ID: 1161373680

View in Genome Browser
Species Human (GRCh38)
Location 19:3927922-3927944
Sequence GGCTGCTGACCAGGACTTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161373680_1161373687 3 Left 1161373680 19:3927922-3927944 CCCCAAAGTCCTGGTCAGCAGCC 0: 1
1: 0
2: 2
3: 19
4: 291
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161373680 Original CRISPR GGCTGCTGACCAGGACTTTG GGG (reversed) Exonic
900616190 1:3566709-3566731 GGCAGCTGACCTGGACTCTGTGG - Intronic
901290726 1:8122271-8122293 GGCTTCTGAGCTGGACTTGGGGG + Intergenic
901828742 1:11879467-11879489 AGCTGCTGTGCAGGTCTTTGTGG + Intergenic
903503248 1:23813899-23813921 GGCTTGAGACCAGGAGTTTGAGG - Intronic
903832280 1:26182503-26182525 GGCAGCAGACCAGGATGTTGTGG - Exonic
904048387 1:27623206-27623228 GGCTGGGGAACAGGAATTTGGGG - Intronic
904629553 1:31830661-31830683 GGCTGCAGCCCAGGACTTAGAGG - Intergenic
904814896 1:33188468-33188490 TGCTGCTGATCATGACATTGTGG + Intergenic
905830709 1:41064829-41064851 CGCTTCTGCCCAGGAGTTTGAGG + Intronic
905852775 1:41286531-41286553 GGCTGCTGGCCTGGACAGTGGGG + Intergenic
906618900 1:47257409-47257431 GGCTTCAGCCCAGGAGTTTGAGG + Intronic
907732567 1:57081728-57081750 GGAGGCTGACCTGGGCTTTGAGG + Intronic
908528824 1:65013503-65013525 TGCTGCTGACCAGTACAATGAGG + Intergenic
909673510 1:78214202-78214224 GCCTCCTGACCAGAACTTGGGGG + Intergenic
912834714 1:112986106-112986128 TGCAGCTGTCCAGGGCTTTGGGG - Intergenic
915401589 1:155625893-155625915 AGCTGCGGCCCAGGAGTTTGGGG - Intergenic
917758741 1:178132122-178132144 GGCTACAGCCCAGGAGTTTGAGG - Intronic
917796231 1:178534651-178534673 GCCTGCTCACCAGGCCTTGGTGG + Intronic
919172235 1:193969330-193969352 GGCTTGAGACCAGGAGTTTGAGG + Intergenic
921574764 1:216821599-216821621 GGCTTGTGCCCAGGAGTTTGAGG + Intronic
923137596 1:231132076-231132098 TGCTTCAGCCCAGGACTTTGAGG + Intergenic
924638029 1:245807234-245807256 TGCTGCTGACCAGGTCTCTCTGG + Intronic
924949812 1:248872236-248872258 CGCTTCTGCCCAGGAGTTTGAGG - Intergenic
1063009819 10:2011333-2011355 AGGTGCTGACCAGGACTCTCAGG + Intergenic
1063671167 10:8101422-8101444 AGCTGTTGACCAGGGATTTGGGG - Intergenic
1064173065 10:13051007-13051029 GGCTTGAGACCAGGAGTTTGAGG - Intronic
1064695680 10:17963075-17963097 GGCTTGTGCCCAGGAGTTTGAGG + Intronic
1069221593 10:65890192-65890214 TGCTTCTGGCCAGCACTTTGTGG + Intergenic
1069468932 10:68668899-68668921 TGCTGTTGCCCAGGAATTTGAGG + Intronic
1070362298 10:75702431-75702453 GGCTGTGGACCAAGACTTTAGGG + Intronic
1070806275 10:79272929-79272951 GGCTGGTGCCGAGGACCTTGGGG - Intronic
1072661615 10:97366851-97366873 GGATGTTGACCAGGACTCTGTGG + Exonic
1073214315 10:101828249-101828271 GCCTCCTTCCCAGGACTTTGTGG - Exonic
1073938762 10:108668855-108668877 GGGTGCTAACCATGACTTTAAGG - Intergenic
1076313400 10:129523843-129523865 GGCTTCTGACAAGCACATTGTGG - Intronic
1077434343 11:2531588-2531610 TCCTGCTGACCAGGGGTTTGTGG - Intronic
1079085685 11:17443213-17443235 GGCTCCTGTCCAGTACTTCGTGG - Exonic
1079404294 11:20131459-20131481 GGCTTGAGCCCAGGACTTTGAGG - Intergenic
1080101330 11:28463245-28463267 GGCTCTTGACCAGTACTTTTTGG - Intergenic
1080566527 11:33514667-33514689 GTCTCCTGAGCATGACTTTGAGG - Intergenic
1080795619 11:35560258-35560280 GGGTCATGATCAGGACTTTGGGG + Intergenic
1081935751 11:46902915-46902937 GGCTGCTGGCCAGGCCTGGGCGG + Exonic
1082903841 11:58285088-58285110 GTCTCCTGGCCAGAACTTTGGGG + Intergenic
1082916790 11:58446291-58446313 GCCTCCTGGCCAGAACTTTGGGG + Intergenic
1083767537 11:64849032-64849054 GGCTGATTCTCAGGACTTTGAGG - Intergenic
1084293654 11:68195091-68195113 GGCTGCAGCCCAGGAAATTGCGG + Intronic
1084479049 11:69407534-69407556 CGCTTCAGCCCAGGACTTTGAGG + Intergenic
1084763241 11:71287621-71287643 GGCTGCTGTTCAGGCATTTGGGG + Intergenic
1085018824 11:73192388-73192410 GGCTCTTGGGCAGGACTTTGTGG - Intergenic
1085023564 11:73223711-73223733 GGGTGGTGTCCAGGACGTTGTGG + Intronic
1085371599 11:76012100-76012122 TGCTTGTGACCAGGAGTTTGAGG + Intronic
1085747748 11:79129367-79129389 GGCTCCTGGCCAGAACTTGGGGG + Intronic
1087152447 11:94870720-94870742 AGCTGCTGACCCGGCCTCTGTGG - Exonic
1087841157 11:102922485-102922507 GGCTGCTGGCCTGGAGGTTGGGG - Intergenic
1087977695 11:104569967-104569989 GGCTTGAGCCCAGGACTTTGAGG + Intergenic
1088930883 11:114349515-114349537 AGCTGCAGCCCAGGAGTTTGGGG - Intergenic
1088981450 11:114867943-114867965 GGCTTCAGCCCAGGAGTTTGAGG + Intergenic
1089281608 11:117378835-117378857 GGCTGCAGACCATGGCTTTCTGG - Intronic
1090908411 11:131097061-131097083 GGCTGCTGAGCAGGAGGCTGAGG - Intergenic
1091108291 11:132943127-132943149 GGCGGGGGACCAGGACTGTGCGG - Exonic
1091150179 11:133321082-133321104 GACTGGTGACCAGAACTTGGGGG + Intronic
1091795564 12:3295714-3295736 GGCTGCTGGCCTGGACATGGAGG + Intergenic
1094485831 12:30925816-30925838 GGCTGCTGAGAAGGGCTTCGCGG - Intergenic
1096137851 12:49217615-49217637 GGCTTGAGACCAGGAGTTTGAGG - Intronic
1096609291 12:52790344-52790366 TGCTGCTGACCACGGCTGTGGGG + Exonic
1096683006 12:53269344-53269366 GGCTGCTCCCCAGGACTATGAGG + Exonic
1096716779 12:53496130-53496152 GGCTGGACACCAGGTCTTTGTGG + Intronic
1097836231 12:64275543-64275565 GGCTTGTGCCCAGGAGTTTGAGG - Intronic
1101420144 12:104544038-104544060 GGCTGGAGCCCAGGAGTTTGAGG + Intronic
1101632440 12:106508379-106508401 GGGTGCTGACCAGGAATTGAAGG - Intronic
1102405917 12:112674139-112674161 TGCTTGTGACCAGGAGTTTGAGG - Intronic
1102839527 12:116103334-116103356 GGCTTCAGCCCAGGAGTTTGAGG - Intronic
1103489751 12:121307987-121308009 GGCTGCTCACGAGGACTTGTTGG - Intergenic
1103964788 12:124631898-124631920 GGCTGGTGGACAGGACTTCGGGG + Intergenic
1104744942 12:131204622-131204644 GGCTGCAGACCTGGACTGAGAGG - Intergenic
1104782132 12:131428670-131428692 GGCTGCTGGCCAGGACAGGGAGG + Intergenic
1105610461 13:21964873-21964895 GGCTGCTGACCCGGACGCTGGGG + Intergenic
1108316049 13:49238729-49238751 GGCAGCTGCCCAGGACATTGTGG - Intergenic
1109414722 13:62023632-62023654 GGCTTGTGCCCAGGAGTTTGAGG + Intergenic
1110495644 13:76164409-76164431 GGCTGGAGACCAGGATTTTCTGG + Intergenic
1113796443 13:113061379-113061401 GGCAGCTGACCAGGGCTCTCCGG - Intronic
1114852548 14:26398805-26398827 GGCTGGAGCCCAGGAGTTTGAGG - Intergenic
1117122629 14:52584693-52584715 GGCTTCAGCCCAGGAGTTTGAGG - Intronic
1117150286 14:52880171-52880193 GGCTTGAGTCCAGGACTTTGAGG + Intronic
1118761963 14:68885456-68885478 GGCTGCCCACCAGGACCGTGTGG - Exonic
1121476690 14:94214419-94214441 GGCTGGGGCCCAGGAGTTTGAGG + Intronic
1121732396 14:96195516-96195538 GGCTGCAGACCAGGGCACTGGGG + Intergenic
1122326289 14:100882520-100882542 GGAAGCGGACCAGGACTTGGCGG + Exonic
1122961877 14:105097692-105097714 GGGTGCTGACCAGGCCTGTCAGG - Intergenic
1202937339 14_KI270725v1_random:102930-102952 GGGAGGTGACCAGGTCTTTGGGG + Intergenic
1125925849 15:43562505-43562527 GGCTGCTGAACAGTACTTCGGGG + Intronic
1125938993 15:43662056-43662078 GGCTGCTGAACAGTACTTCGGGG + Intronic
1126112433 15:45183611-45183633 GGCTGGGGCCCAGGACTTGGAGG - Intronic
1127342750 15:58065262-58065284 GGCTCCTGCCCCGGACTCTGAGG - Intronic
1127886585 15:63206836-63206858 GGGGGCAGAGCAGGACTTTGAGG - Intronic
1130171156 15:81516084-81516106 GGCTGCTCATCAGGACCTTATGG - Intergenic
1130353839 15:83112592-83112614 GGCTGCAGCCCATGACTTTCAGG - Intronic
1130880002 15:88046712-88046734 GGCTGCTGTCCAGGTGTGTGGGG - Intronic
1131522351 15:93126075-93126097 GGTGGCTGGACAGGACTTTGTGG + Intergenic
1132184087 15:99788688-99788710 TGCTTCTGCCCAGGAATTTGAGG - Intergenic
1132434281 15:101784469-101784491 TGCTTCTGCCCAGGAATTTGAGG + Intergenic
1134038915 16:11052975-11052997 GGCTGGAGCCCAGGAGTTTGAGG - Intronic
1135287924 16:21210066-21210088 GTCTGCTAATCAGGACTATGAGG + Intronic
1136494221 16:30632085-30632107 GGCTGGAGCCCAGGAATTTGAGG - Intergenic
1137566215 16:49534052-49534074 GTCTTCAGCCCAGGACTTTGAGG + Intronic
1138589083 16:57989830-57989852 GGCATCTGACCAGGGCTTAGAGG + Intergenic
1139148184 16:64347529-64347551 GGCTGCTGCACTGGACATTGTGG + Intergenic
1139215888 16:65123556-65123578 GGCTGGTGACCAGGAGCTGGAGG - Intronic
1139496288 16:67321105-67321127 GGCTTGAGACCAGGAGTTTGAGG + Intronic
1139518551 16:67466095-67466117 AGATGCTGACCAGGAGTCTGAGG - Intronic
1139614119 16:68078866-68078888 GGCTCCTGACCAAGACCCTGGGG + Exonic
1139969303 16:70763788-70763810 GGCTGCTTAGCAGAACTTTGGGG - Intronic
1140580171 16:76222255-76222277 GCATTCTGACCTGGACTTTGGGG - Intergenic
1140742996 16:77958124-77958146 GACTTCTGCCCAGGAGTTTGAGG - Intronic
1141744391 16:85915738-85915760 GTCTGCTGACCAGTGCTTTCCGG + Intronic
1141818145 16:86426788-86426810 GGCTGGGGCCCAGGACTCTGTGG - Intergenic
1142688348 17:1590814-1590836 CGCCGCTGACCAGGAACTTGAGG + Exonic
1142740294 17:1928056-1928078 GGCTCCAGCCCAGGAGTTTGAGG - Intergenic
1143009296 17:3857188-3857210 AGCTGCTGAACAGGCCTTGGAGG + Intergenic
1143852289 17:9821984-9822006 GGCTGCTGACCACGGCGGTGAGG + Exonic
1144458567 17:15438957-15438979 GGTTGCTGGCCAGAAGTTTGGGG + Intronic
1146463333 17:33065533-33065555 GGCTTCAGGCCAGGAGTTTGAGG - Intronic
1146603738 17:34240386-34240408 GCCTTCTGACCAGGGTTTTGTGG + Intergenic
1147753161 17:42749714-42749736 GGCTGCTGCCCAGGACTTGGTGG + Intergenic
1148971422 17:51486214-51486236 GGCTGCTCTCCAGGTCTGTGTGG - Intergenic
1149792037 17:59487357-59487379 GGTTGCTGACTACGTCTTTGTGG - Intergenic
1150429495 17:65103725-65103747 GGCTGGAGCCCAGGAGTTTGAGG + Intergenic
1151674998 17:75592705-75592727 GGAGGATGCCCAGGACTTTGAGG + Intergenic
1152017702 17:77762510-77762532 GGCTGGAGTCCAGGAGTTTGAGG - Intergenic
1152657545 17:81527068-81527090 GGTTGCTGTCCAGGGCTTAGAGG + Intergenic
1153807562 18:8722338-8722360 TGCTTGTGCCCAGGACTTTGAGG + Intronic
1155978503 18:32157307-32157329 GGCTGGAGCCCAGGAGTTTGAGG - Intronic
1156516861 18:37687543-37687565 GGCTGGTGTCCAGAACATTGAGG - Intergenic
1157134539 18:45040889-45040911 GGCTGTTGAGCTGGACTTTTGGG + Intronic
1158963273 18:62603653-62603675 AGCTTGTGACCAGGAATTTGAGG + Intergenic
1161373680 19:3927922-3927944 GGCTGCTGACCAGGACTTTGGGG - Exonic
1161621908 19:5302278-5302300 TGCTTGTGACCAGGAGTTTGAGG + Intronic
1161751885 19:6104118-6104140 TGTTGCAGACCAGGGCTTTGGGG - Intronic
1162944757 19:14035862-14035884 GGCTGGAGCCCAGGAGTTTGAGG - Intronic
1163313403 19:16527275-16527297 GGCTCCTGGCCAGCACTTGGAGG + Intronic
1163700954 19:18786267-18786289 GGATGTGGACCACGACTTTGTGG - Exonic
1163849434 19:19654957-19654979 GGCTGACACCCAGGACTTTGTGG + Intronic
1164752644 19:30668261-30668283 GGCTCCTGACCTTGAGTTTGAGG + Intronic
1165370621 19:35403469-35403491 GGATGCTGACAAGGACAGTGTGG + Intergenic
1165423226 19:35732510-35732532 TGCTGCTGACCTGGACTTCGCGG + Exonic
1166999767 19:46738986-46739008 GGCTGCTGCCCATTACTGTGGGG - Intronic
1167418636 19:49390170-49390192 GGCAGCTGCCCAGGGCTGTGTGG + Intronic
925010235 2:479438-479460 GGCTGGTGGCCAGGCTTTTGTGG - Intergenic
925026467 2:611280-611302 GATTGCTGACTAGGACTTTCAGG - Intergenic
925686884 2:6482039-6482061 GGGTGCTGACGATGACTTGGAGG - Intergenic
925765185 2:7226794-7226816 AGGTGCTGACTAAGACTTTGTGG - Intergenic
928167435 2:28981380-28981402 GGCTGCGGCCCAGGACTGTGTGG + Exonic
928785239 2:34876249-34876271 GGCTGCTGACTAGGAAATTCAGG - Intergenic
928966153 2:36977387-36977409 CGCTGCAGCCCAGGAGTTTGTGG + Intronic
929778145 2:44941264-44941286 GCCTGCCGACCTGGACTATGTGG + Intergenic
931228873 2:60357179-60357201 GGCTGGGGACCAGGACTTGGGGG - Intergenic
932814054 2:74847619-74847641 GGCTGCAGCCTAGGAGTTTGAGG + Intronic
934463368 2:94235799-94235821 GGCTTGAGACCAGGAGTTTGAGG - Intergenic
936097324 2:109540715-109540737 TGCTGGAGACCAGGAGTTTGAGG + Intergenic
937034659 2:118770991-118771013 GGCTGCTTAAGAAGACTTTGAGG + Intergenic
941987321 2:171522387-171522409 GGCTGCTGGCCCGGAATGTGGGG - Exonic
942694064 2:178618815-178618837 GACAGCTGACCAAGACCTTGTGG - Exonic
945155148 2:206830301-206830323 GGCTGGAGCCCAGGAGTTTGAGG + Intergenic
945882983 2:215345794-215345816 GGCGGCTGCCCAGGTATTTGTGG + Intronic
946918413 2:224551138-224551160 GGCTGAGGCCCAGGAGTTTGAGG - Intronic
947411496 2:229845510-229845532 GGTTACTGACCCAGACTTTGAGG + Intronic
948528456 2:238587940-238587962 GGCTGGTCTCCAGGACTGTGAGG - Intergenic
949028705 2:241778143-241778165 GGCTGCTGTCCAGGGCTGTGGGG - Intronic
949050344 2:241894553-241894575 GGCTGCTGACCAGTGGTTGGTGG + Intronic
1170449085 20:16463139-16463161 GGCTCCTGAGCAGGTCTTTTAGG - Intronic
1172064446 20:32209031-32209053 GACTCCTGACCATGACTTTCAGG + Intronic
1172381077 20:34492311-34492333 GCCTGCTGCCCAGGAGTTAGAGG + Intronic
1172600319 20:36178534-36178556 GGCTGCTGACCAGCCATTTCAGG + Intronic
1173755402 20:45511413-45511435 AGCAGCTGACTTGGACTTTGGGG + Intergenic
1173833962 20:46113056-46113078 GGCTGCTACCCAGGACGGTGTGG + Intergenic
1173993985 20:47323871-47323893 GGCAGATGACTAGGACTCTGAGG - Intronic
1174188617 20:48724126-48724148 GCCTGCTGAGAAGGATTTTGGGG - Intronic
1174731863 20:52925740-52925762 GGCTGGAGCCCAGGATTTTGTGG - Intergenic
1175978051 20:62723425-62723447 GGCTCCTGACCAGCACATTCCGG - Intronic
1175985396 20:62761926-62761948 GGCTGATGACCAGGCTTGTGGGG - Exonic
1176261070 20:64180614-64180636 GCCAGTTGCCCAGGACTTTGGGG + Intronic
1176955008 21:15092105-15092127 GGCTTGAGCCCAGGACTTTGAGG + Intergenic
1178934846 21:36852464-36852486 GGCTGCTGACCAGAATTGTCTGG - Intronic
1180796882 22:18610280-18610302 GGCTGCTGGCCAAGGCGTTGTGG - Exonic
1180871848 22:19150760-19150782 GGCTGCGGTCCAGGAGTTTCGGG - Intergenic
1180942198 22:19666620-19666642 GGCTGCTGGCCTGGCCTGTGGGG + Intergenic
1181145133 22:20840383-20840405 GGCTTCTGACCTGGCCTGTGGGG - Intronic
1181177070 22:21043980-21044002 GGCACCTGAACAGGACTTTCAGG - Intergenic
1181224842 22:21384991-21385013 GGCTGCTGGCCAAGGCGTTGTGG + Exonic
1181253790 22:21549822-21549844 GGCTGCTGGCCAAGGCGTTGTGG - Exonic
1181541199 22:23574140-23574162 GGCTGCTCCCCCAGACTTTGGGG + Intronic
1182273188 22:29168741-29168763 GGCTGCTGCCCAGGGCCTTGTGG - Intergenic
1183472385 22:38016536-38016558 GGCTGCTTGGCAGGACTTGGTGG + Intronic
1183663628 22:39235193-39235215 GGCTGCTGACCAGGGCTCCAGGG + Intronic
1184150266 22:42633858-42633880 GGCTTGTGCCCAGGAGTTTGAGG + Intronic
1184287293 22:43478776-43478798 TGCTGGTAGCCAGGACTTTGCGG + Intronic
950701655 3:14754443-14754465 TGCTACTGAGCAGGGCTTTGAGG + Intronic
952632565 3:35487266-35487288 GGCTGCTGTGCTGGACTTTCAGG - Intergenic
957971656 3:87390412-87390434 GTCTCCTGACCAGAACTTGGGGG + Intergenic
959081200 3:101802956-101802978 GGCTGGAGCCCAGGAGTTTGAGG + Intronic
961364401 3:126390104-126390126 CGCTGTTGACGAGGACTTTCGGG - Intergenic
961886636 3:130101057-130101079 GGCTTAAGCCCAGGACTTTGTGG - Intronic
962809396 3:138947880-138947902 GGCTGTTGCCCGGGACTTTGCGG + Intronic
962901500 3:139765827-139765849 GGCAGGTGCCCATGACTTTGGGG + Intergenic
966883242 3:184361544-184361566 GGCTGCCGGCGCGGACTTTGCGG - Exonic
968770357 4:2501716-2501738 TGCTGCTGAGGAGGACTGTGGGG + Intronic
969289123 4:6227431-6227453 AGCTGCTGACCAGAGCTCTGAGG + Intergenic
972240534 4:37187241-37187263 GGCTGCCTAGCAGGAGTTTGGGG + Intergenic
973547003 4:51992075-51992097 AGTTGCTGACCATCACTTTGAGG + Intergenic
974061686 4:57041617-57041639 CGCTGGAGACCAGGAGTTTGAGG - Intronic
974258203 4:59489218-59489240 GGATGGTTACCAGGTCTTTGAGG + Intergenic
979612485 4:122703930-122703952 GGCTTCAGCCCAGGAGTTTGAGG - Intergenic
980107760 4:128604095-128604117 GGCTTCAGCCCAGGAGTTTGAGG + Intergenic
981606347 4:146545458-146545480 GGCTGCCCACCACAACTTTGGGG + Intergenic
983848609 4:172550679-172550701 GGCTGGAGCCCAGGAGTTTGAGG - Intronic
984792152 4:183624816-183624838 GGCTGCTGTGAAGGACTGTGTGG + Intergenic
985606289 5:859896-859918 AGCTGCTGACGCTGACTTTGGGG + Intronic
986748491 5:10764060-10764082 AGCTGCTGACCACCACTTTCAGG - Intergenic
988921665 5:35947922-35947944 GGCTGGAGCCCAGGAGTTTGAGG + Intergenic
988963263 5:36390674-36390696 GGCTGCTGTCTTGGTCTTTGGGG + Intergenic
989261285 5:39422701-39422723 AGCTGCTGACCAGCTGTTTGGGG - Intronic
990167571 5:53011505-53011527 GGAAGCTGAATAGGACTTTGAGG - Intronic
990949357 5:61281276-61281298 GGCTGCTGAGTGGGACTTTGGGG - Intergenic
992654456 5:78894800-78894822 GGCTGCTGCCCAGGACTCTGGGG - Intronic
995242142 5:109897812-109897834 GGCTGCTTACCACCACTTTTGGG - Intergenic
995373483 5:111447829-111447851 GGCTGCCCAGCAGGACTTTCAGG - Intronic
996504852 5:124257514-124257536 GCCTCCTGGCCAGGACTTGGGGG - Intergenic
996659170 5:125979311-125979333 GGCAGCAGCCCAGGACTCTGTGG - Intergenic
997283294 5:132661873-132661895 AGCTGCTGACCAGGGCCATGGGG - Intergenic
997873264 5:137523764-137523786 TGCTGCAGCCCAGGAGTTTGAGG + Intronic
998597537 5:143548845-143548867 TGGTGCTTACCAGGACTTTCTGG - Intergenic
1002324720 5:178396870-178396892 GGCTCCTGCCCAGGACTGTTTGG + Intronic
1002456311 5:179346906-179346928 GGTTGCTAAGCAGGACTGTGGGG - Intergenic
1002858453 6:1058493-1058515 GTCTGCTGACCAGCACGCTGTGG - Intergenic
1003065023 6:2897040-2897062 TGCTGGAGCCCAGGACTTTGAGG + Intronic
1006101494 6:31688761-31688783 GCCTGGTGACCAGGACCGTGAGG - Exonic
1006278821 6:33029734-33029756 GGCTTCTGAACAGGGCTGTGAGG - Intergenic
1007435354 6:41806516-41806538 GCCTGCTGGCCAGGACGCTGCGG - Exonic
1007717174 6:43864115-43864137 GGGTGCTGAGCAGCACTTTGGGG + Intergenic
1008504572 6:52217153-52217175 TTCTGCTGTCCAGGACTTTGTGG + Intergenic
1008906091 6:56679360-56679382 GGTTGCAGACCTGGAATTTGTGG - Intronic
1009798455 6:68502585-68502607 GCCTCCTGACCAGAACTTGGGGG + Intergenic
1010274052 6:73948690-73948712 GGCTGCTGACCAGGGATCTTAGG - Intergenic
1011698273 6:89932665-89932687 GGGTGCTGAGCAGAACATTGCGG - Exonic
1013172469 6:107649066-107649088 GGCTGAGGCCCAGGAGTTTGAGG + Intronic
1013185490 6:107754061-107754083 GGCTGCTGAGCAGCACTGAGGGG + Intronic
1013565007 6:111349648-111349670 TGCTTGTGACCAGGAGTTTGAGG - Intronic
1014190854 6:118495170-118495192 GGCTTCTGACTTGGACTTTCGGG + Intronic
1015142944 6:129956207-129956229 GTATGCTGCCCAGGAGTTTGAGG + Intergenic
1019109066 6:169695267-169695289 GGTTGCTGAAGAGGAATTTGAGG + Intronic
1019305090 7:330286-330308 GGCTTCAGCCCAGGACGTTGAGG + Intergenic
1023745276 7:43317307-43317329 GGCTGCTGTCCAGGCCATGGCGG - Intronic
1025170948 7:56756111-56756133 TGCTGGTGTCCAGGAGTTTGAGG - Intergenic
1025700932 7:63819587-63819609 TGCTGGTGTCCAGGAGTTTGAGG + Intergenic
1026112987 7:67473247-67473269 GGCTTATGCCCAGGAGTTTGAGG - Intergenic
1026220374 7:68391267-68391289 AGCTGGTCACCAGGACTTGGTGG + Intergenic
1026344655 7:69463831-69463853 GGCTGGAGGCCAGGAGTTTGAGG - Intergenic
1026880103 7:73902363-73902385 GGCTCCGGACCAGGAAGTTGGGG + Intergenic
1026933994 7:74241462-74241484 GGCTGGTAGCCATGACTTTGTGG + Intronic
1026973748 7:74483624-74483646 GGCTGGAGTCCAGGAATTTGAGG + Intronic
1026978248 7:74511901-74511923 GGCTGCAGACCTCGACTCTGGGG + Intronic
1027125791 7:75555917-75555939 GGCTGCTGAGAAGGGGTTTGGGG - Intronic
1027218638 7:76200393-76200415 GGCTTCAGCCCAGGAGTTTGAGG + Intergenic
1028723834 7:94064645-94064667 TGCTGCTGATAAGGACTTTCAGG + Intergenic
1029113992 7:98228102-98228124 TGCTGCTGGCCAGGCCTGTGGGG + Exonic
1029133328 7:98350258-98350280 GGCTGCTGACCAGACCATTCAGG + Intronic
1029526954 7:101100570-101100592 GGCTGCTCACCAAGGCTGTGGGG - Intergenic
1029945858 7:104532198-104532220 GGCTTGAGCCCAGGACTTTGAGG - Intronic
1031270408 7:119642247-119642269 GGCTGCTGAAGCTGACTTTGTGG - Intergenic
1031501779 7:122526795-122526817 ATCTGCTGGCCATGACTTTGTGG - Intronic
1032162929 7:129524638-129524660 GGCTTCTGCCCAGGAGGTTGAGG - Intergenic
1032797529 7:135289658-135289680 TGCTGCTGAAATGGACTTTGTGG + Intergenic
1033422840 7:141218353-141218375 GGCAGGAGACCAAGACTTTGTGG + Intronic
1034331588 7:150287846-150287868 GGATGTTGACCAGGCCTGTGAGG - Intronic
1034666451 7:152822021-152822043 GGATGTTGACCAGGCCTGTGAGG + Intronic
1035948524 8:3992695-3992717 GGCTTCAGTCCAGGAGTTTGAGG + Intronic
1039915043 8:41853842-41853864 CGCTGGTGCCCAGGAGTTTGAGG - Intronic
1041063570 8:54059835-54059857 TGCTGGAGACCAGGAATTTGAGG + Intronic
1041694448 8:60720932-60720954 GGCTGCTGAGCAGGGCTCTAAGG - Intronic
1045136653 8:99227908-99227930 TGCTGCTGACCCAGACTCTGGGG + Intronic
1046416749 8:113925644-113925666 TTATGCTGACTAGGACTTTGAGG - Intergenic
1046773604 8:118140488-118140510 TGCTGGTGTCCAGGAGTTTGAGG - Intergenic
1048019683 8:130526923-130526945 GGCTTGTGCCCAGGAGTTTGAGG + Intergenic
1048181820 8:132202117-132202139 GGGTGCTGTGCTGGACTTTGGGG + Intronic
1048355467 8:133650333-133650355 AGCTCCTGGCCAGGACCTTGTGG + Intergenic
1049108954 8:140630968-140630990 GGCTTGTGCCCAGGAGTTTGAGG + Intronic
1049434965 8:142582267-142582289 GGCCACTGACCAGGGCTCTGGGG + Intergenic
1049795015 8:144493230-144493252 GGCAGCTGGCCTGGGCTTTGAGG + Intronic
1050556549 9:6794356-6794378 GGAGGCTGACCTGTACTTTGTGG + Intronic
1051808785 9:21027277-21027299 GGCCTCTGATCAGGACTTTTGGG + Intronic
1054361869 9:64130167-64130189 GGCTTCTGACCATGTCTTAGAGG - Intergenic
1056018891 9:82421612-82421634 GGCTGCTGACAATCGCTTTGGGG - Intergenic
1056328842 9:85504998-85505020 GGCTTCAGCCCAGGAGTTTGAGG - Intergenic
1056794938 9:89651794-89651816 AGCTGCTGAGCAGGAGTTTGAGG - Intergenic
1056985355 9:91359543-91359565 GGAGACTGCCCAGGACTTTGAGG - Intronic
1057453861 9:95190049-95190071 AGCTCCTCACCAGGACTTTTGGG - Intronic
1057633182 9:96737426-96737448 GGCTGCTGCTCAGTCCTTTGGGG + Intergenic
1059173278 9:112146717-112146739 CGCTGGAGCCCAGGACTTTGAGG - Intronic
1059517318 9:114907959-114907981 GACTGCTGTCCGGGAGTTTGGGG + Intronic
1060268912 9:122127760-122127782 GGCTGGTGAACAGAACTGTGGGG + Intergenic
1060638667 9:125220472-125220494 GGCTTCTGACCTTGACTCTGGGG - Intronic
1061741682 9:132711194-132711216 GTCTGCGGACCTGAACTTTGAGG - Intergenic
1186562377 X:10626421-10626443 GGCTCGTGCCCAGGAGTTTGAGG - Intronic
1187076642 X:15942038-15942060 GGATGCTAACCTGAACTTTGAGG - Intergenic
1187950932 X:24469555-24469577 GGCTTGAGACCAGGAGTTTGAGG + Intronic
1188454589 X:30348670-30348692 GGCTGGAGACCAGTAGTTTGAGG + Intergenic
1190449698 X:50566180-50566202 GACAGCTGGCCAGGTCTTTGGGG + Intergenic
1192213655 X:69143199-69143221 GGCAGCTGACAAGGACCATGGGG + Intergenic
1195094950 X:101493428-101493450 GGCTGGTGGCCAGGTCCTTGGGG + Exonic
1195706380 X:107740902-107740924 GTCTGGTGACCCGGACTCTGGGG - Intronic
1195911133 X:109889623-109889645 AGAAGCTGACAAGGACTTTGAGG - Intergenic
1197697412 X:129565425-129565447 GGCTGCTAGCCAGGTCTTTAGGG - Intronic
1199012483 X:142774113-142774135 GGCTGTTGACCAGGACTCCTTGG + Intergenic