ID: 1161373678

View in Genome Browser
Species Human (GRCh38)
Location 19:3927918-3927940
Sequence GCTGACCAGGACTTTGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161373678_1161373687 7 Left 1161373678 19:3927918-3927940 CCTCCCCCAAAGTCCTGGTCAGC 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161373678 Original CRISPR GCTGACCAGGACTTTGGGGG AGG (reversed) Exonic
900098186 1:948868-948890 GCTTCCCAGGATTTTGGGAGAGG - Intronic
900701856 1:4053491-4053513 GCTCACCTGGACTCTGGTGGAGG - Intergenic
900767978 1:4518207-4518229 GCTGATCATGCCTTTGAGGGAGG - Intergenic
900971344 1:5993756-5993778 GCTGAGCAGGAAAGTGGGGGTGG - Intronic
901064235 1:6487057-6487079 GGTGACCTGGGCTTTGGGAGTGG - Intronic
901680547 1:10910298-10910320 GCAGAACAGGACAGTGGGGGAGG + Intergenic
901747747 1:11385729-11385751 TCAGACCAGGACTTTGGGTCTGG - Intergenic
901817356 1:11802275-11802297 GCTGCACAGGGCTTGGGGGGTGG - Intronic
902695934 1:18140881-18140903 GCTGCCCAGCTCTCTGGGGGAGG + Intronic
903541327 1:24097924-24097946 GCGGACGAGGACTTTGGCGAAGG + Exonic
904537372 1:31208711-31208733 GCTGCCCCGGACTTTGAGAGCGG + Intronic
905137216 1:35808584-35808606 GCTGACCCGGGCCTGGGGGGCGG + Intronic
907886585 1:58597770-58597792 GCTGACCAGTTCTTAGAGGGTGG + Intergenic
909673514 1:78214206-78214228 CCTGACCAGAACTTGGGGGAGGG + Intergenic
910569642 1:88684815-88684837 GCAGGCCAGGGCTTTGGCGGGGG - Intronic
911019934 1:93375843-93375865 CCTGCCCAGGACTTGGGGTGGGG + Intergenic
912387586 1:109279833-109279855 GCTGACCACAACAGTGGGGGTGG + Exonic
912835463 1:112992601-112992623 GGTAATCAGGACTTTGGGGATGG - Intergenic
915489553 1:156243572-156243594 GGTGTCCAGGCTTTTGGGGGTGG - Exonic
915626304 1:157115973-157115995 GCTGAGCTGGGCTGTGGGGGCGG + Intergenic
916239536 1:162625116-162625138 GCTGGCCAGGTCTATAGGGGAGG + Intergenic
918085940 1:181245257-181245279 GCTGAGCTGGACTCTGGGTGTGG + Intergenic
920965371 1:210696714-210696736 GGTTACCAGGACTTGGGGAGAGG + Intronic
922657847 1:227401640-227401662 CCTGGCCAGAACTTTGGGTGGGG + Intergenic
922878876 1:228964055-228964077 GCTGAGCTGGACCTTGGAGGTGG + Intergenic
924927981 1:248702109-248702131 GGTGACCAGGATCATGGGGGTGG - Intergenic
1063009821 10:2011337-2011359 GCTGACCAGGACTCTCAGGAGGG + Intergenic
1063495025 10:6499071-6499093 GCTGACCAGGATTTTGTGTGAGG + Intronic
1069612402 10:69783245-69783267 GCTGACTAGGACTTTGCTGCTGG - Intergenic
1069819099 10:71216791-71216813 GCTGCCTAAGACTTTGGGGATGG + Intronic
1071569104 10:86686844-86686866 GCTGCACTGGGCTTTGGGGGAGG + Intronic
1072722233 10:97788085-97788107 GCTGAGCTGGATTTTGGGGTTGG + Intergenic
1072724205 10:97801587-97801609 GCTGCCCAGGCCTTAGGGAGGGG + Intergenic
1073458366 10:103651278-103651300 GCTTACCAGGTCCTTGGGGAGGG - Intronic
1074877963 10:117629170-117629192 TCTGACCAGGAGATTGTGGGGGG + Intergenic
1076529105 10:131132820-131132842 GCTGCCCAGGAGATTGTGGGTGG + Intronic
1076744098 10:132504143-132504165 GCTGCCCAGGACCCTGGGGCTGG + Intergenic
1076858862 10:133130223-133130245 GCTGCTCTGGACTTTGGGGATGG + Exonic
1077188484 11:1245939-1245961 GCTGGTCAGCACTTTGGGAGGGG - Exonic
1077189443 11:1249710-1249732 GCTGGTCAGCACTTTGGGAGGGG - Exonic
1077225038 11:1435937-1435959 GCTGTCCAGGACGTGGGAGGAGG + Intronic
1079328697 11:19516346-19516368 GCAGTTCTGGACTTTGGGGGTGG - Intronic
1080880157 11:36312288-36312310 TCTGACCATGACTTTGGGAAAGG + Intronic
1081430438 11:42970836-42970858 AGTGATTAGGACTTTGGGGGAGG + Intergenic
1082903844 11:58285092-58285114 CCTGGCCAGAACTTTGGGGAGGG + Intergenic
1082916794 11:58446295-58446317 CCTGGCCAGAACTTTGGGGAGGG + Intergenic
1083658396 11:64241238-64241260 GGTGACGAGGAAATTGGGGGTGG + Intronic
1083679308 11:64343923-64343945 GCCGGCCAGGACCCTGGGGGAGG - Intronic
1084007518 11:66331198-66331220 GCTGCCCCGGCCTTTGTGGGTGG + Intronic
1084083587 11:66844401-66844423 GCAGTCCAGGACATTGGGGCAGG + Intronic
1085051678 11:73383183-73383205 GCTGCCCAGGGCTGTGGGAGGGG + Intronic
1085303010 11:75469299-75469321 GCTCACCATGGCATTGGGGGTGG + Intronic
1087061571 11:93983795-93983817 GTTGGCCAGAACTTTGAGGGAGG + Intergenic
1088835566 11:113575570-113575592 GCTGATCTGGTTTTTGGGGGTGG + Intergenic
1089864482 11:121619903-121619925 CCTGACCAGGACTTGGTGAGTGG + Exonic
1091150180 11:133321086-133321108 GGTGACCAGAACTTGGGGGAAGG + Intronic
1092783416 12:12007625-12007647 GCTGGACAGGACTTGGTGGGGGG - Intergenic
1095585340 12:43843480-43843502 GCTAAGCAAGACTTTGGAGGTGG + Intronic
1096594774 12:52687883-52687905 GGTGACCAGGACAGTGGTGGTGG - Intergenic
1097245633 12:57606178-57606200 GCTGACCAGGACTGGGAGTGGGG - Exonic
1101139008 12:101775867-101775889 CCTGACCAGAGCTTTGAGGGGGG + Intronic
1101568407 12:105931309-105931331 GCTGACCAGGACTTTCAGTTAGG - Intergenic
1102375261 12:112416823-112416845 GCTGGCCAGGATTTAGGGAGAGG + Intronic
1102698580 12:114819024-114819046 GGTTACCAGGAGTTTGGGGGAGG - Intergenic
1102710258 12:114919703-114919725 GGTGGCCAAGACTTTGGGGACGG + Intergenic
1102760115 12:115377474-115377496 GTTGACCAAGACCTTGGAGGGGG + Intergenic
1102980419 12:117236830-117236852 GTTCAAGAGGACTTTGGGGGAGG - Intronic
1103484843 12:121275667-121275689 GTTGCCTAGGACTATGGGGGTGG + Intronic
1103539148 12:121653997-121654019 GTTGCCTAGGACTATGGGGGTGG - Intronic
1104107315 12:125675155-125675177 GCTGGGCAGGACTTTGGTGGTGG + Intergenic
1104471268 12:129031821-129031843 ACTGACCAGGGCTGAGGGGGCGG - Intergenic
1107816523 13:44249684-44249706 TCTGAGCAGGAGTTTGGGGTGGG - Intergenic
1109582736 13:64363702-64363724 GCAGACAGGGACGTTGGGGGTGG - Intergenic
1114203108 14:20541513-20541535 GCTGTCCAGGAGTTTGAGGCAGG - Intergenic
1114424802 14:22612507-22612529 GCTGACCTGGACTCTGGGCTGGG - Exonic
1116909410 14:50443723-50443745 CCTTACCAGAACTTTTGGGGTGG + Exonic
1119082182 14:71705552-71705574 GATGACCAGACCTGTGGGGGTGG - Intronic
1122081926 14:99272666-99272688 TCGGACTTGGACTTTGGGGGTGG + Intergenic
1122135236 14:99628953-99628975 GGTGACCAGGACATCAGGGGAGG - Intergenic
1122787831 14:104172084-104172106 GCTGGCCAGGACGATGAGGGAGG - Intronic
1122887684 14:104717736-104717758 GCTGACCACGGCTGCGGGGGTGG + Intronic
1123153576 14:106204391-106204413 GCTCAGGAGGACTTTGGAGGTGG + Intergenic
1123436540 15:20258684-20258706 GGTTGCCAGGACTTAGGGGGAGG + Intergenic
1124070004 15:26382208-26382230 GCTGACCAGGTGTGTGGGGTGGG + Intergenic
1124428471 15:29584647-29584669 GCTGCCAGGGACTTTGGGGTGGG + Intergenic
1124786300 15:32684118-32684140 GCTGACCAGGAGATGGGGGTGGG + Intronic
1125242326 15:37589602-37589624 GGTTACCAGGGGTTTGGGGGAGG - Intergenic
1130033031 15:80333024-80333046 GCTGCCCAGGACCTTGGAGCTGG + Intergenic
1130995919 15:88904063-88904085 GATGACCATGACTTGGGGTGAGG - Intronic
1131057716 15:89385554-89385576 TCTGACCAGGACCTTAGAGGTGG + Intergenic
1132210353 15:100017359-100017381 CCTGGCCAGAACTTGGGGGGAGG - Intronic
1132498503 16:274805-274827 GCGGTCCAGGACTTTTGGGGAGG + Intronic
1132610036 16:811028-811050 GCTGCCCAGGGCTTTTGGGAGGG + Intronic
1132676463 16:1123240-1123262 GCTGCTCAGAACTTGGGGGGCGG - Intergenic
1132723179 16:1327058-1327080 GCTCCCCTGGGCTTTGGGGGTGG + Intergenic
1132903611 16:2271292-2271314 GCTGGCCAGGTCCATGGGGGTGG + Intergenic
1133013168 16:2925848-2925870 GCCGACCAGGCCTTCGGGAGTGG + Intronic
1133312464 16:4858721-4858743 ACTGACCAGGAAGCTGGGGGTGG + Intronic
1133894056 16:9908715-9908737 GCTGGCCAGGGCTGTGTGGGAGG + Intronic
1136043847 16:27600598-27600620 GCTCACCAGGAGAATGGGGGAGG - Intronic
1136355818 16:29744448-29744470 GCTCACCAGGCCTGTGGCGGGGG + Exonic
1136481996 16:30547908-30547930 GCTGACAAGGACGGTGGGAGAGG + Intronic
1136848031 16:33592169-33592191 GGTTGCCAGGACTTAGGGGGAGG - Intergenic
1137610004 16:49811760-49811782 GCTGACAGGGCCTCTGGGGGCGG - Intronic
1137626484 16:49912018-49912040 GTTGAACAGGACTTTTGGGAAGG + Intergenic
1137720753 16:50625989-50626011 GCTGCCCAGGAGCTTGGGGGTGG + Intronic
1138589085 16:57989834-57989856 TCTGACCAGGGCTTAGAGGGAGG + Intergenic
1139601861 16:67992183-67992205 GCTGACCAGAACTGGGGGGAAGG + Exonic
1139797321 16:69494086-69494108 GGTGACCAGGAGTTTAGGGGAGG + Intergenic
1140046022 16:71441165-71441187 GCTGTCGAGGACTGTGGGGGAGG - Intergenic
1140782153 16:78306663-78306685 GCTCATCAGGAATTTGGGGAAGG - Intronic
1141660084 16:85436878-85436900 GCGGCCCGGGACTGTGGGGGCGG + Intergenic
1142286157 16:89172332-89172354 GCTGGCCAGGAACTTGGGGTGGG - Intronic
1203109739 16_KI270728v1_random:1440818-1440840 GGTTGCCAGGACTTAGGGGGAGG - Intergenic
1143009298 17:3857192-3857214 GCTGAACAGGCCTTGGAGGGCGG + Intergenic
1143423686 17:6815850-6815872 GCTGACCCGTACCTTGGAGGAGG - Exonic
1144213445 17:13034363-13034385 ACTTTCCAGGACTTTGGTGGTGG + Intergenic
1144805889 17:17967292-17967314 TCTGACCAGAATATTGGGGGTGG - Intronic
1147967069 17:44199388-44199410 GCTGACCCAGACCTGGGGGGAGG + Intronic
1148758999 17:49989792-49989814 TCTGGGCAGGTCTTTGGGGGAGG - Intergenic
1148874484 17:50678586-50678608 GCTGAGCAGGTCTTTGTGGCTGG + Intronic
1149659537 17:58327103-58327125 AAGGAACAGGACTTTGGGGGAGG - Intronic
1150866775 17:68859223-68859245 GCAGTCCAAGACTTTGGTGGAGG + Intergenic
1151882645 17:76904406-76904428 GCCCACCTGGACTTTGGGGAGGG - Exonic
1152078243 17:78171443-78171465 GCTTTCCAGGACTCTGGGAGGGG - Intronic
1152931143 17:83110497-83110519 GCTGACGTGGTCTTTGGGTGGGG - Intergenic
1154120965 18:11652232-11652254 GTGGACCAGGAATTTGGGAGTGG - Intergenic
1157413356 18:47482144-47482166 TCTGACCTGGGCTTTGGGAGGGG - Intergenic
1157553416 18:48597025-48597047 GGAGACCAGGAATTTGGGGCAGG - Intronic
1159364032 18:67442697-67442719 GCTGACCAAAACTTTGTGTGGGG + Intergenic
1159787034 18:72726859-72726881 CCTGTCCAGAACTTGGGGGGAGG + Intergenic
1161268038 19:3374166-3374188 GCTGGCCTGGACTTTCAGGGTGG + Intronic
1161373678 19:3927918-3927940 GCTGACCAGGACTTTGGGGGAGG - Exonic
1161956979 19:7501519-7501541 GGTGGTCAGGACTTGGGGGGTGG + Intronic
1163260725 19:16188297-16188319 GATGACCAAGACTTTGGGCTGGG + Intronic
1163822198 19:19502419-19502441 GCTGACCAGGGCTGTGGCCGAGG - Exonic
1165032607 19:33009090-33009112 GGTTGCCAGGACTTAGGGGGAGG + Intronic
1165257817 19:34590215-34590237 GCTGTGCAGGACCTTGGAGGTGG - Intergenic
1166148754 19:40855439-40855461 GATGACAAGGATTTGGGGGGTGG + Intronic
1166152894 19:40887224-40887246 GATGACAAGGATTTGGGGGGTGG + Intronic
1166195368 19:41202337-41202359 GCTGACCTGGAATATGGGAGTGG + Intronic
1167142007 19:47658214-47658236 GTTGACCAGGATGTTGGGGCTGG + Intronic
925727156 2:6884261-6884283 GCGGACATGGACTGTGGGGGAGG + Intronic
926293958 2:11553828-11553850 GCTGAACAGGACCTTGGGCAGGG + Intronic
927700947 2:25268612-25268634 GCTGGCCAGGGCTGTGGGGAGGG - Intronic
931809477 2:65840935-65840957 GGTCACCAGGAGGTTGGGGGTGG - Intergenic
932701596 2:73996031-73996053 GCTGACCAAGACTGTAGGTGGGG - Intronic
932798941 2:74722429-74722451 GCTGAGCAGGACAGTGAGGGAGG + Intergenic
933751935 2:85608382-85608404 GCTGCTCAGGACTTTGGAGGTGG - Exonic
934993146 2:98935755-98935777 GCTGCCCAGGGCTTCGGCGGCGG + Intronic
938192419 2:129295836-129295858 GCTGTCCAGGGCTTTGGTGCAGG + Intergenic
938244903 2:129768736-129768758 CCTGATCAGGACTTGGGAGGCGG - Intergenic
938920663 2:135991730-135991752 GTTGCCCAGGACTTGGGGGAGGG - Intergenic
942762067 2:179411354-179411376 GCTGCACAGAACTTTGGAGGTGG + Intergenic
945097808 2:206236244-206236266 GCTGAGCAGGGCTATGCGGGAGG - Intergenic
946176582 2:217925799-217925821 GGTAACCAGGGGTTTGGGGGAGG - Intronic
948139395 2:235661514-235661536 GCTGGCCAGGGCTGTGGGGGTGG + Intronic
948601553 2:239110467-239110489 GCTGCCCAGGACTTGTGGAGTGG + Intronic
1168878526 20:1186667-1186689 GCTGCACAGAACTTTGGAGGAGG - Intronic
1169277642 20:4244325-4244347 GGTGACCAGGACCTGGGAGGAGG + Intronic
1169336260 20:4759812-4759834 CCTGGCCAGAACTTTGGGGAGGG - Intergenic
1172880760 20:38198526-38198548 GCTGCCCTGAACTTTGGGTGGGG + Intergenic
1172941308 20:38656584-38656606 GCTGGCCAGAACTGTGGGCGGGG + Intergenic
1173588870 20:44208846-44208868 GCTAAAGAGGACTTGGGGGGCGG - Intronic
1173755404 20:45511417-45511439 GCTGACTTGGACTTTGGGGGAGG + Intergenic
1173857648 20:46260984-46261006 GATTATCAGGAATTTGGGGGAGG - Intronic
1173904945 20:46619792-46619814 ACTGACCAGGACTTTAGGGTGGG - Intronic
1174625660 20:51912469-51912491 GTTGACCAGGAGTTTGGTGGGGG - Intergenic
1174902939 20:54520151-54520173 GATGACAAGGACTTACGGGGAGG - Intronic
1175870808 20:62208551-62208573 GCTGACGGGGACACTGGGGGTGG - Intergenic
1176215119 20:63944310-63944332 GGTGACCAGGCCACTGGGGGTGG + Intronic
1176389453 21:6156084-6156106 TCCCACCAGGAATTTGGGGGTGG - Intergenic
1176808612 21:13515624-13515646 GCTGACCAGCAGCTGGGGGGAGG - Intergenic
1179056509 21:37940649-37940671 GGTTACCAGGGGTTTGGGGGAGG - Intergenic
1179485721 21:41709382-41709404 GCTGCCAAGGAGTGTGGGGGTGG + Intergenic
1179734016 21:43382154-43382176 TCCCACCAGGAATTTGGGGGTGG + Intergenic
1179807333 21:43847973-43847995 GCTGATGAGGAGGTTGGGGGTGG + Intergenic
1181966020 22:26657332-26657354 CCTGGCCAGGACTCTGGGCGCGG + Intergenic
1182155301 22:28066491-28066513 GGTGACCAGAGGTTTGGGGGTGG - Intronic
1182254772 22:29030672-29030694 GCGGGCCGGGACTTTCGGGGCGG - Intronic
1182462097 22:30490390-30490412 GCTGTCCAGGACAGTGGGTGGGG + Intronic
1183010542 22:34943151-34943173 ACTGGCAGGGACTTTGGGGGAGG + Intergenic
1183441142 22:37823787-37823809 GCTGGGCAGGGCTGTGGGGGCGG + Intronic
1184527788 22:45035721-45035743 GCAGACAGGGACTTTGGGGCTGG - Intergenic
1184558791 22:45248990-45249012 GCTCACCAAAGCTTTGGGGGTGG - Intergenic
950207393 3:11091610-11091632 GATGACCTGGCCATTGGGGGTGG - Intergenic
950708224 3:14796969-14796991 GCTGCACAGCACTGTGGGGGAGG - Intergenic
952370542 3:32718741-32718763 AGTGACCAGAACTTTGGGGTGGG + Intronic
952872005 3:37909387-37909409 GCTGAGCAGGTCTTTCAGGGTGG + Intronic
954304788 3:49719825-49719847 GCTGACGGGGACTTTGGGGTTGG - Intronic
954381142 3:50219968-50219990 TCGCACCAGGATTTTGGGGGTGG - Exonic
954611424 3:51946479-51946501 GCTGTCCTGGGCTTTGGTGGCGG + Intronic
954797149 3:53167299-53167321 GCTGCCCAGGCCTTTTTGGGGGG + Intronic
955725931 3:61932745-61932767 TCTGACCAAGATTTTGGTGGTGG - Intronic
957971659 3:87390416-87390438 CCTGACCAGAACTTGGGGGAGGG + Intergenic
958813275 3:98887991-98888013 GGTTACCAGGGTTTTGGGGGAGG - Intronic
958853353 3:99355199-99355221 GCTGAGCAGTAGTGTGGGGGTGG - Intergenic
958933566 3:100233408-100233430 GATTGCCAGGGCTTTGGGGGAGG + Intergenic
962059626 3:131911847-131911869 CCTGACCTTGACTTTGGAGGTGG + Intronic
962971267 3:140404106-140404128 CCTGACCAGGTCTGCGGGGGTGG - Intronic
964771025 3:160224977-160224999 GCTGTCCCAGAGTTTGGGGGTGG - Intergenic
965104350 3:164339130-164339152 GCTCAGGAGGACTTTGGAGGTGG + Intergenic
966267507 3:178063917-178063939 TCTTACTAGGACTTTGGTGGTGG - Intergenic
967073305 3:185980933-185980955 TCCTCCCAGGACTTTGGGGGAGG + Intergenic
968007115 3:195250589-195250611 GAGGACCAGGAGTATGGGGGTGG - Intronic
972635059 4:40876988-40877010 GCTGACCACCACTATGGGTGGGG + Intronic
974024714 4:56723272-56723294 GCAGACCGGGAGCTTGGGGGCGG - Intergenic
977739585 4:100461985-100462007 GCTAACCAGGAATCTGGGAGAGG + Intronic
978103581 4:104873801-104873823 GATGACCTTGACTTTGTGGGAGG - Intergenic
979498494 4:121411660-121411682 GCTGGCCAGAACTCAGGGGGAGG - Intergenic
980567643 4:134564922-134564944 GATGTCCAGGGCTTTGGGGTTGG - Intergenic
983271947 4:165572630-165572652 GGTTGCCAGGAATTTGGGGGAGG - Intergenic
984133688 4:175910024-175910046 GCTGACCCTGACTTTCTGGGGGG + Intronic
990167569 5:53011501-53011523 GCTGAATAGGACTTTGAGGGAGG - Intronic
992323435 5:75636778-75636800 TGTGACCAGGACTTGGGGAGAGG + Intronic
992762977 5:79967970-79967992 ACAAACCAGGACTGTGGGGGAGG + Intergenic
994081408 5:95711749-95711771 GCTCAGGAGGACTTTGGAGGTGG + Intergenic
996070971 5:119131261-119131283 GCTAACCAGGAATTGGGGGAGGG + Intronic
996504849 5:124257510-124257532 CCTGGCCAGGACTTGGGGGAAGG - Intergenic
997283293 5:132661869-132661891 GCTGACCAGGGCCATGGGGAAGG - Intergenic
998343488 5:141439975-141439997 GCTGGCCAAGAGTTTGGTGGTGG + Intronic
999615333 5:153416912-153416934 GAGGATCAGGAATTTGGGGGCGG - Intergenic
1001036324 5:168299412-168299434 GCTAACCAGAGCTTTGGGGATGG + Intronic
1003096915 6:3149522-3149544 GCTGACCAGGCATTTGGGGATGG - Intronic
1003485375 6:6571524-6571546 GGTTACCAGGAACTTGGGGGAGG - Intergenic
1003729432 6:8804558-8804580 GCTTACCAGAATTTTGGGGTAGG + Intergenic
1006108234 6:31729269-31729291 GCAGACAAGGGCGTTGGGGGTGG + Exonic
1006637435 6:35470495-35470517 GCTCACCAGGCCACTGGGGGAGG + Intronic
1008670971 6:53768504-53768526 CTTTTCCAGGACTTTGGGGGTGG - Intergenic
1009692027 6:67047765-67047787 GCTGGTCAGGGCTTGGGGGGTGG - Intergenic
1009798459 6:68502589-68502611 CCTGACCAGAACTTGGGGGAGGG + Intergenic
1010076427 6:71803705-71803727 CCTGGCCAGAACTTTGGGGAGGG - Intergenic
1011356248 6:86475718-86475740 GCTCAGGAGGACTTTGGAGGTGG - Intergenic
1018421215 6:163642400-163642422 GCTGAGCACCACTTTGGGAGGGG + Intergenic
1018669582 6:166167758-166167780 GCGGACCAAGACTTGGGGGGAGG + Exonic
1020438335 7:8189752-8189774 GCAGACCAGGAGTGTGGGGAGGG + Intronic
1023738026 7:43251759-43251781 TCTGAGAAGGACTTTGTGGGTGG - Intronic
1024596632 7:50943421-50943443 GCTGAGCAGGGCTGTGGTGGAGG + Intergenic
1024621209 7:51159070-51159092 GCTGGCCAGGAGCTTGGAGGAGG + Intronic
1024707048 7:51972265-51972287 GGTGATCAGAACTTTGAGGGTGG + Intergenic
1024736196 7:52307603-52307625 GTTGCCCAAGACTTTGAGGGTGG + Intergenic
1029467372 7:100734696-100734718 GCTGAACAGGAATTAAGGGGCGG + Intronic
1030486621 7:110176667-110176689 GGTGACCAGGTTTTTGGGGTGGG + Intergenic
1033122157 7:138675854-138675876 ACAGAGCAAGACTTTGGGGGTGG - Intronic
1038689196 8:29745968-29745990 GCTGAAGTGGAATTTGGGGGAGG + Intergenic
1039372543 8:37001379-37001401 ACTCTCCAGGACTTTGGTGGAGG - Intergenic
1039921147 8:41895613-41895635 TCTGACCAGGCCTTTGGGCCAGG + Intronic
1040111164 8:43567775-43567797 GGTGGCCAGGCCTTCGGGGGAGG - Intergenic
1046378911 8:113427412-113427434 TCTGATCAGGATTTTGGGGTAGG + Intronic
1047325168 8:123829096-123829118 GCTGAAAAGGATGTTGGGGGTGG + Intergenic
1049434968 8:142582271-142582293 ACTGACCAGGGCTCTGGGGAGGG + Intergenic
1049967225 9:790652-790674 GGTGAACATGAATTTGGGGGTGG + Intergenic
1050107503 9:2180831-2180853 ACTTACCATGAATTTGGGGGAGG + Intronic
1050556550 9:6794360-6794382 GCTGACCTGTACTTTGTGGCTGG + Intronic
1050985620 9:12078467-12078489 GGTTGCCAGGATTTTGGGGGTGG + Intergenic
1052901363 9:33797304-33797326 GCTGATCAGAACCTTGGGGATGG - Intronic
1055323334 9:75103179-75103201 GCTGCCCAGGAGTTTGAGGCAGG + Intronic
1056278688 9:85018583-85018605 GGTGCCCAGGACTTTGGGAGAGG - Intronic
1057076382 9:92140374-92140396 GCTCACCAGGGCTCTGGGGCCGG + Intergenic
1057564556 9:96156321-96156343 GCTGGCCTGGATTCTGGGGGTGG - Intergenic
1058157469 9:101531626-101531648 GCTGACTAGGACTTTGGCTTGGG + Intronic
1060170703 9:121458808-121458830 GCTGAGCAGGACTTGGGAGGTGG - Intergenic
1060506049 9:124199154-124199176 GCTGCCCAGGTCTTAGGGGCTGG - Intergenic
1060523169 9:124305787-124305809 GATGATCAGGAATTTGGGGTGGG + Intronic
1060729279 9:126027115-126027137 GGTCACAAGGACATTGGGGGAGG - Intergenic
1062270200 9:135704752-135704774 GCTGGCCAGGACCTTGGGCCAGG - Intronic
1192803781 X:74492739-74492761 GCTTAGCTGGACGTTGGGGGTGG - Intronic
1195985183 X:110621822-110621844 CCTGACCAGAACTTGGGGGAGGG - Intergenic
1198022420 X:132671990-132672012 ACTGACCTGGATTTTGGTGGAGG - Intronic