ID: 1161373687

View in Genome Browser
Species Human (GRCh38)
Location 19:3927948-3927970
Sequence CCTTCCAACGATGAGTTTTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161373681_1161373687 2 Left 1161373681 19:3927923-3927945 CCCAAAGTCCTGGTCAGCAGCCC 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107
1161373678_1161373687 7 Left 1161373678 19:3927918-3927940 CCTCCCCCAAAGTCCTGGTCAGC 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107
1161373682_1161373687 1 Left 1161373682 19:3927924-3927946 CCAAAGTCCTGGTCAGCAGCCCA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107
1161373677_1161373687 8 Left 1161373677 19:3927917-3927939 CCCTCCCCCAAAGTCCTGGTCAG 0: 1
1: 0
2: 5
3: 22
4: 254
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107
1161373680_1161373687 3 Left 1161373680 19:3927922-3927944 CCCCAAAGTCCTGGTCAGCAGCC 0: 1
1: 0
2: 2
3: 19
4: 291
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107
1161373679_1161373687 4 Left 1161373679 19:3927921-3927943 CCCCCAAAGTCCTGGTCAGCAGC 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107
1161373683_1161373687 -6 Left 1161373683 19:3927931-3927953 CCTGGTCAGCAGCCCATCCTTCC 0: 1
1: 1
2: 2
3: 25
4: 279
Right 1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161373687 Original CRISPR CCTTCCAACGATGAGTTTTG CGG Exonic
901260925 1:7870124-7870146 CCTTCAACATATGAGTTTTGGGG - Intergenic
901946837 1:12711115-12711137 CCTTCCACTCATGACTTTTGAGG - Intergenic
906526548 1:46496579-46496601 CCTTCCAACTCTGAGCTTTTGGG - Intergenic
906730077 1:48073446-48073468 CATTCCAGGAATGAGTTTTGAGG - Intergenic
912873568 1:113331996-113332018 CTTGACACCGATGAGTTTTGTGG - Intergenic
915031879 1:152886787-152886809 GCTTCCACCGATGAGTTGGGGGG - Intergenic
916445942 1:164871770-164871792 CCTTCCAACTCCGAGGTTTGGGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919468884 1:197954406-197954428 GCTTACAAAGTTGAGTTTTGAGG - Intergenic
919575285 1:199301062-199301084 CCTTCCAAGCAGGATTTTTGAGG + Intergenic
921310088 1:213833889-213833911 CCTTTCAAAGATAAGTTCTGTGG - Intergenic
1075226101 10:120630660-120630682 CCTTGCAAAGATGACTCTTGTGG + Intergenic
1076657561 10:132035172-132035194 CCTTCAAAATATGAATTTTGGGG - Intergenic
1083375582 11:62217606-62217628 CCTTCCACTCATGACTTTTGAGG + Intergenic
1083444015 11:62695198-62695220 CCTTCCTACTCTGAGTCTTGGGG - Intronic
1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG + Intergenic
1087955686 11:104284932-104284954 TCTTCCAACGGTGCTTTTTGTGG + Intergenic
1088872194 11:113900365-113900387 CCTTCCAAGGATGATGTCTGGGG + Intergenic
1089477637 11:118778369-118778391 CCTTACAACAAAGAATTTTGTGG - Intronic
1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG + Intronic
1092586780 12:9908637-9908659 CCTTCCACTCATGACTTTTGAGG - Intronic
1093184408 12:16003386-16003408 ACTTCCACCTATGAATTTTGGGG + Intronic
1095344489 12:41133587-41133609 GCTTCCAAGTATGAATTTTGTGG - Intergenic
1108100517 13:46949135-46949157 CCTTTAAATGGTGAGTTTTGGGG + Intergenic
1114052718 14:18935106-18935128 CCTTCCCAGGGTGACTTTTGTGG + Intergenic
1114109840 14:19466820-19466842 CCTTCCCAGGGTGACTTTTGTGG - Intergenic
1115045790 14:28991587-28991609 CCTTGCAAAAATGAGTCTTGAGG - Intergenic
1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG + Intergenic
1118488990 14:66241008-66241030 CCTTCTAACCCTGATTTTTGAGG + Intergenic
1119188995 14:72666441-72666463 TCTTCCAAAGATGATCTTTGGGG + Intronic
1121879113 14:97484183-97484205 CCTTCCAAAGTAGAGTTTGGTGG - Intergenic
1126258171 15:46652985-46653007 CCTTTCAAAGTTGAGTTGTGGGG + Intergenic
1130536144 15:84786379-84786401 GCTTGCAAGGATGAGTTTGGAGG + Intronic
1132749248 16:1449828-1449850 CTTTAAAACGATGAGTTTTACGG + Intronic
1133856404 16:9553362-9553384 CCAACCAAAAATGAGTTTTGGGG + Intergenic
1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG + Intergenic
1136418011 16:30115133-30115155 CCTTGCACCCAGGAGTTTTGAGG + Intronic
1137432774 16:48432032-48432054 CCTTCCAAGGATGGGCTTTAGGG - Intronic
1138353149 16:56357465-56357487 CCTTCCAACGATGGTTATTTGGG + Intergenic
1140675108 16:77320305-77320327 CCTTCCAACTATGTTTTCTGTGG + Intronic
1141426539 16:83947859-83947881 CCTGCCAACGTGGAGTGTTGGGG - Intronic
1143688496 17:8539313-8539335 CATTCCAGGGATGAGTTTTATGG - Intronic
1148982490 17:51590580-51590602 CCTTTCAAGACTGAGTTTTGGGG - Intergenic
1149737967 17:59014536-59014558 AATTCCAACTATAAGTTTTGAGG + Intronic
1153285427 18:3451136-3451158 TTTTCCCACGATGAATTTTGGGG + Intronic
1153501321 18:5752761-5752783 CTTACCACCGATGAGTTCTGGGG + Intergenic
1154073891 18:11180043-11180065 CCTTGCAACTATGAGCTTTAAGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG + Intronic
1168476615 19:56680420-56680442 CCTGCTAACGGTGAGTTTTATGG - Intergenic
925338076 2:3113289-3113311 CCTTCACACGATGGGTTTGGAGG - Intergenic
926966084 2:18413069-18413091 CTTACCAACTATGTGTTTTGGGG - Intergenic
932308100 2:70718134-70718156 CCTACCAACTATTAGGTTTGAGG - Intronic
935048080 2:99499494-99499516 CCTTCCACTCATGACTTTTGAGG + Intergenic
941626261 2:167833925-167833947 ACTTCCAACGCTGAAATTTGAGG + Intergenic
942950855 2:181719661-181719683 CCTTCCACAGATTAGTTTTAGGG + Intergenic
943470594 2:188290493-188290515 CCTCCAAACCATGAGATTTGGGG + Intergenic
943890484 2:193279674-193279696 CCTTCCAACAATGATTTATTTGG + Intergenic
947980645 2:234405850-234405872 CCTTCCTATGATGAGTGATGGGG + Intergenic
1169711468 20:8569184-8569206 CATTCCTACGATGACTTTCGAGG - Intronic
1173340440 20:42148348-42148370 CCTTCCAAATCTGACTTTTGAGG - Intronic
1173616769 20:44408275-44408297 TCTTCCAAGGATCAGTTGTGGGG - Intronic
1177278585 21:18948914-18948936 CCTTCCAATGATCTGTTTTGTGG + Intergenic
1180471192 22:15657480-15657502 CCTTCCCAGGGTGACTTTTGTGG + Intergenic
1184543809 22:45151300-45151322 ACTTCAAAAGATGAATTTTGGGG + Intergenic
956891999 3:73622648-73622670 CCTCCCAACTAAGAGTTATGGGG + Intronic
959057223 3:101579701-101579723 CCTTATAACGATGCTTTTTGAGG + Intronic
961481954 3:127186830-127186852 CCTTTCATTGTTGAGTTTTGAGG + Intergenic
975302642 4:72808426-72808448 CATTCCAACAAAGAGTTTTAAGG + Intergenic
986626413 5:9727104-9727126 CCATCCAAGCATGTGTTTTGTGG - Intergenic
986841411 5:11701960-11701982 GCTTCCCATGATGAGTTATGTGG - Intronic
992833432 5:80617600-80617622 TCTTCCAGCGTTGAGTTTTGAGG + Intergenic
993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG + Intergenic
997353557 5:133247985-133248007 CCTTCCAACTCTGAGACTTGTGG - Intronic
997453799 5:134003754-134003776 CTCTCCTTCGATGAGTTTTGGGG - Intronic
1000780440 5:165473749-165473771 CATTCCAAAGATAAGTTCTGAGG - Intergenic
1001385034 5:171331529-171331551 GCTCCCAAAGCTGAGTTTTGTGG - Intergenic
1003772351 6:9319447-9319469 CCTTCCTAAGATGACATTTGAGG + Intergenic
1007352189 6:41282072-41282094 CCTCCCAAGGATGCGTTTGGTGG - Intronic
1007386284 6:41522381-41522403 CCTTCCAGCTTTGAGATTTGGGG + Intergenic
1008678487 6:53846176-53846198 CCTTCAAACACTGACTTTTGTGG + Intronic
1017578832 6:155837652-155837674 CCTTCCCTCTGTGAGTTTTGAGG + Intergenic
1019062191 6:169264559-169264581 CAGTGCAATGATGAGTTTTGAGG + Intergenic
1021136850 7:16975577-16975599 CCATCCAATGATGAGCTTTTTGG + Intergenic
1021432237 7:20573214-20573236 CCTTCCAACCATATTTTTTGAGG + Intergenic
1022280150 7:28900029-28900051 GCTTTCAACGATGACTTCTGGGG - Intergenic
1026079183 7:67202109-67202131 CCTTCCAATTATGTGTTTTCTGG + Intronic
1026697640 7:72609847-72609869 CCTTCCAATTATGTGTTTTCTGG - Intronic
1027160046 7:75795806-75795828 TCTGCCATCCATGAGTTTTGTGG - Intergenic
1028018506 7:85743497-85743519 CCTTCCACTCATGACTTTTGGGG - Intergenic
1030683884 7:112463087-112463109 CCTTCCAATGGTAAGATTTGAGG - Intronic
1034776848 7:153835738-153835760 TCATCCAACGATTGGTTTTGAGG + Intergenic
1035199398 7:157250834-157250856 CCTTCGGACGGTGAGTGTTGTGG + Intronic
1035345113 7:158192471-158192493 GCTGCCAACGCTGTGTTTTGAGG + Exonic
1046093502 8:109531354-109531376 CCTTCCCTCGAAGAGTTTTCAGG + Intergenic
1046754749 8:117961871-117961893 CCTTTCAACTATGAGATCTGTGG - Intronic
1047042215 8:121008545-121008567 CTTTCCAGGGATCAGTTTTGTGG - Intergenic
1049055893 8:140237291-140237313 CCCTGCGATGATGAGTTTTGAGG - Intronic
1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG + Intronic
1052772499 9:32702747-32702769 CTTTCCAAATCTGAGTTTTGAGG - Intergenic
1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG + Intergenic
1053878126 9:42564001-42564023 CATTCCAAACATGAATTTTGTGG + Intergenic
1053894534 9:42730365-42730387 CATTCCAAACATGAATTTTGTGG - Intergenic
1054233568 9:62537693-62537715 CATTCCAAACATGAATTTTGTGG - Intergenic
1054264209 9:62902745-62902767 CATTCCAAACATGAATTTTGTGG - Intergenic
1055725574 9:79224621-79224643 CCTTGCAACCATCAGTTCTGGGG + Intergenic
1058650347 9:107170090-107170112 CCTTCCAAGTGTTAGTTTTGGGG + Intergenic
1060806801 9:126582823-126582845 CTTCCCAAGGATGAGGTTTGTGG - Intergenic
1186335233 X:8579785-8579807 CCCTCCAGCGAGGAGTTCTGAGG + Intronic
1192063660 X:67857817-67857839 CCTTGCAAAGCTGACTTTTGTGG - Intergenic
1194378290 X:93163222-93163244 CCTTGCAATTCTGAGTTTTGGGG - Intergenic
1199319133 X:146417732-146417754 CCTACCCACTATGAGTTTGGAGG + Intergenic