ID: 1161373683

View in Genome Browser
Species Human (GRCh38)
Location 19:3927931-3927953
Sequence GGAAGGATGGGCTGCTGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161373683_1161373687 -6 Left 1161373683 19:3927931-3927953 CCTGGTCAGCAGCCCATCCTTCC 0: 1
1: 1
2: 2
3: 25
4: 279
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161373683 Original CRISPR GGAAGGATGGGCTGCTGACC AGG (reversed) Exonic
900308258 1:2021425-2021447 GGAAGGGAGGGCGGCTGTCCTGG - Intronic
900329326 1:2126294-2126316 GGAGGGCTGGTCTGCTGACCTGG + Intronic
900742951 1:4341832-4341854 GCAAGGCTGGGCAGCTGCCCTGG + Intergenic
901012703 1:6210375-6210397 GGAAGGAGGAGCAGATGACCAGG - Exonic
901131339 1:6963690-6963712 GGTGGGGCGGGCTGCTGACCTGG + Intronic
902658060 1:17883082-17883104 GGAAGGTTGGGATGCTGGGCAGG + Intergenic
902925564 1:19693732-19693754 GGAAAGATGGGATGCAGAGCGGG - Intronic
903133996 1:21297297-21297319 GGAGTGAGAGGCTGCTGACCAGG - Intronic
903262550 1:22139230-22139252 GGAAGCAAGGGCTGCTGTCAGGG - Intronic
904095076 1:27970621-27970643 GGACAGATGGCCTGCTGACTGGG + Exonic
904224862 1:29008210-29008232 GGAAGGATGGGCTCATGATGAGG - Intronic
905482560 1:38271519-38271541 GGAGGGATGGGCAGCAGACAGGG - Intergenic
905929913 1:41779790-41779812 GTAAGGAGGGGCTTCTGGCCAGG - Intronic
908124262 1:61014531-61014553 GGAAGGTTAGGCTGCAGACAGGG - Intronic
909356225 1:74713126-74713148 GCAGGGATAGGCTGGTGACCTGG - Intronic
909923805 1:81414557-81414579 GGAAGGATGGCCAGGTGCCCTGG + Intronic
911377051 1:97063608-97063630 GGTGGGATGGTCTGTTGACCTGG + Intergenic
913273641 1:117117931-117117953 GGAAGCATGCCCTACTGACCAGG - Intronic
916426133 1:164682365-164682387 GGATGGATGAGCTGATGAACAGG - Intronic
916511229 1:165473919-165473941 GGAAGGAAGGGCTCCTGGGCAGG - Intergenic
919822479 1:201481966-201481988 GGAAGGAGGGTCGGCTGACGGGG - Intergenic
919958089 1:202438875-202438897 GGATGTATGGGCTCCTGCCCTGG - Intronic
920267166 1:204732776-204732798 GGAAGGATGGGCTTCTGAACAGG + Intergenic
921474622 1:215591647-215591669 GGAAAGAAAGGCTGCTGGCCGGG - Intronic
921888000 1:220325685-220325707 GGAAGGATGGCCTGCTGTGTGGG - Intergenic
922237578 1:223733567-223733589 GGAAGGAAGGGCTGGCTACCTGG + Intronic
922495178 1:226051564-226051586 GGAAGGTTGGGTAACTGACCAGG - Intergenic
923888406 1:238183455-238183477 GGAAAAATGCGTTGCTGACCTGG + Intergenic
924377060 1:243422001-243422023 GGAAGGATTGGGTGCTGGCAGGG + Intronic
1062807876 10:437805-437827 GAAATGACTGGCTGCTGACCAGG - Intronic
1067534012 10:47094896-47094918 GGAAGGATGGGGTGCTGTACAGG - Intergenic
1070176549 10:73975468-73975490 GGAAGGCTGGGCTGCTGGGATGG - Intergenic
1070575116 10:77671810-77671832 GGAAGGAGGGGCTGCCGAGTTGG - Intergenic
1070819343 10:79345937-79345959 GAAAGGAGGGGCTGCTCCCCAGG + Intergenic
1070888337 10:79923818-79923840 GAAAGGAGGGGCTGCTGGCCAGG - Intergenic
1072732294 10:97854354-97854376 GGAAAGATGGCCCACTGACCTGG - Intronic
1073002109 10:100293495-100293517 GGATTGATGGGCTGCCGAACTGG - Intronic
1073538821 10:104301441-104301463 GTAAGGATGTGCAGGTGACCAGG - Intronic
1074363830 10:112842492-112842514 GGAAGCCAGGCCTGCTGACCTGG - Intergenic
1075122188 10:119672397-119672419 GGAGGGCTGGGCTGCTGGCCGGG - Exonic
1075904064 10:126065313-126065335 GGAAGCGTTGGCTGCTGGCCTGG + Intronic
1076656753 10:132029323-132029345 GGAAGAATGGGCTCCAGGCCGGG - Intergenic
1076806522 10:132861856-132861878 GGGAGGGTGGGCTGATGAGCTGG + Intronic
1076883813 10:133252313-133252335 GGCAGGACGGGCTGCTGGGCAGG - Intergenic
1078930010 11:15905602-15905624 GGCAGGTTGGGCTGCAGGCCCGG - Intergenic
1079095580 11:17507952-17507974 TGAAGGATGAGCTGCTGCCCAGG - Intronic
1079698334 11:23512588-23512610 GAAATGGTGGGCTGCTGAACAGG + Intergenic
1081440324 11:43073667-43073689 TGAAGGATGGGATGATGAGCTGG + Intergenic
1081604724 11:44520227-44520249 AGATGGATGGGCTGCTGCCGAGG + Intergenic
1084052168 11:66607066-66607088 GGTTGGATGAGCTGCTAACCAGG + Intergenic
1084543932 11:69804475-69804497 TGCTGGAGGGGCTGCTGACCTGG - Intergenic
1084774152 11:71364512-71364534 GGATGGATGGGCTTCAGGCCTGG + Intergenic
1084777917 11:71389395-71389417 GGAGGGACGGGCTCCTGCCCCGG - Intergenic
1086184657 11:83999039-83999061 GGAAGGTTGGACTGCTGGCAAGG - Intronic
1086608147 11:88722284-88722306 GTAAGGATGCCCTGATGACCTGG + Intronic
1087568833 11:99896991-99897013 GGAGGGATGGGCTGGTACCCGGG - Intronic
1088653541 11:111977905-111977927 GGGAGGACCGGCTGCTGACCAGG + Intronic
1089202261 11:116731650-116731672 GGAAGCATGACCTGCTGAGCTGG - Intergenic
1090657540 11:128857406-128857428 GGCAAGACGGGCTGCTGTCCTGG - Intronic
1090919824 11:131197873-131197895 GGAAGGATGGGCTGGGAGCCGGG + Intergenic
1092123577 12:6060799-6060821 GGGAGGAAGGGCAGCTGCCCAGG + Intronic
1093519175 12:20027817-20027839 GGAGAAATGGGCTGCTGGCCAGG - Intergenic
1096137313 12:49213191-49213213 GGAGGAAAGGGCTGCTGTCCGGG + Intronic
1096612826 12:52814215-52814237 GGAAGGATGGGCTTGTGCCAAGG - Exonic
1097017425 12:55997370-55997392 GGGAGGAAGGGCTGCTGAGCTGG + Intronic
1097081754 12:56436628-56436650 AGATGGATGGGCTGCAGACATGG + Intronic
1100192027 12:92203145-92203167 GGATGGATGGGCTGAGGCCCCGG - Intergenic
1101344284 12:103871407-103871429 GCAGGGATGGGCTCCTGCCCAGG + Intergenic
1101574860 12:105987947-105987969 CGAGGGTTAGGCTGCTGACCAGG + Intergenic
1102685092 12:114718330-114718352 GGAAGGATGGGCTGGTAAAAAGG + Intergenic
1105058893 12:133130052-133130074 GGGAGGAGGGGCTACTTACCGGG - Intronic
1105577880 13:21670159-21670181 GGAAGGAGCGGCTGCAGCCCCGG + Intergenic
1106833687 13:33611863-33611885 GGAAGGATGGCTTCCTCACCAGG + Intergenic
1108723065 13:53151790-53151812 TGCAGGATGGGCTGCCGAGCAGG + Intergenic
1112760905 13:102692265-102692287 TGAGGGATGCCCTGCTGACCAGG - Intronic
1112972056 13:105273266-105273288 GGATGGTTGGGCTGGGGACCAGG + Intergenic
1113607777 13:111622517-111622539 TGAAGGCTGGGCTGCAGAACCGG - Intronic
1113866389 13:113528472-113528494 GGAATGAAGGGCTGTTTACCTGG + Intronic
1116794675 14:49377072-49377094 AGATGGATGGACTGCTAACCTGG - Intergenic
1118138430 14:63052788-63052810 GGAAGGAAGGGCTGTTTACCAGG - Intronic
1118708966 14:68504188-68504210 GGTAGCATGGGATGCTGGCCTGG - Intronic
1119705236 14:76779095-76779117 GGAAGGCGGGGCTGGTGACAAGG + Exonic
1120769274 14:88360950-88360972 GATAGGATGGTGTGCTGACCAGG + Intergenic
1120788307 14:88556644-88556666 GGCAGGAGGGGCTGCTGGCCAGG - Intergenic
1121845827 14:97171276-97171298 GGAAGGCTGGACTGCAGCCCTGG - Intergenic
1122453953 14:101835177-101835199 GGGAGCATGGGCTGCTCAGCTGG + Intronic
1123062951 14:105602384-105602406 GGCAGGATGGGCTGGGGACTTGG - Intergenic
1125114909 15:36079374-36079396 GGAACACTGGGCTGCTGAACTGG - Intergenic
1125662221 15:41403184-41403206 GGTAGGAGGGGCTGCTGTCCAGG - Intergenic
1125721403 15:41846840-41846862 GGAAGGGTGGGCAGCCCACCAGG + Intronic
1126506144 15:49406559-49406581 GGGAGGGTGGGGTGCTGGCCGGG + Intronic
1128114055 15:65094456-65094478 GGCAGGAAGCCCTGCTGACCTGG + Exonic
1128291574 15:66482328-66482350 GAAAGGACGGGCTGCTGAGAAGG - Intronic
1129705567 15:77792232-77792254 TGAAGGATGGGCTGTGGACTGGG - Intronic
1134083298 16:11339308-11339330 GGAAGGCTGTGCTGCAGCCCTGG + Intronic
1136580579 16:31148851-31148873 GGAAAGATGGGATTCAGACCCGG + Intronic
1136682380 16:31975894-31975916 GGGAAGATGGGCTGGTGCCCAGG - Intergenic
1136782638 16:32917062-32917084 GGGAAGATGGGCTGGTGCCCAGG - Intergenic
1136887156 16:33936788-33936810 GGGAAGATGGGCTGGTGCCCAGG + Intergenic
1137532434 16:49287893-49287915 AGGAGGATGGGCTGCTGAGGAGG - Intergenic
1138108603 16:54305465-54305487 AGCCGGATGGGCTGGTGACCTGG + Intergenic
1138305104 16:55967106-55967128 GGAAGGCTGAGCTGGTGATCAGG - Intergenic
1139431751 16:66914421-66914443 GGGAGGATGGTCAGCTGAGCAGG + Intronic
1142265518 16:89062491-89062513 GGAAGGACGGGCTGTGGACGAGG + Intergenic
1203085296 16_KI270728v1_random:1181050-1181072 GGGAAGATGGGCTGGTGCCCAGG - Intergenic
1143038164 17:4012500-4012522 GGAAGAATGAGCTCCTGACAGGG + Intronic
1145237965 17:21222385-21222407 GGAAGGGTGGCCAGCTGTCCTGG + Intergenic
1147142902 17:38469232-38469254 GGGAAGATGGGCTGGTGCCCAGG - Exonic
1147721728 17:42543653-42543675 GGAAGGCGGGGCTGGTGGCCAGG - Exonic
1151509476 17:74549518-74549540 GGACGTAGGGGCTGCTGAACAGG + Intergenic
1151518521 17:74612748-74612770 GGAAGTGAGGGCTGCTGAGCCGG + Exonic
1151562274 17:74877051-74877073 GGAAGGATGGTCTGCAGCCTGGG - Intergenic
1151874999 17:76862945-76862967 GGAAGGCTGGGCTGCTTCCTAGG - Intergenic
1152110967 17:78357693-78357715 GGATGGATGGGCTGGTCAGCTGG - Exonic
1152233499 17:79126435-79126457 GGAAGGGGAGGCTGGTGACCCGG + Intronic
1152279332 17:79376137-79376159 GGAAGGAGGGGGTGTTGACTTGG - Intronic
1152739642 17:82013318-82013340 GGGAGGGTGGGCTGCAGGCCTGG - Intronic
1153687689 18:7562898-7562920 GGCAGGATGGGCTCCTGCCCTGG + Intergenic
1153817842 18:8806631-8806653 GGAAGGCTGCCCTGGTGACCTGG - Intronic
1155744273 18:29332377-29332399 GGCAAGATGGGCTACTGACTAGG - Intergenic
1157274835 18:46303189-46303211 GGAAGGAAGGGCTCCTGACTTGG - Intergenic
1157616614 18:48991162-48991184 GGCTGGATGGGATTCTGACCTGG + Intergenic
1158565613 18:58551816-58551838 GGAAGCCTGGGCTGGTGACAAGG - Intronic
1159995100 18:74956726-74956748 AGAAGGATGGGCTGCTGGGGTGG + Intronic
1160502829 18:79410791-79410813 GGGAGGACAGGCTGCTGGCCGGG - Exonic
1160791375 19:925300-925322 GGAGGGACGGGCTGCAGACGGGG - Intergenic
1160952328 19:1673745-1673767 GGACGGTTAGGCTTCTGACCTGG - Intergenic
1160980803 19:1815769-1815791 GGCAGGAGGGGCTGCGGGCCGGG + Exonic
1161354443 19:3811053-3811075 GGAAGGAGTGGGTGCTGCCCTGG - Intronic
1161373683 19:3927931-3927953 GGAAGGATGGGCTGCTGACCAGG - Exonic
1162111122 19:8400325-8400347 GGAAGGCTGGGATGCTGGCTGGG - Intronic
1163765129 19:19159576-19159598 TGCAGGATGTGCTGGTGACCTGG + Intronic
1164245177 19:23422067-23422089 GGTAGGATGGGTTGGGGACCTGG + Intergenic
1164596630 19:29534391-29534413 AGAAGGGTGGGCTGAGGACCTGG + Intronic
1164862434 19:31572785-31572807 GGAGAGGTGGGCTGCTGGCCCGG - Intergenic
1165177243 19:33939264-33939286 GGAGGGCTGGGCTGCAGCCCTGG + Intergenic
1165357464 19:35312663-35312685 GGAAAGATGGGGTCCTGACTAGG + Intronic
1165773894 19:38393970-38393992 GGAAAGATGCTCTGCTGTCCAGG + Intronic
1165833961 19:38743507-38743529 GGGAGGAGGGGCTGGGGACCTGG - Intronic
1165834024 19:38743690-38743712 GGGAGGAGGGGCTGGGGACCTGG - Intronic
1166306497 19:41939170-41939192 GGAAGGAAGGGCTGGGGGCCTGG - Intergenic
1166373693 19:42315651-42315673 GGGAGGATGGGCTGGGGACCTGG + Intronic
1166521902 19:43486448-43486470 GGGAGGATGGGCTGGGGGCCTGG + Intronic
1166683574 19:44781993-44782015 GGGAGGAGGGGCTGGAGACCTGG + Intronic
1166683586 19:44782030-44782052 GGGAGGAGGGGCTGGAGACCTGG + Intronic
1166683598 19:44782067-44782089 GGGAGGAGGGGCTGGAGACCTGG + Intronic
1166800743 19:45455703-45455725 GGAAGGCTGGGCTGGGGCCCTGG + Intronic
1167047291 19:47057594-47057616 GGAAGGTTGGGCAGATGACAGGG - Intergenic
1167266110 19:48483535-48483557 GGGAGGAAGGGCTGGTGACTGGG - Intergenic
1167314298 19:48755028-48755050 GGAAGGAGGGGCTGGGGTCCTGG - Intronic
1167327675 19:48835579-48835601 GGGAGGAGGGGCTGGGGACCTGG + Intronic
1167413773 19:49360176-49360198 GGGAGGAGGGGCTGGGGACCTGG + Intronic
1167560850 19:50225960-50225982 GGGAGGAGGGGCTGGGGACCTGG + Intronic
1167560908 19:50226109-50226131 GGGAGGAGGGGCTGGGGACCTGG + Intronic
1167560962 19:50226257-50226279 GGGAGGAGGGGCTGGGGACCTGG + Intronic
1167561048 19:50226480-50226502 GGGAGGAGGGGCTGGTGGCCTGG + Intronic
1167705539 19:51079153-51079175 GGGAGGAGGGGCTGGGGACCTGG - Intronic
1167738307 19:51310688-51310710 GGGAGGAGGGGCTGGGGACCTGG + Intergenic
1167738572 19:51311351-51311373 GGGAGGAGGGGCTGGGGACCTGG + Intergenic
1167746371 19:51353715-51353737 GGGAGGATGGGCTGATAGCCTGG - Intronic
1167746445 19:51353937-51353959 GGAAGGAGGGGCTGGGGGCCTGG - Intronic
1167746472 19:51354011-51354033 GGGAGGATGGGCTGATAGCCTGG - Intronic
1167795317 19:51704724-51704746 GGGAGGAGGGGCTGCGGACCTGG - Intergenic
1168057208 19:53870139-53870161 GGAAGGAGGGGCTGGGGGCCTGG + Intronic
1168092549 19:54095549-54095571 GGAAGGAGGGGCTGGGGGCCTGG + Exonic
1168092564 19:54095585-54095607 GGAAGGAGGGGCTGGGGGCCTGG + Exonic
1168126457 19:54286106-54286128 GGAGGGATGGGCTGGTCCCCAGG - Intergenic
1168175437 19:54624758-54624780 GGAGGGATGGGCTGGTCCCCAGG + Intronic
1168252182 19:55147364-55147386 GGAAGGAGGGGCTGGGGGCCTGG + Intronic
1168266166 19:55225035-55225057 GGGAGGAGGGGCTGGGGACCTGG - Intergenic
1168306291 19:55437995-55438017 GGGAGGAGGGGCTGCAGGCCTGG - Intronic
1168327872 19:55547137-55547159 GGGAGGAGGGGCTGGGGACCTGG - Intergenic
925031318 2:652081-652103 GGAAGGATGGGCTGCAGCTGGGG - Intergenic
925031356 2:652232-652254 GGAAGGACGGGCTGCAGCCGGGG - Intergenic
925628675 2:5867107-5867129 GCAGGGTGGGGCTGCTGACCAGG + Intergenic
925854662 2:8117929-8117951 GGAAAGATGGGCTGCAGAGATGG - Intergenic
927819021 2:26245720-26245742 GGAATGATGGGCTGGAGTCCTGG + Intronic
928335486 2:30394489-30394511 GGAAGGAAGGGATGCTGCGCTGG + Intergenic
933158691 2:79001333-79001355 GGCAGGATGGGATGATGACTTGG - Intergenic
936947107 2:117940918-117940940 GGAAGGCTGTGTGGCTGACCAGG + Intronic
937970789 2:127547123-127547145 GGAAGGGTGGGCTGATGGACGGG - Intronic
938323390 2:130380740-130380762 GGAAGGAGGGGATGCTGTGCAGG + Intergenic
941451268 2:165663508-165663530 GAAAGGGTGGGCTGCAGCCCTGG + Intronic
941541129 2:166786183-166786205 GGAAGGATAGGCTATTGACCTGG - Intergenic
942055509 2:172178608-172178630 AGAGGGAAGGGATGCTGACCAGG + Intergenic
946253171 2:218425815-218425837 GGGAGGGTGGGCTGCAGGCCGGG + Intronic
946255221 2:218437089-218437111 GGAAGGATGGACTGATCCCCTGG + Intronic
948063893 2:235062345-235062367 TGCATGAGGGGCTGCTGACCAGG - Intergenic
948934236 2:241151876-241151898 GGGATGATGGGCTGGTGAACAGG - Intronic
949035979 2:241815949-241815971 GGAAGGAGGGGCTGGTGCCTCGG - Intronic
1168832329 20:853379-853401 GGAAGGAGAGATTGCTGACCTGG + Intronic
1169499156 20:6142456-6142478 AGACGGATGGGCTGCCGGCCAGG + Intergenic
1170497905 20:16944725-16944747 GGAAGGCTGGTCCCCTGACCCGG - Intergenic
1170908095 20:20535067-20535089 TGAATGATGGGCTGCTGTCTTGG + Intronic
1171517263 20:25747447-25747469 GGAAGGACAGGATGCTGACAGGG - Intergenic
1173253594 20:41377337-41377359 GGAAGGGTAGGGTGCTGAGCTGG + Intergenic
1173635627 20:44554504-44554526 GGAAGGATGGGTTTTTGAGCAGG + Intronic
1173875445 20:46367598-46367620 GGCAGGATCTCCTGCTGACCAGG - Intronic
1174540419 20:51285118-51285140 GGAAGGCTGGGCTCCAGTCCCGG - Intergenic
1179164597 21:38925678-38925700 GGAAGAATGGGCTGGTGTCCTGG - Intergenic
1179595924 21:42443278-42443300 AGAAGGAGAGGCTGCTGCCCTGG - Intronic
1179895087 21:44357318-44357340 GAGAGGAAGGGGTGCTGACCTGG + Intronic
1181523089 22:23460442-23460464 GGAAGGCAGGGATGCTGTCCTGG - Intergenic
1182647937 22:31825556-31825578 GGAAGCATGGGCTGAGGAACAGG - Intronic
1182904343 22:33922187-33922209 GGAAGGATGGGCTGGGGAGGGGG + Intronic
1183616687 22:38950132-38950154 GGAAGTGGGGGCTGCTGTCCAGG - Intergenic
1184594104 22:45503652-45503674 GGATGGAGGGGATGCGGACCTGG + Intronic
1185037246 22:48485911-48485933 GAGAGGAGGGGCGGCTGACCAGG - Intergenic
949500896 3:4679154-4679176 GGAAGGAGGCGCTGATGATCAGG + Intronic
949936599 3:9120917-9120939 TGAAGAATGTGCTGCTGCCCAGG - Intronic
950135897 3:10580608-10580630 GGGAGGAGGGGCTGCGGACAGGG - Intronic
950468158 3:13167784-13167806 GGAAGGAGGGGCTGCACACATGG - Intergenic
952197137 3:31087791-31087813 GAAAGAATGGGATGCTGACCTGG + Intergenic
953931472 3:47007948-47007970 GGACGGATGGGCTGCAGGTCTGG - Intronic
958904099 3:99923235-99923257 AGAAGGATGGGCTGGTGATATGG - Intronic
960997210 3:123348118-123348140 GGAAGGATTAGCTGGTGTCCCGG - Intronic
961312325 3:126010897-126010919 GAAGGGATGGACTGCTGCCCAGG - Intronic
961450324 3:126999619-126999641 GGCGGGATGGACAGCTGACCTGG + Intronic
963166544 3:142210281-142210303 GGGAGGAGGAGCTGCTGGCCAGG + Intronic
963273315 3:143306649-143306671 AGCAGGAGGTGCTGCTGACCTGG - Intronic
966714249 3:183000159-183000181 GCAAGGGTGGGGTGCTGACAGGG + Intergenic
967866962 3:194198207-194198229 GGAAGAATGGGCTGCCTCCCCGG + Intergenic
967884149 3:194321996-194322018 GGGAGGGTGGGCTGCTGGGCTGG + Intergenic
968606555 4:1538253-1538275 GAAAGGAGGGGCTGCTGACCGGG + Intergenic
969089191 4:4680495-4680517 GGGCGGATGGGCTGCTGGCAGGG + Intergenic
969163680 4:5284756-5284778 GGAAAGATGAGCTGCTCACGTGG - Intronic
970226353 4:13861556-13861578 GGAAGGATGGGTTAATGACTGGG - Intergenic
971216793 4:24669691-24669713 GGAAGGATGCTCTGGTGTCCTGG - Intergenic
971279097 4:25226566-25226588 GGAAGTATGGGCTGCTAAGAGGG - Intronic
972575648 4:40348929-40348951 GGTATGATGGGCTGATCACCTGG + Exonic
975606847 4:76163693-76163715 GGAAGGAAGTGATGCTGAGCTGG - Intronic
977172748 4:93783160-93783182 GGAGGGAAGGCATGCTGACCAGG + Intergenic
980881046 4:138710174-138710196 GGAAGGATGGAGTGATGAGCAGG - Intergenic
982693119 4:158570637-158570659 GGAAAGCTGGGCTGCTGATTAGG - Intronic
985141802 4:186847689-186847711 TGAAGGATGGGCATCTGACCAGG - Intergenic
985705139 5:1396135-1396157 GAATGGCTGGGCTGCAGACCAGG + Intronic
986799478 5:11244866-11244888 GGAAGGAGGAGCTGCTGGCTGGG - Intronic
990523649 5:56604163-56604185 GGAAGGGTGGGGAGCTGAGCTGG + Intronic
991363350 5:65843554-65843576 GGCAGGATGGGCTTCTGCCCGGG - Intronic
992466546 5:77011827-77011849 GGAAGGGTGAGCAGCTGAGCAGG - Intergenic
992622834 5:78610522-78610544 GGGAGGATGGCCTGGTGAGCAGG + Intronic
998205392 5:140153825-140153847 GGAAGGATGGGCTGCAGACCAGG - Intergenic
999106201 5:149073394-149073416 AGAAGGTAGGGCTGCTGACCAGG + Intergenic
999525564 5:152402427-152402449 GGAAGGATGAGCTGTTATCCAGG - Intronic
1000352714 5:160364767-160364789 GGAAGGATGGGGTGTTGCCTTGG + Intronic
1001518441 5:172373627-172373649 GGAAGGAGGGGTGGCTGAACTGG - Intronic
1002203255 5:177543968-177543990 GGAACAATGGGCTGCTGCCCAGG - Intronic
1002310147 5:178309273-178309295 GGCAGGGTGGGCAGCTGCCCAGG + Intronic
1002495364 5:179607875-179607897 GAAAGGATGTGCTGGAGACCAGG - Intronic
1006134278 6:31886562-31886584 GGCTGGGTGGGCCGCTGACCTGG + Exonic
1006304927 6:33213188-33213210 GGCAGGCTGGGCTGCAGACTCGG + Intergenic
1006828580 6:36954961-36954983 GGATGGAAGGGGTGCTGGCCAGG + Intronic
1007307909 6:40921505-40921527 GGAAGGGGGAGCTTCTGACCAGG + Intergenic
1008050363 6:46894652-46894674 GGAAGGAATGTCTTCTGACCTGG + Intronic
1010386282 6:75284502-75284524 GTAAGGATGGGCTGCCAAGCTGG + Exonic
1013190582 6:107801669-107801691 GGAAGGATATGTTGCTGACAGGG + Intronic
1013629588 6:111973342-111973364 GGAAGGAAGGGCGGCTGAGGAGG + Intergenic
1016017219 6:139198749-139198771 GGGAGGAAGGGCTGCTGAGCAGG - Intergenic
1017822726 6:158060844-158060866 AGAAGGGTGGGCTCCTGGCCAGG + Intronic
1018900494 6:168049618-168049640 GCAAGGAGGGGGTGCTGTCCAGG - Intergenic
1019039785 6:169094324-169094346 GGACGGACAGCCTGCTGACCGGG - Intergenic
1019542458 7:1557774-1557796 GGAAGGATGGGCCTCAGCCCGGG - Intronic
1019588242 7:1816117-1816139 GGAAGGCAGGGATGCTGTCCTGG + Exonic
1022347904 7:29535170-29535192 GGAAAGACAGGCTACTGACCAGG - Intergenic
1022660433 7:32361681-32361703 GGAAGGAGGCACTGCTGCCCAGG - Intergenic
1026086262 7:67265708-67265730 GGAGGGATGGGGTGCTGTGCGGG + Intergenic
1026154915 7:67818364-67818386 GCAAGGATGGGTTGCAGCCCTGG - Intergenic
1026690886 7:72549109-72549131 GGAGGGATGGGGTGCTGTGCGGG - Intergenic
1026846297 7:73700711-73700733 GCAGGGCTGGGCTACTGACCCGG + Exonic
1027314763 7:76978679-76978701 GGCAGGATGGGCTGGGCACCTGG + Intergenic
1029481203 7:100814026-100814048 GGAAGGAAAGGCTGCTGATCAGG + Intronic
1031485294 7:122316851-122316873 GGCAGGCTGGGCTGCTATCCCGG + Intergenic
1031989074 7:128184388-128184410 GGAGGAATGGGCAGATGACCAGG + Intergenic
1034261789 7:149761451-149761473 AGGAGGAGGGGCTGCTGACTAGG + Intergenic
1034433776 7:151053547-151053569 GCAAGGATGGGCTCCCCACCAGG - Intergenic
1034435735 7:151062052-151062074 GGAAGGTTGGGCTGGCGACCTGG - Intronic
1034448545 7:151125680-151125702 GCAAGGAGGGGCTGCAGATCTGG - Intronic
1034628819 7:152514837-152514859 GGAAGGAGATGCAGCTGACCGGG - Intergenic
1035690011 8:1553888-1553910 GCAAGGATGACCTGTTGACCTGG - Intronic
1036752729 8:11453615-11453637 GGAAGGCTGAGCTGGGGACCAGG + Intronic
1037389829 8:18381564-18381586 GGATGGAGGGGCTTCAGACCAGG - Intergenic
1037681597 8:21102118-21102140 GTGAGGATGGGCAGCTGACTTGG + Intergenic
1037689243 8:21168882-21168904 GAGAGGATGTGCTGCTGTCCAGG + Intergenic
1039327727 8:36503422-36503444 GCAAGGATGGGGTGAGGACCTGG + Intergenic
1041757974 8:61334709-61334731 GGAGGGGTGGGCAGCTGAGCTGG + Intronic
1045398308 8:101784145-101784167 GGAAGGAAGACCTGATGACCGGG + Intronic
1049300617 8:141867588-141867610 GGGGCGATGGGCTGCTGGCCAGG + Intergenic
1049302743 8:141880296-141880318 TGGAGGCTGGGCTGCTGCCCTGG - Intergenic
1049378667 8:142301364-142301386 GGAAGGAAGGCCTGCTGGCATGG - Intronic
1049433247 8:142574911-142574933 GGAAGGAGGAGGTGCTGCCCGGG - Intergenic
1049546894 8:143236457-143236479 GGAAGAGTGGGCTGCACACCTGG - Intergenic
1050682899 9:8134752-8134774 GAAAGGCTGTGCTGCTGAGCTGG + Intergenic
1051599870 9:18862050-18862072 GGAAGGAGCCGCTGCTGACTAGG - Intronic
1052359176 9:27536043-27536065 GGTAGGCAGGGCTGCTGGCCAGG - Intergenic
1056510613 9:87301488-87301510 GGAAGGTTGGGCTGCACCCCAGG - Intergenic
1056580680 9:87886550-87886572 GGAAGGATGTGCAGAAGACCGGG + Exonic
1057491753 9:95525621-95525643 AGGAGGAGGGGCTACTGACCAGG + Intergenic
1060410923 9:123399686-123399708 GGAAGGGTGGCCTGCTGGGCAGG + Intronic
1060976466 9:127767985-127768007 GGAAGGATGGGCTGTTCCCCCGG - Intronic
1061225040 9:129276570-129276592 GAAAGGAGGGGCAGCTGCCCAGG - Intergenic
1062350084 9:136134216-136134238 GGAAGGTTGGGGAGATGACCAGG - Intergenic
1062476280 9:136728919-136728941 GGAAGGCCGCGCTGCTGTCCTGG + Intergenic
1062610361 9:137370700-137370722 GGAAGGCTGGGCAGGTGCCCAGG + Intronic
1185776740 X:2809250-2809272 GGAAGGATGCAATGGTGACCAGG + Intronic
1185779024 X:2829487-2829509 GGGAGGATGGGCGGCAGGCCGGG + Intronic
1194121763 X:89971547-89971569 GGAAGGGTGGGCTGGTCCCCAGG + Intergenic
1197772394 X:130097775-130097797 GCAAGGTGGGGCTGCTGGCCTGG - Intronic
1200474620 Y:3628998-3629020 GGAAGGGTGGGCTGGTCCCCAGG + Intergenic