51159071-51159093 CTGGCCAGGAGCTTGGAGGAGGG + Intronic
1026410948 7:70122165-70122187 CTTACCAGGAATTTGGGGGATGG + Intronic
1027134834 7:75616773-75616795 CTGGCCATCACTTTGGGGTAAGG + Intronic
1029309812 7:99652578-99652600 CTGTCCAGTACTTTGGGTCATGG + Exonic
1029321213 7:99762066-99762088 CTGTCCAGTACTTTGGGTCACGG + Exonic
1029331703 7:99861792-99861814 CTGTCCAGTACTTTGGGTCATGG - Exonic
1031752453 7:125593709-125593731 CTGCCTAGGACTTTGGGAGGTGG - Intergenic
1031955761 7:127940681-127940703 ATGACCTGGAGTTTGGGGAAGGG - Intronic
1032418973 7:131762528-131762550 CTGACAAGGACTTTGTGCAAAGG - Intergenic
1033582630 7:142751249-142751271 CTGATCAGAACCTTGGGGAAGGG - Intronic
1033782563 7:144690028-144690050 GTTACCAGGAGCTTGGGGGAAGG - Intronic
1034631146 7:152531444-152531466 GTGACCAGGACTTGGGTAGACGG - Intergenic
1037189273 8:16101649-16101671 ATGACCTATACTTTGGGGGAAGG - Intergenic
1038050801 8:23808975-23808997 TTGGCCAGGATTCTGGGGGAAGG - Intergenic
1038444622 8:27594797-27594819 CTGAGCAGGACTAGGGGTGAAGG + Intergenic
1039571768 8:38592701-38592723 CTGGCCAGAACCTGGGGGGAGGG + Intergenic
1041253736 8:55960829-55960851 GTGACCTGTTCTTTGGGGGAAGG + Intronic
1045256979 8:100534114-100534136 CTGACCAGGAATTTGGGATTTGG - Intronic
1045809051 8:106200438-106200460 ATGGTCAGGAATTTGGGGGATGG + Intergenic
1046666394 8:117008488-117008510 CTGAATAGGACTTTGGGGGCAGG - Intronic
1047644189 8:126852396-126852418 CTGAGGAGGATTTTGGTGGAGGG + Intergenic
1048355471 8:133650338-133650360 CTGGCCAGGACCTTGTGGGGAGG + Intergenic
1049434969 8:142582272-142582294 CTGACCAGGGCTCTGGGGAGGGG + Intergenic
1050107504 9:2180832-2180854 CTTACCATGAATTTGGGGGAGGG + Intronic
1052504188 9:29331016-29331038 CAGGCCAGAAATTTGGGGGATGG - Intergenic
1053041516 9:34877675-34877697 ATTACCAGGGATTTGGGGGAAGG + Intergenic
1054155296 9:61635422-61635444 CTGAGCTGGTATTTGGGGGAAGG - Intergenic
1054178184 9:61891024-61891046 CTGAGCTGGTATTTGGGGGAAGG + Intergenic
1054659345 9:67689800-67689822 CTGAGCTGGTATTTGGGGGAAGG - Intergenic
1056278687 9:85018582-85018604 GTGCCCAGGACTTTGGGAGAGGG - Intronic
1057141644 9:92729997-92730019 CTGGCCTGGATTTTGGGGCATGG - Intronic
1057453858 9:95190044-95190066 CTCACCAGGACTTTTGGGGAAGG - Intronic
1057867826 9:98695248-98695270 CTGTCCTGGGCTTTGGGGCATGG + Intronic
1060170702 9:121458807-121458829 CTGAGCAGGACTTGGGAGGTGGG - Intergenic
1060189159 9:121581329-121581351 CTGCCAAGGACATTGGGGGACGG - Intronic
1060472683 9:123961609-123961631 GTGACCAGGGATTTGGGGGCAGG + Intergenic
1062110457 9:134779367-134779389 CTGAACAGGAGTTTCTGGGACGG - Intronic
1203458957 Un_GL000220v1:15919-15941 CTGTCCCTGACTTAGGGGGAAGG - Intergenic
1189102537 X:38206344-38206366 TTGGGCAGGACTTTGGGGGACGG - Intronic
1195400919 X:104460273-104460295 CTGAACATCACTTTGGGGCAGGG - Intergenic
1195679605 X:107534479-107534501 CTGAGCTGGACCTTGAGGGATGG + Intronic
1196218847 X:113088058-113088080 CTGGCCAGAACTTGGGGGAAGGG + Intergenic
1198667771 X:139043949-139043971 CTTACCAGGATCTTAGGGGAAGG + Intronic
1199947543 X:152680677-152680699 CTGGGCAGGACTGTGGGGAAGGG + Intergenic
1199962136 X:152787777-152787799 CTGGGCAGGACTGTGGGGAAGGG - Intergenic