ID: 1161374814

View in Genome Browser
Species Human (GRCh38)
Location 19:3933858-3933880
Sequence CGGTGTCCCCAGTGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161374799_1161374814 20 Left 1161374799 19:3933815-3933837 CCCGAGGTCAGAGTGCAGGGAGG 0: 1
1: 0
2: 3
3: 48
4: 418
Right 1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG 0: 1
1: 0
2: 3
3: 20
4: 226
1161374797_1161374814 23 Left 1161374797 19:3933812-3933834 CCGCCCGAGGTCAGAGTGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 148
Right 1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG 0: 1
1: 0
2: 3
3: 20
4: 226
1161374801_1161374814 19 Left 1161374801 19:3933816-3933838 CCGAGGTCAGAGTGCAGGGAGGA 0: 1
1: 1
2: 1
3: 55
4: 713
Right 1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG 0: 1
1: 0
2: 3
3: 20
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161374814 Original CRISPR CGGTGTCCCCAGTGGGAAGG GGG Intronic
900298683 1:1965708-1965730 GGGTGTCCCCAGTGGGCAGGTGG + Intronic
900386408 1:2412899-2412921 CGCTGTCCCCAGTGGGAGGGCGG - Intronic
900595909 1:3480103-3480125 CTGTGTCCCACGTGGGGAGGAGG + Intronic
900792228 1:4688141-4688163 CGGTGGCCCCAGTGAGACGGGGG + Intronic
901070545 1:6515208-6515230 AGTTGTCCCAAATGGGAAGGTGG - Intronic
901622321 1:10598409-10598431 CTGTGTCCCCACTGGAAATGCGG + Intronic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
901841265 1:11955402-11955424 CTGAGTCCCCTGTGGGGAGGAGG - Intronic
902830741 1:19010685-19010707 CGGTGTCCTCTGTGGAAATGTGG - Intergenic
902985601 1:20152416-20152438 GGGTGTCCCGAGGGGGTAGGCGG - Intergenic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903460449 1:23516959-23516981 CAGCAACCCCAGTGGGAAGGGGG - Intronic
903837721 1:26216401-26216423 AGGTGTTCCCAGTCTGAAGGGGG - Intergenic
904750224 1:32737296-32737318 AGGTCTCCCAAGTGGAAAGGGGG + Intergenic
905518605 1:38580366-38580388 CTGTGTTCCCAGTGGGACGTGGG - Intergenic
906908966 1:49925738-49925760 CGGTGCTCCCCGTGGGCAGGTGG + Intronic
908068032 1:60428892-60428914 AGGAGTCCCCAGTTGGATGGAGG + Intergenic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
912971219 1:114285225-114285247 TGGTGCAGCCAGTGGGAAGGAGG + Intergenic
916655107 1:166868426-166868448 AGGTGTCCGTAGTGGGGAGGTGG - Intronic
916879339 1:169004173-169004195 GGGTTTCCCCTGGGGGAAGGAGG + Intergenic
917978633 1:180255918-180255940 CGGGGTCCCCAGTGGGATCTGGG + Intronic
919805697 1:201379960-201379982 CTGCGTCCCCAGTAGGAACGAGG + Intronic
920358196 1:205391701-205391723 AGGTGTCCCCAGTGGGAGCCTGG + Intronic
920651455 1:207840401-207840423 CGATGCCCACAGTGGGAAGGGGG - Intergenic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
922864586 1:228848638-228848660 CGGGGTCCTCAGTGAGAAGCTGG - Intergenic
1062814522 10:489826-489848 CCGTGTCCCTAGTGTGAAGGTGG - Intronic
1062814567 10:490023-490045 CCGTGTCCCTAGTGTGAAGGTGG - Intronic
1063577858 10:7278267-7278289 TGATGTCCACAGTGAGAAGGGGG + Intronic
1066364467 10:34763434-34763456 CTGTGTCCTCTGGGGGAAGGTGG + Intronic
1067226034 10:44376293-44376315 CCTTGTCCCCAGTGGGAATCAGG - Intronic
1069553411 10:69380676-69380698 AGTTGTCCCCATTGGCAAGGAGG + Intronic
1070628488 10:78067868-78067890 TGGTGTCCCCAGGGGAAGGGTGG + Intergenic
1070642657 10:78180665-78180687 TGGGGTCCCCAGGGAGAAGGGGG - Intergenic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1073481263 10:103787524-103787546 AGGAATCCCCAGTGGGAGGGTGG - Intronic
1076373359 10:129968427-129968449 CCTGGGCCCCAGTGGGAAGGAGG + Intergenic
1076386972 10:130064217-130064239 CGGTGTCCTCTGTGGGTGGGGGG - Intergenic
1076854834 10:133111034-133111056 AGGTGTCCCTGGTGGGCAGGTGG - Intronic
1081569371 11:44280061-44280083 CTTTCTCCCCAGTGGGTAGGAGG - Intronic
1081786528 11:45751521-45751543 TGGTGCCCCCAGAGGGAAGCTGG + Intergenic
1082806845 11:57457239-57457261 GGGTATGCCCAGAGGGAAGGGGG + Intergenic
1082868354 11:57920281-57920303 AGGAGTCCTCAGTGGGAATGTGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084492484 11:69486397-69486419 TGGAGGCCCCAGTGGGCAGGTGG - Intergenic
1084689294 11:70715851-70715873 TGGAGTCGCCAGTGGGGAGGAGG + Intronic
1084715729 11:70872375-70872397 CGGGGTGCACAGTGGAAAGGAGG + Intronic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1085468320 11:76739136-76739158 CGCTGGCCCCAGTAGGAATGTGG - Intergenic
1085532605 11:77200920-77200942 CCCTGTCCTCAGTGGGGAGGGGG + Intronic
1085950794 11:81328830-81328852 GGGTATCCCTAGTGGCAAGGTGG - Intergenic
1086184591 11:83998588-83998610 AGGAGTCCACAGTGGGAATGTGG - Intronic
1088818076 11:113434878-113434900 GGGTGTCCCCAGGGGGAGGCTGG + Intronic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1096192651 12:49630585-49630607 GGGGGGCCCCGGTGGGAAGGGGG - Exonic
1099222747 12:79934542-79934564 CGGTTTCCCCAGAGGGCGGGAGG - Intronic
1099298474 12:80861322-80861344 CGGTGTCACCAGTGCCAAGAGGG - Intronic
1102520199 12:113472984-113473006 CGCTGGCCCCAGGGGAAAGGAGG - Intergenic
1104875954 12:132034958-132034980 CGGTGAGCCCAGTGGACAGGCGG + Intronic
1105801068 13:23903677-23903699 AGGTGTCCCCAGCGGGAGGTCGG - Intergenic
1107094451 13:36519630-36519652 CCGTTTCCCCACTGAGAAGGTGG + Intergenic
1110424834 13:75355114-75355136 CAGTGTCCACACTGGGAATGTGG + Intronic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1113566547 13:111322882-111322904 CGGTGGCCTCAGCGGGCAGGTGG + Intronic
1113749226 13:112766841-112766863 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749257 13:112766920-112766942 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749305 13:112767040-112767062 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749322 13:112767079-112767101 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749370 13:112767199-112767221 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749387 13:112767238-112767260 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749404 13:112767277-112767299 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749422 13:112767317-112767339 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749440 13:112767357-112767379 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749458 13:112767397-112767419 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1113749475 13:112767436-112767458 TGGGGGCCCCTGTGGGAAGGTGG + Intronic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1114552635 14:23542192-23542214 GCCTGTCCCCAGTGAGAAGGAGG + Intronic
1117745092 14:58861042-58861064 AGGAGTCCACAGTGGGAATGTGG + Intergenic
1117869665 14:60186949-60186971 CTGTTTCCCCAGTGGGAATGCGG - Intergenic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1121251919 14:92505919-92505941 TGGTCTCCCCAGGGTGAAGGAGG + Intergenic
1122133768 14:99620820-99620842 GGGTGTCCCCAGAGGGAAATGGG - Intergenic
1122191171 14:100044879-100044901 CACTGTCCCCAGTGGGAAAGTGG - Intronic
1125003412 15:34794639-34794661 AGGGGTCCCGAGTGGGACGGGGG + Intronic
1125342467 15:38688449-38688471 GGGTGTCCACTGTGGGGAGGTGG + Intergenic
1129423950 15:75451571-75451593 CGGTGCCCAGACTGGGAAGGAGG + Exonic
1132602178 16:778275-778297 CTGTGTCCCCAGTGAGGACGAGG - Intronic
1133042540 16:3068114-3068136 TGGGGGCCACAGTGGGAAGGGGG + Intronic
1134008226 16:10832680-10832702 CAGAGTCTCCAGTGGGAGGGGGG + Intergenic
1134875395 16:17693705-17693727 CGGTGTGCCAGGAGGGAAGGGGG - Intergenic
1136086717 16:27890501-27890523 CTGTGGCCACAGTGGGAATGAGG + Intronic
1136487941 16:30585330-30585352 CGGTGTCCCCAGAGGCTAGTGGG - Intronic
1136672887 16:31873986-31874008 GGGGGTCCCCAGAGGGAGGGAGG + Intronic
1138245444 16:55463663-55463685 CACTGTCCTCAGTGGGGAGGAGG + Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139160971 16:64508075-64508097 AGGAGTCCACAGTGGGAATGTGG + Intergenic
1139303866 16:65967014-65967036 AGATGTCCCCAGTGGGAATTTGG - Intergenic
1139510086 16:67422677-67422699 CGGTGGCCACAGTGAGGAGGAGG - Intergenic
1141158721 16:81614534-81614556 TGGTTTCCCCAGTGGAAATGTGG + Intronic
1141418178 16:83893251-83893273 GGCCTTCCCCAGTGGGAAGGGGG + Intergenic
1142142542 16:88478999-88479021 TGGGCTCCCCAGTGGGTAGGTGG + Intronic
1142161912 16:88562054-88562076 CGCTGTTCCCGGGGGGAAGGGGG - Intergenic
1142280445 16:89145147-89145169 CGGTGTCCTCTGAGGAAAGGGGG - Intronic
1142280459 16:89145200-89145222 CGGTGTCCCCTGAGGAAAAGGGG - Intronic
1142280472 16:89145253-89145275 CGGTGTCCCCTGAGGAAAAGGGG - Exonic
1142434323 16:90047332-90047354 GGGTGTCCCCAGTGGGGCAGGGG - Intergenic
1142961356 17:3554268-3554290 CGGTGTCCCCATTCCAAAGGTGG + Intronic
1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG + Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145156936 17:20550171-20550193 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145799100 17:27672043-27672065 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1146058107 17:29591078-29591100 TGGTGGCCTCAGCGGGAAGGGGG + Intronic
1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1147428387 17:40357000-40357022 CGGCTTCTCCAGTGGGAGGGAGG - Intronic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1149627888 17:58092684-58092706 TGCTGTTCCCAGTGGGGAGGGGG - Exonic
1152693718 17:81733654-81733676 CTGTGTCCCCACTAGGAAGCCGG + Intergenic
1157557242 18:48620931-48620953 CCCTGTCCCCACTGGGAAGCAGG + Intronic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1159957182 18:74527082-74527104 TGGAGCCGCCAGTGGGAAGGAGG + Intergenic
1160310813 18:77788453-77788475 AGGTGCTCCCAGTGGGCAGGAGG + Intergenic
1160522673 18:79517456-79517478 CGCTGTGTCCAGTGGGACGGTGG + Intronic
1161265824 19:3363882-3363904 CAGTGTCCACAGTGCCAAGGGGG + Intronic
1161267180 19:3369752-3369774 CGGTGGCGCCAGCGGGAGGGAGG - Intronic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1161542606 19:4861152-4861174 TGGTGTCCCCAGTTGGGAGGGGG - Intronic
1161649384 19:5474925-5474947 AGGTGTCCACAGAGTGAAGGTGG + Intergenic
1162057072 19:8071260-8071282 GGGTGGCCCGAGAGGGAAGGAGG + Intronic
1162766837 19:12924865-12924887 CGGGGGCCCCAGTGGGGAGAGGG - Intronic
1163263120 19:16203352-16203374 CGGAGTCCCCAGAGCGAAGCAGG + Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1163758270 19:19119828-19119850 CCGTGTCCCCAGCTGCAAGGTGG - Exonic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1166644683 19:44522856-44522878 TGGTGTTGCCAGTGGGGAGGTGG - Exonic
1167551767 19:50166087-50166109 GGGTGTCCTCACTGGGGAGGTGG + Intergenic
1167748277 19:51365606-51365628 TGTTGTCCCCAGAGGGAAGCTGG - Intronic
1168026525 19:53647703-53647725 GGGTGTCCCAGGTGAGAAGGTGG - Intergenic
1168122028 19:54256910-54256932 CCTTGTCCCCAGTGAGAAGAAGG + Intronic
1168125472 19:54280213-54280235 CCTTGTCCCCAGTGAGGAGGAGG + Intronic
1168171782 19:54594505-54594527 CCTTGTCCCCAGTGAGGAGGAGG - Intronic
1168176503 19:54631335-54631357 CCTTGTCCCCAGTGAGGAGGAGG - Intronic
925141159 2:1550648-1550670 GGGTGGCCCACGTGGGAAGGAGG - Intergenic
927156018 2:20222252-20222274 CTCTGGCCCCAGTGGGAAGCAGG - Intronic
927571969 2:24167762-24167784 CAGAGTCCACAGTGGGAGGGAGG + Intronic
929557724 2:42936089-42936111 CCCTGTCCCCAGTGTGAGGGGGG - Intergenic
929588021 2:43128139-43128161 CGAGGTCCCCAGTGGGAAGTGGG + Intergenic
930156960 2:48115518-48115540 TGGTGCCCCCAGGAGGAAGGAGG - Intergenic
931392310 2:61854533-61854555 CGGGGGCCAGAGTGGGAAGGAGG + Intergenic
933851054 2:86366973-86366995 CGGTGTCCCCATTGTGAAATGGG + Intergenic
935122747 2:100196969-100196991 CGAAGGCCCCAGCGGGAAGGGGG - Intergenic
936019014 2:108980793-108980815 CGGTGTCACTGGTGGGGAGGTGG + Intronic
938119339 2:128622833-128622855 CTGTGTCCCCAGTGGCTAGCAGG - Intergenic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
941421512 2:165287705-165287727 AGGTGTCCCCAGTGGGCAAGGGG - Intronic
946178145 2:217934444-217934466 CAGTGTCTCCACTGGGTAGGTGG - Intronic
948754307 2:240150248-240150270 CTGTCTCCCCTGGGGGAAGGAGG + Intergenic
1169050472 20:2572640-2572662 CGATGTCCCCAGACGGATGGGGG + Intronic
1171157469 20:22889639-22889661 CTGTGACTTCAGTGGGAAGGTGG - Intergenic
1172158754 20:32849645-32849667 AGGAGTCCCCAGTGGGCAAGGGG - Exonic
1175916760 20:62429595-62429617 CTGGGTCCCCAGGGAGAAGGTGG + Intergenic
1178723690 21:35032661-35032683 AGGTGTCCCTTGTGGGAAGCTGG - Intronic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1181028724 22:20139989-20140011 AGGGATCCCCAGTGGGCAGGTGG + Intronic
1181081695 22:20419789-20419811 ATTTGTCCCCAGTGGGAAGATGG - Intergenic
1181462873 22:23095624-23095646 CAGTGTCCCCTGTGGCAAGAGGG + Exonic
1182443889 22:30379431-30379453 CCATGTCCACACTGGGAAGGAGG - Exonic
1183539162 22:38419601-38419623 CAGTGCCCACAGTGAGAAGGAGG - Intergenic
1183628713 22:39020628-39020650 CGGTGGCCACCGTGGGAGGGAGG - Intronic
1183775043 22:39958488-39958510 CTGTGTCCCCAGTGCCCAGGAGG + Intronic
1184251609 22:43263558-43263580 CGGTGTGTCCCGGGGGAAGGAGG - Intronic
1184857108 22:47152344-47152366 CGGTGCCCCCAGGGGCCAGGGGG - Intronic
951196108 3:19825540-19825562 CTGTGTCCCAGGTGGGAAGAGGG - Intergenic
952476570 3:33717378-33717400 CGGTCTGCCCAGTGGGGACGCGG + Intronic
953625259 3:44565633-44565655 CGAAGTCCCCACTGGGGAGGTGG - Exonic
956195501 3:66650075-66650097 CAATGTCCCCTGTGGGAAGCTGG - Intergenic
959697483 3:109264107-109264129 GGGTTTCACCAGTGGGAATGGGG - Intergenic
963906707 3:150779156-150779178 CGGTGTGCCCAGGGAAAAGGTGG - Intergenic
967412135 3:189177675-189177697 TGGTGTACCAAATGGGAAGGGGG + Intronic
968440852 4:623798-623820 CGGAGGCCCCTGTGGGAGGGAGG + Intergenic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
971048339 4:22831251-22831273 AGGTGTCCACAGTGGCAATGGGG - Intergenic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
971925964 4:33010006-33010028 AGGAGTCCCCAGTGGGAAAGGGG + Intergenic
973729467 4:53809852-53809874 AGGGGTCCCCAGTGGGAGGGAGG - Intronic
976217536 4:82729274-82729296 GGGTTTCCCCAGAAGGAAGGAGG + Intronic
980098602 4:128519016-128519038 CTGTGCCCACGGTGGGAAGGAGG + Intergenic
981998462 4:151000951-151000973 AGGAGTCCACAGTGGGAATGTGG - Intronic
985668787 5:1195874-1195896 CTGTGTCCCCAGGGGGTGGGAGG - Intergenic
992102807 5:73423540-73423562 CAGGGTCCCCAGTAGGTAGGTGG + Intergenic
992542107 5:77775917-77775939 CGGCGCCCGCGGTGGGAAGGTGG - Intronic
992981692 5:82181527-82181549 AGGTGTCCTCAGTGAGATGGAGG + Intronic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
1001529340 5:172451425-172451447 GGGTGTCACAATTGGGAAGGGGG + Intronic
1002691550 5:181053634-181053656 CGGTGACCCCGGTGGGGAAGGGG + Intronic
1003163354 6:3654983-3655005 TGGAGTCCACAGTTGGAAGGAGG + Intergenic
1006114965 6:31770642-31770664 AGGTGTCCCTGGTGGGAAGGTGG + Intronic
1006339287 6:33437799-33437821 CGGTGTCCCCAGAGGCAGAGCGG - Exonic
1006871827 6:37258201-37258223 GGGTGACCTCAGCGGGAAGGTGG + Intronic
1007109383 6:39304212-39304234 AGCTGTCCCCAGTAAGAAGGGGG + Intronic
1014411325 6:121125453-121125475 CGGTATCTCCTGTAGGAAGGAGG + Intronic
1014459024 6:121673092-121673114 TGGTGTCCCCAGTGGCAGGACGG - Intergenic
1014818836 6:125963050-125963072 CGTTGTCCCCTGTTGGAAGATGG + Intronic
1015858001 6:137646125-137646147 GGGAGTCCTCAGTGGGAATGTGG + Intergenic
1017711316 6:157170679-157170701 GGGTGGCCACAGTGGGGAGGGGG + Intronic
1018907969 6:168086184-168086206 CAGTGTCCACACTGGGAATGTGG - Intergenic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019720745 7:2569119-2569141 GGGAGACCCCAGTGGGAATGGGG - Intronic
1019749392 7:2719199-2719221 AGGTGGCCCCTGTCGGAAGGGGG + Intronic
1020342850 7:7131361-7131383 CTGTGTGCCCAGTGGGCTGGAGG - Intergenic
1022247592 7:28575568-28575590 CGCTGTCTCCAGCAGGAAGGAGG - Intronic
1023057364 7:36300827-36300849 AGGTCTCTCCAGTGGGAGGGCGG + Exonic
1024326707 7:48114692-48114714 CTGTGTCCTCAGTGAGAAGGAGG - Intergenic
1024991176 7:55235468-55235490 CGGTGGCTCTAGCGGGAAGGTGG + Intronic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1030087552 7:105829995-105830017 GTGTGTCCCCAGTGACAAGGAGG - Intronic
1033025319 7:137766633-137766655 GGGTGTGCTGAGTGGGAAGGAGG - Intronic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1036176226 8:6540958-6540980 TGCTGTCCCCAGGGGGCAGGTGG + Intronic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036504748 8:9345097-9345119 AGGTCTCCCCAGTGGGCAGAAGG + Intergenic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1037892106 8:22628913-22628935 CGCTGTCCCCAGCAGGCAGGGGG + Intronic
1039971124 8:42322564-42322586 TGGTGTCCCGTGTGGGATGGCGG - Intronic
1049101271 8:140580584-140580606 TCCTGTCCCCAGTGGGGAGGTGG - Intronic
1055828895 9:80358116-80358138 CGGGGTCCCCAGCAGGAAGCAGG - Intergenic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1056224010 9:84477709-84477731 AGGTGTCCCCAGGGGAAAGCTGG - Intergenic
1057462010 9:95271522-95271544 AGGTGTCCCCAGAGGGAATGTGG + Intronic
1060151725 9:121293121-121293143 CATTGTCCCCATCGGGAAGGTGG + Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1062269716 9:135702846-135702868 AAGAGTCCCCAGTGGGAAGTGGG + Intronic
1062398280 9:136361415-136361437 CGCTGTCCACCGAGGGAAGGAGG + Intronic
1186608218 X:11112788-11112810 AAATGTCCCCTGTGGGAAGGGGG - Intronic
1190960369 X:55240919-55240941 CTGAGTTCCCAGTGGGGAGGGGG + Intronic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic