ID: 1161373681

View in Genome Browser
Species Human (GRCh38)
Location 19:3927923-3927945
Sequence GGGCTGCTGACCAGGACTTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161373681_1161373687 2 Left 1161373681 19:3927923-3927945 CCCAAAGTCCTGGTCAGCAGCCC 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161373681 Original CRISPR GGGCTGCTGACCAGGACTTT GGG (reversed) Exonic
900598457 1:3493110-3493132 GGGCTGCTTACCTGGCCTTGTGG - Intronic
900866639 1:5273726-5273748 AGCTTACTGACCAGGACTTTTGG - Intergenic
900947851 1:5841267-5841289 GGGCTGCTGGCCTGGCCTCTTGG - Intergenic
901290725 1:8122270-8122292 GGGCTTCTGAGCTGGACTTGGGG + Intergenic
902625392 1:17673368-17673390 GGGCAGCTGCCCAGTCCTTTTGG + Intronic
902756814 1:18554312-18554334 AGGCTGCTGCCCGTGACTTTAGG - Intergenic
903025770 1:20429065-20429087 GGGCTGATGGTCAGGACTCTGGG - Intergenic
904676191 1:32200698-32200720 GGGCTACTGACCTGGAGGTTTGG - Exonic
910203664 1:84725762-84725784 GTGCTGCTGATCAGGGCTTCTGG + Intergenic
910664459 1:89709518-89709540 TGGCTGCTGTACAGGATTTTAGG - Intronic
914883520 1:151566199-151566221 GGGCTGCTGTACAGGGCTGTGGG - Exonic
916278679 1:163024010-163024032 GGCCTGATGACTAGGGCTTTGGG + Intergenic
917355779 1:174124973-174124995 GTGAAGCTGCCCAGGACTTTGGG + Intergenic
922160079 1:223073097-223073119 GGGCTGCTTACTAGGGCATTTGG + Intergenic
922917097 1:229267665-229267687 GGGAGGCTGCCCAGCACTTTGGG + Intergenic
1063754787 10:8995238-8995260 GTGCTGTTCTCCAGGACTTTGGG + Intergenic
1067733913 10:48834340-48834362 GTGCTGCTGAGGAGGACCTTAGG + Intronic
1068960039 10:62858558-62858580 GGGCTGTGGACCAGGATTGTGGG - Intronic
1069718413 10:70535089-70535111 GGGCTGCTGGCCAGGGCTGCAGG + Intronic
1070362297 10:75702430-75702452 AGGCTGTGGACCAAGACTTTAGG + Intronic
1070644204 10:78190229-78190251 GTGCTGCTGCCCGGGCCTTTGGG + Intergenic
1070806276 10:79272930-79272952 GGGCTGGTGCCGAGGACCTTGGG - Intronic
1075298979 10:121303765-121303787 AGGCTGCTCCCCAGCACTTTGGG + Intergenic
1076508882 10:130998363-130998385 CCGCTGCTGACCAGGACTGGGGG + Intergenic
1076758656 10:132589106-132589128 GGGCTGCTGCCCAGGCCTCCCGG + Intronic
1080072071 11:28101094-28101116 GGGCTTATGACTAGCACTTTGGG + Intronic
1083296346 11:61717517-61717539 GTGATTCTCACCAGGACTTTAGG + Intronic
1084532743 11:69738413-69738435 GGGCTGCTGACATGGGCTCTGGG + Intergenic
1085418450 11:76335464-76335486 GTGGAGCTGCCCAGGACTTTGGG + Intergenic
1085834666 11:79939792-79939814 GGGCAGCTTATCTGGACTTTAGG - Intergenic
1088750551 11:112838808-112838830 GGGCTGGTGCCCATGACCTTGGG - Intergenic
1089282367 11:117383156-117383178 GGGCTCCTGGTCAGGACTTGAGG + Intronic
1096381228 12:51159745-51159767 TGGCTGGTCCCCAGGACTTTGGG - Intronic
1101741886 12:107507191-107507213 GGGTGGCTGACCAGGACTCTTGG - Intronic
1103626468 12:122224057-122224079 TGGCTGATGCCCAGGGCTTTGGG - Intronic
1103743948 12:123109564-123109586 GGGCCACTGACCATGACTTGCGG + Intronic
1103964787 12:124631897-124631919 GGGCTGGTGGACAGGACTTCGGG + Intergenic
1105610460 13:21964872-21964894 AGGCTGCTGACCCGGACGCTGGG + Intergenic
1106133689 13:26958891-26958913 ATGCTGATGACCAGCACTTTGGG - Intergenic
1108001548 13:45909677-45909699 GGGCTCCTGACCTGGGGTTTTGG - Intergenic
1109251165 13:60022529-60022551 GGGCTGCTGCCTGGGACTCTGGG + Intronic
1111975818 13:94966555-94966577 GGGCTGCTGGCCAGAACCATGGG - Intergenic
1112265512 13:97919957-97919979 GGGCTGCTGCCCAGGTCCTCTGG + Intergenic
1112325416 13:98440202-98440224 GGGCTGCTGGCCAGGAACTCAGG - Exonic
1120878500 14:89396357-89396379 GGGCAGCTGACCAAGGCTTTCGG + Intronic
1122548967 14:102539787-102539809 GGGCTGAGCACCAGCACTTTAGG - Intergenic
1123413953 15:20081684-20081706 GGGCTGCTGGCCATGACCTAGGG - Intergenic
1123523295 15:21088795-21088817 GGGCTGCTGGCCATGACCTAGGG - Intergenic
1124511390 15:30329249-30329271 GGACTGCTGCCCTGGGCTTTTGG + Intergenic
1124731524 15:32201515-32201537 GGACTGCTGCCCTGGGCTTTTGG - Intergenic
1125484848 15:40104820-40104842 GTGCTGCTGCCCAGGAGCTTCGG - Intronic
1125925848 15:43562504-43562526 AGGCTGCTGAACAGTACTTCGGG + Intronic
1125938992 15:43662055-43662077 AGGCTGCTGAACAGTACTTCGGG + Intronic
1127258267 15:57309096-57309118 GGGCTGCAGACCAGGATGGTGGG + Intergenic
1130334535 15:82947983-82948005 GGGCTGGGGCCCAGCACTTTGGG + Intronic
1131344194 15:91630951-91630973 GCATTGCTGACAAGGACTTTTGG + Intergenic
1133808249 16:9141899-9141921 TGGTGGCTGAGCAGGACTTTGGG + Intergenic
1134164781 16:11921156-11921178 TGGCTGATGCCCAGCACTTTGGG + Intergenic
1135505902 16:23035969-23035991 GGACTCCTGCCCAGGCCTTTTGG - Intergenic
1136774537 16:32864663-32864685 TGGCTGCTAACCAGCACTTTGGG - Intergenic
1136896075 16:33996851-33996873 TGGCTGCTAACCAGCACTTTGGG + Intergenic
1139439421 16:66958291-66958313 GGGCTGCTGTCCATGACTACTGG - Intergenic
1139528324 16:67529571-67529593 GGGCTGCTCACCAGGGCTAGAGG + Intronic
1139586865 16:67909545-67909567 GGCTTGCGGACCAGGACTTCTGG - Exonic
1139696162 16:68676523-68676545 GGGCTCCTGGCCAGCAATTTGGG - Intronic
1139969304 16:70763789-70763811 AGGCTGCTTAGCAGAACTTTGGG - Intronic
1140253885 16:73318403-73318425 GGGTTGCTGACCTGGGGTTTAGG - Intergenic
1203076963 16_KI270728v1_random:1126799-1126821 TGGCTGCTAACCAGCACTTTGGG - Intergenic
1145078391 17:19874246-19874268 GAGATGCTGACCTGGACTTGAGG + Intergenic
1146673099 17:34755574-34755596 GGGCCGCTGCCCACGCCTTTTGG + Intergenic
1147818026 17:43224223-43224245 AGGCTGGTGACCTGGCCTTTGGG + Intergenic
1148891654 17:50811860-50811882 GGGCTGCTCACCTGGACTCAAGG + Intergenic
1149211111 17:54302395-54302417 GCACTGCTGAACAGGACTATAGG - Intergenic
1149519874 17:57310591-57310613 TGGCTGATGCCCAGCACTTTGGG - Intronic
1150173316 17:63022740-63022762 GGGCTACTACCCAGGACTTCAGG + Intronic
1152518145 17:80838079-80838101 GGGGTGGTGCCCAGGACTCTCGG + Intronic
1153693617 18:7617892-7617914 GGAATGCTGCCCTGGACTTTCGG + Intronic
1153713277 18:7820949-7820971 GGGCAGCTGACCAGGGCTGGGGG - Intronic
1154021666 18:10668820-10668842 GGGCTTGAAACCAGGACTTTGGG + Intronic
1155241889 18:23871716-23871738 TGGCTGCTGTCCAGCACTGTGGG + Intronic
1157134538 18:45040888-45040910 TGGCTGTTGAGCTGGACTTTTGG + Intronic
1160059730 18:75518118-75518140 GGGCTGCTGACCAGGCACTGTGG + Intergenic
1160458719 18:79021191-79021213 GGGCTGCTGCCCAGGCTTCTTGG + Intergenic
1161373681 19:3927923-3927945 GGGCTGCTGACCAGGACTTTGGG - Exonic
1161751886 19:6104119-6104141 GTGTTGCAGACCAGGGCTTTGGG - Intronic
1163130255 19:15267967-15267989 TGGCAGCTCACCAGGACTCTGGG + Intronic
1163797069 19:19343830-19343852 GGGCTGCAGTCCAGCACTATGGG - Exonic
1165467502 19:35983720-35983742 GGGCTGCTGCCCAGCCCTTGGGG + Intergenic
1167312350 19:48744383-48744405 GGGCTGGAGACAAGGACTCTTGG + Intronic
1167743376 19:51337701-51337723 GGGCTGGTGACCTGGACTCCTGG + Intronic
1167795316 19:51704716-51704738 GGGCTGCGGACCTGGACTCCTGG - Intergenic
1168266165 19:55225027-55225049 GGGCTGGGGACCTGGACTTCTGG - Intergenic
1168666894 19:58211103-58211125 GGGGAACTGACCAGGACTTTGGG - Intronic
925390047 2:3488350-3488372 CTGCTGCTGAGCAGGACTTTGGG - Intergenic
926077342 2:9951791-9951813 GGGCCGCAGAACTGGACTTTCGG - Exonic
926293956 2:11553823-11553845 GGTCAGCTGAACAGGACCTTGGG + Intronic
927906666 2:26863314-26863336 CAGCTGCTGACCAGGAGTGTGGG + Intronic
928934843 2:36665076-36665098 AGGCTGATGAACATGACTTTGGG + Intergenic
931228874 2:60357180-60357202 TGGCTGGGGACCAGGACTTGGGG - Intergenic
931360895 2:61577139-61577161 GGGAGGCTCACCAGCACTTTGGG + Intergenic
932231296 2:70086608-70086630 GGGCTGCCGGCCAGGGCTTCAGG - Intergenic
932701599 2:73996036-73996058 GGGCTGCTGACCAAGACTGTAGG - Intronic
933096645 2:78191280-78191302 GGGTTGGTGAACAGGATTTTTGG - Intergenic
934575391 2:95397404-95397426 GGGCTCCTGCACAGGACTTGAGG + Intergenic
937043309 2:118837213-118837235 GGCCTGCAGACCAGGTCTTCAGG + Intergenic
941987322 2:171522388-171522410 GGGCTGCTGGCCCGGAATGTGGG - Exonic
945482646 2:210361167-210361189 AGCCTCCTGACCAGAACTTTCGG - Intergenic
946465905 2:219911989-219912011 GGGCTGGTGACCACGACCTTGGG - Intergenic
949028706 2:241778144-241778166 AGGCTGCTGTCCAGGGCTGTGGG - Intronic
1171383130 20:24748207-24748229 GGGTTGCTGTCCACGAGTTTTGG - Intergenic
1172673968 20:36654365-36654387 TGGCTGCTGCCCAGGACGATAGG - Intronic
1176261069 20:64180613-64180635 GGCCAGTTGCCCAGGACTTTGGG + Intronic
1176431677 21:6579867-6579889 GGGCTGCTGCCCAGGATTCCTGG + Intergenic
1179707071 21:43187329-43187351 GGGCTGCTGCCCAGGATTCCTGG + Intergenic
1180871849 22:19150761-19150783 AGGCTGCGGTCCAGGAGTTTCGG - Intergenic
1180942197 22:19666619-19666641 GGGCTGCTGGCCTGGCCTGTGGG + Intergenic
1181541198 22:23574139-23574161 GGGCTGCTCCCCCAGACTTTGGG + Intronic
1181935543 22:26435846-26435868 TGACTGCTGACCAGGAATTCAGG - Intronic
1183663627 22:39235192-39235214 GGGCTGCTGACCAGGGCTCCAGG + Intronic
1184757636 22:46525943-46525965 CGGCTCCTGCCCAGGGCTTTGGG + Intronic
954091384 3:48287025-48287047 GGACTGGGGACCAGGAATTTAGG - Intronic
958189030 3:90160630-90160652 AGGCTGCTGAGGAGAACTTTTGG - Intergenic
960433546 3:117598956-117598978 AGTCTTCTCACCAGGACTTTAGG + Intergenic
961364402 3:126390105-126390127 GCGCTGTTGACGAGGACTTTCGG - Intergenic
963704611 3:148670329-148670351 AGCCTGCTGAGCAGCACTTTGGG - Intergenic
968606556 4:1538261-1538283 GGGCTGCTGACCGGGACCCACGG + Intergenic
968770356 4:2501715-2501737 GTGCTGCTGAGGAGGACTGTGGG + Intronic
968917050 4:3501133-3501155 AGGCTGCTGCCCAGGAGTTTGGG + Intronic
972240533 4:37187240-37187262 GGGCTGCCTAGCAGGAGTTTGGG + Intergenic
975808540 4:78139224-78139246 GGGCTGAGGAACAGGACCTTGGG + Intronic
976498851 4:85762706-85762728 GAGCTTCTGGCCAGGACTTGGGG - Intronic
982340953 4:154298110-154298132 GAGCTGATGACCTGGACTTGGGG - Exonic
985476472 5:82067-82089 GGGCTGGTGGCTTGGACTTTAGG + Intergenic
986944475 5:12999252-12999274 GGGCTCCTGACAAGGACCTGTGG - Intergenic
988963262 5:36390673-36390695 GGGCTGCTGTCTTGGTCTTTGGG + Intergenic
990370578 5:55114363-55114385 GGGCTGCTGCTCAGGACTGTAGG + Intronic
990949358 5:61281277-61281299 TGGCTGCTGAGTGGGACTTTGGG - Intergenic
992323434 5:75636773-75636795 GGACTTGTGACCAGGACTTGGGG + Intronic
992654457 5:78894801-78894823 GGGCTGCTGCCCAGGACTCTGGG - Intronic
995185621 5:109267566-109267588 GGTCTGATGACTAGGACTTCAGG - Intergenic
995242143 5:109897813-109897835 AGGCTGCTTACCACCACTTTTGG - Intergenic
997424618 5:133794789-133794811 GCACTGCTGACCAGGAGTCTGGG - Intergenic
998337840 5:141389302-141389324 GGGCTTCTGATCCGGACTTGGGG + Exonic
999433522 5:151544221-151544243 TGGCTTCTGACCAGGACTCAGGG - Exonic
1002203253 5:177543960-177543982 GGGCTGCTGCCCAGGGCTGCTGG - Intronic
1005520771 6:26598568-26598590 GGGCTCCTGGCCAGGATCTTTGG + Exonic
1006594039 6:35179610-35179632 GTGCTGCTGTCAAGGACTTAGGG - Intergenic
1006773035 6:36569653-36569675 GGGCAGCTGGCCTGGTCTTTTGG - Intergenic
1007717173 6:43864114-43864136 GGGGTGCTGAGCAGCACTTTGGG + Intergenic
1012118180 6:95331253-95331275 AGGCTGCTGTCTAGGAATTTAGG + Intergenic
1013457122 6:110340268-110340290 GGGCTGTTGTCCAGGACAGTAGG + Intronic
1014190853 6:118495169-118495191 AGGCTTCTGACTTGGACTTTCGG + Intronic
1015493284 6:133853352-133853374 GTGCTGCTGACCAGAGCTCTAGG - Intergenic
1017116953 6:150986678-150986700 GGGCTGCAGACCAGGGGGTTAGG + Intronic
1017308333 6:152947189-152947211 AGGCTGCTGACCAGCAGCTTCGG - Intergenic
1017675830 6:156812760-156812782 GGGCTGCGGGCCTGGTCTTTTGG - Intronic
1022784846 7:33627781-33627803 GGGCTCATGCCCAGCACTTTGGG + Intergenic
1026880102 7:73902362-73902384 GGGCTCCGGACCAGGAAGTTGGG + Intergenic
1026978247 7:74511900-74511922 GGGCTGCAGACCTCGACTCTGGG + Intronic
1027125792 7:75555918-75555940 GGGCTGCTGAGAAGGGGTTTGGG - Intronic
1028173551 7:87628226-87628248 GGGCTGCTGTCAAGGACGCTGGG - Intronic
1029113991 7:98228101-98228123 GTGCTGCTGGCCAGGCCTGTGGG + Exonic
1031996142 7:128232623-128232645 GGCCTGCTGACAATGACATTAGG - Intergenic
1032162599 7:129522292-129522314 GGGCTGCTGAGCATGACATGTGG + Intergenic
1035261798 7:157666604-157666626 AGGCTGAGGACCAGGACTCTGGG + Intronic
1041456491 8:58066431-58066453 GGGCTGCTGCCCATGGCCTTTGG + Intronic
1041774924 8:61513513-61513535 GGGCTGCTGACCAGCAGTCATGG + Intronic
1043138254 8:76555297-76555319 AGGATGCTGACCAGGTCTGTTGG + Intergenic
1048181819 8:132202116-132202138 GGGGTGCTGTGCTGGACTTTGGG + Intronic
1049434964 8:142582266-142582288 GGGCCACTGACCAGGGCTCTGGG + Intergenic
1050360622 9:4827383-4827405 GGGCAGCTGACCAAAATTTTGGG + Intronic
1051636920 9:19189105-19189127 GGGCTCCTGAGTGGGACTTTTGG - Intergenic
1051760459 9:20457948-20457970 GGGCTGCTGAAGAGGACTCAGGG - Intronic
1051808784 9:21027276-21027298 GGGCCTCTGATCAGGACTTTTGG + Intronic
1055884063 9:81038305-81038327 GGGATGATGAGCAGGATTTTTGG + Intergenic
1056018892 9:82421613-82421635 GGGCTGCTGACAATCGCTTTGGG - Intergenic
1057453862 9:95190050-95190072 GAGCTCCTCACCAGGACTTTTGG - Intronic
1059566211 9:115385480-115385502 CGGCTGCAGACCTGGGCTTTTGG + Intronic
1060268911 9:122127759-122127781 GGGCTGGTGAACAGAACTGTGGG + Intergenic
1060638668 9:125220473-125220495 GGGCTTCTGACCTTGACTCTGGG - Intronic
1186754462 X:12655855-12655877 TAACTGCTCACCAGGACTTTGGG + Intronic
1188878265 X:35460138-35460160 GTCCTGATGACTAGGACTTTGGG + Intergenic
1189438874 X:41016913-41016935 TGTCTCCTCACCAGGACTTTAGG - Intergenic
1189573164 X:42321246-42321268 GGGCTGCATACCAGGAGTTCAGG - Intergenic
1192233102 X:69279222-69279244 GGACTGCTGTCCAGGTCTATTGG + Intergenic
1197697413 X:129565426-129565448 TGGCTGCTAGCCAGGTCTTTAGG - Intronic
1200049888 X:153423160-153423182 TGGCCGCTGACCAGGACGCTGGG - Intergenic
1200094079 X:153649189-153649211 GGCCTGCTGACCTGGCCTTCTGG - Intronic
1200105410 X:153709394-153709416 TGGCTGCTAACCAGCACTTTGGG + Intronic