ID: 1161376129

View in Genome Browser
Species Human (GRCh38)
Location 19:3939896-3939918
Sequence GTACAAGTCCACCAGGGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161376129_1161376141 25 Left 1161376129 19:3939896-3939918 CCAGGCCCCTGGTGGACTTGTAC 0: 1
1: 0
2: 4
3: 8
4: 116
Right 1161376141 19:3939944-3939966 CGTATGAAGAGTGCAAGTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1161376129_1161376138 22 Left 1161376129 19:3939896-3939918 CCAGGCCCCTGGTGGACTTGTAC 0: 1
1: 0
2: 4
3: 8
4: 116
Right 1161376138 19:3939941-3939963 TCCCGTATGAAGAGTGCAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161376129 Original CRISPR GTACAAGTCCACCAGGGGCC TGG (reversed) Exonic
900499894 1:2998951-2998973 CTAGAAGTTCACCAGGGTCCGGG - Intergenic
902039049 1:13479620-13479642 ACACAAGCCCACCAGGGGCGGGG + Intronic
904466669 1:30712247-30712269 GCACTGGTCCAACAGGGGCCTGG + Exonic
904623532 1:31789462-31789484 CTTCCAGTCCAGCAGGGGCCAGG + Intergenic
905441896 1:38001147-38001169 GCATGAGGCCACCAGGGGCCAGG + Intronic
906055659 1:42914891-42914913 TAAAAATTCCACCAGGGGCCAGG + Intergenic
907476134 1:54706825-54706847 GTACAAGCCTAGCAGGAGCCTGG + Intronic
910060596 1:83087212-83087234 TTACAAGTCGTCCATGGGCCGGG - Intergenic
915525882 1:156475990-156476012 GGACAAGTCCAGCCTGGGCCTGG + Intronic
920413801 1:205784034-205784056 GCAAAAGTCCAGCAGGCGCCAGG - Intergenic
922169809 1:223144544-223144566 CTGCAAGACCAGCAGGGGCCTGG + Intergenic
1078102862 11:8339943-8339965 GCACAAGCTCACCAGGGGCAGGG - Intergenic
1078317855 11:10306845-10306867 GTGCAAGTGCCCCAGGGGGCGGG + Exonic
1078527553 11:12111743-12111765 GGACCAGCCCACAAGGGGCCTGG - Intronic
1081858088 11:46316511-46316533 GAACCAGCCCACCAGGCGCCAGG - Intronic
1084148962 11:67279245-67279267 ATAGAATTCCACCAAGGGCCTGG - Exonic
1084616142 11:70237226-70237248 GTGAAAGTAAACCAGGGGCCTGG - Intergenic
1084638524 11:70409985-70410007 GTCCAAGCACACCAGGAGCCTGG - Intronic
1085279813 11:75322585-75322607 GTACAAGGCCAGCAGGGACATGG + Intronic
1086084191 11:82938192-82938214 GTAGAAGTCCACCCTGAGCCTGG - Intronic
1090911968 11:131129187-131129209 CTAGCATTCCACCAGGGGCCTGG - Intergenic
1093162456 12:15764404-15764426 GTTCAAGTCCACAAGGTTCCAGG + Intronic
1098329703 12:69340498-69340520 GTACAAGCCAGCCAGGGGACTGG - Intergenic
1099104155 12:78479352-78479374 AAACAAAGCCACCAGGGGCCAGG + Intergenic
1100619610 12:96258628-96258650 GTACAAAACCACCCTGGGCCGGG + Intronic
1101303660 12:103505645-103505667 GTATATGCCCCCCAGGGGCCTGG - Intergenic
1105291311 13:19055460-19055482 GTTCAATTTCAGCAGGGGCCTGG - Intergenic
1105482739 13:20793839-20793861 GTACAAGTCCTACTGGGTCCAGG + Intronic
1115785633 14:36822240-36822262 TAACAAGTCCACCAGGGTCATGG + Intronic
1117282990 14:54258676-54258698 AAGCAAGTCCACCAGGTGCCAGG + Intergenic
1117409472 14:55438262-55438284 CTACAAGTCCAGCAGGTGGCAGG + Intronic
1121218205 14:92264689-92264711 CCAAAAGACCACCAGGGGCCAGG + Intergenic
1121557907 14:94852143-94852165 GCCTATGTCCACCAGGGGCCAGG + Intergenic
1122417693 14:101558192-101558214 TTACAACTCCAGCAGGGGGCGGG - Intergenic
1129629810 15:77246300-77246322 TCAAAAGTCCAGCAGGGGCCAGG - Intronic
1130776606 15:86990793-86990815 GTTCAAGGCCACCAGGAGCAAGG + Intronic
1130980990 15:88811738-88811760 GTCCAAGTCTTCCAGGGGACTGG - Intronic
1131215334 15:90530675-90530697 GCACAAGTCCATCCAGGGCCCGG + Intronic
1132365599 15:101254168-101254190 GTAGAAGTCTGCCAGGGGCAGGG + Intergenic
1132572875 16:651637-651659 GTTCTAGTCCTCCTGGGGCCGGG + Exonic
1133119503 16:3597424-3597446 GTAGAAGTCCTCCATGGCCCAGG + Exonic
1133347888 16:5082584-5082606 GCACACGTCCTCCAGTGGCCTGG + Exonic
1134200036 16:12190557-12190579 GTAGCTGTTCACCAGGGGCCTGG + Intronic
1143101355 17:4506421-4506443 TCCCAAGACCACCAGGGGCCAGG - Intronic
1144683811 17:17213342-17213364 GTCTAAGTCCACAAGGGGCCTGG + Exonic
1145103044 17:20092727-20092749 GAACAAGTCCATCAGGTGCCAGG - Intronic
1147053528 17:37816346-37816368 ATACAAGACTTCCAGGGGCCAGG - Intergenic
1147862775 17:43533290-43533312 GTCCAAGGGCACCAGGGGCAGGG + Exonic
1148469441 17:47884264-47884286 GCACAAGGCCTGCAGGGGCCTGG + Intergenic
1152284484 17:79404278-79404300 GTCCCAGCCCACCAGGGGCCTGG + Intronic
1152460467 17:80439546-80439568 GTAAAACTCCACTCGGGGCCTGG - Intergenic
1155238761 18:23846332-23846354 GTAAAAGGCCACCAGGGACCTGG - Exonic
1160938120 19:1607071-1607093 GTAAGAGTTCACCAGTGGCCGGG + Intergenic
1161376129 19:3939896-3939918 GTACAAGTCCACCAGGGGCCTGG - Exonic
1162523186 19:11193829-11193851 GTGGACGTCCACCAGGAGCCAGG + Exonic
1163111053 19:15161156-15161178 GTACACATCCTCCAGGGGGCTGG + Exonic
1165844555 19:38809847-38809869 TTACAAGTCTGCCACGGGCCAGG + Intronic
1166779379 19:45332848-45332870 GTACTAGGCCACCAGGGCTCTGG + Intergenic
1166785413 19:45364165-45364187 GGACAAGTCAGACAGGGGCCAGG + Intronic
1167393436 19:49211575-49211597 GGACAAGGCCACCAGGTGCGGGG - Exonic
1167589328 19:50394806-50394828 GTACTTGTCCCCCAGGGTCCAGG - Intronic
925061391 2:893527-893549 GGACAAGTCCTCCAGCAGCCTGG - Intergenic
927850393 2:26495029-26495051 GTTCAAGCCCACCAGCTGCCGGG + Exonic
930379356 2:50608004-50608026 GGCCAAGCCCACCTGGGGCCTGG + Intronic
933205840 2:79506824-79506846 GTACAAAACCACCATGTGCCTGG - Intronic
934761396 2:96858873-96858895 TTACAAGTCCAGCAAGGGGCAGG + Intergenic
936556952 2:113504053-113504075 GAACAGGTGCACCAGGGTCCCGG + Intergenic
941622406 2:167793120-167793142 GAACAAGTCCACCAGGGCCCAGG + Intergenic
942206527 2:173625108-173625130 GGACAAGACCACCAAGGGCCTGG - Intergenic
944597039 2:201270519-201270541 GTTCAAGTCCCCTAGTGGCCAGG - Intronic
947607844 2:231500714-231500736 ATAAAAGTGCACCAGAGGCCAGG - Intergenic
948243963 2:236462374-236462396 GTAGAAACCCACCAGGCGCCGGG + Intronic
948388012 2:237593681-237593703 AGACATGTCCACCAGGGGCTTGG + Intronic
1173127811 20:40356189-40356211 TTACATGTCTATCAGGGGCCAGG - Intergenic
1175253385 20:57623084-57623106 CTGCAAGCCCACCAGGGACCTGG - Intergenic
1180049447 21:45324648-45324670 GTCCAAGGCCCCCAGGGGCTGGG + Intergenic
1181684598 22:24519863-24519885 GCACAAGCCCACCAGGCCCCCGG + Intronic
1182125655 22:27813991-27814013 CTACAAGCTCACCAGGGGCAGGG + Intergenic
1183101431 22:35586399-35586421 AAACGAGCCCACCAGGGGCCAGG - Intergenic
1183394931 22:37566302-37566324 GTCCATGCCTACCAGGGGCCGGG - Exonic
1184192208 22:42902356-42902378 GCACATGTCCACCAGGGGGAGGG - Intronic
1184306373 22:43605347-43605369 GTAAAACTCCACAAGGGGCCAGG + Intronic
1185014265 22:48334160-48334182 ATACATGACCCCCAGGGGCCAGG + Intergenic
950405733 3:12803429-12803451 GCCCAAATCCACCAGGGCCCAGG + Intronic
950489908 3:13297917-13297939 GTACATGTGCTCCAGGGGCTTGG - Intergenic
950858719 3:16128679-16128701 TTACAGGGCCACCAGTGGCCGGG + Intergenic
953672992 3:44978161-44978183 GTTAAAGTATACCAGGGGCCGGG + Intronic
954748808 3:52802461-52802483 GTCCTCGTCCACCAGGCGCCCGG - Exonic
957052266 3:75419850-75419872 GCACACGTCCTCCAGTGGCCTGG + Intergenic
959162845 3:102740936-102740958 CTACAAGTCAGCCAGGGGGCAGG - Intergenic
961302588 3:125931705-125931727 GCACATGTCCTCCAGTGGCCTGG - Exonic
961885882 3:130096074-130096096 GGACACGTCCTCCAGTGGCCTGG + Exonic
964375424 3:156044430-156044452 GCACACGTCCTCCAGTGGCCTGG - Intronic
967197324 3:187039798-187039820 CTCCAAGTCCACCAGGTGGCTGG - Intronic
969419538 4:7084097-7084119 GTACAGCTCCACCTGGGACCTGG - Intergenic
969818894 4:9706041-9706063 GCACATGTCCTCCAGTGGCCTGG - Intergenic
970594059 4:17583975-17583997 GCACAAGGCCAGCAGGTGCCAGG - Intronic
970772456 4:19630289-19630311 GGACATGTCGACTAGGGGCCAGG + Intergenic
979642340 4:123023823-123023845 GTTCAAGTCAACCAGAAGCCAGG - Intronic
983882910 4:172952991-172953013 GTACAAGGCAATGAGGGGCCTGG + Intronic
985566119 5:618586-618608 CTCCAAGTACAGCAGGGGCCGGG + Intronic
997193693 5:131963222-131963244 GCAGAAGTCCTACAGGGGCCTGG - Intronic
997376361 5:133400461-133400483 GTACAGGTTCACTAGGGACCAGG - Intronic
1001184542 5:169556278-169556300 GTTCATGTACACCAGGGGGCAGG - Intergenic
1001955976 5:175848374-175848396 GTACAAGTCAACCAGGGGACAGG + Intronic
1002132549 5:177090514-177090536 GTACACGGCCAGCAGGTGCCAGG - Exonic
1014768049 6:125429823-125429845 GTAGAAATCCACCTGGGTCCAGG - Intergenic
1017747639 6:157461130-157461152 ACACACGTCCTCCAGGGGCCTGG + Intronic
1023881248 7:44322906-44322928 GGACATGTCCACCTGGGGCCAGG + Intronic
1027668459 7:81068285-81068307 GGACATGTACACCAGGGGACAGG + Intergenic
1028503628 7:91547255-91547277 GTGCAAGTCTACCATGTGCCTGG - Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1032196586 7:129792870-129792892 GGCCAAGTTCACCAGAGGCCCGG + Intergenic
1037102645 8:15066011-15066033 TTAGAAGTCCACCTTGGGCCGGG + Intronic
1037506454 8:19534585-19534607 GTACCATTCAGCCAGGGGCCAGG + Intronic
1042867708 8:73370127-73370149 TTGAAAGTCCAGCAGGGGCCAGG + Intergenic
1046614144 8:116457376-116457398 GGACAACTCCACAAGGAGCCAGG - Intergenic
1049450364 8:142658108-142658130 TTCCAAGTCCCCCAGGGGCCTGG + Intronic
1049896049 9:113248-113270 GAACAGGTGCACCAGGGTCCCGG - Intergenic
1052744413 9:32426065-32426087 GTACAACTCCGCCAAGGCCCTGG - Intronic
1061014044 9:127971790-127971812 GTACAAGGCCAAAAGAGGCCAGG + Intronic
1061436764 9:130568172-130568194 GTACGATTCCACCAGGGGCCTGG + Intergenic
1186703984 X:12122732-12122754 GAACAAGGCCACCAGGGGCCAGG + Intergenic
1186817535 X:13252586-13252608 TAACAAGTCCACCAGGACCCTGG - Intergenic
1189717989 X:43884298-43884320 GTGCAAGTCAGCCAGGAGCCTGG + Intergenic
1190944565 X:55079091-55079113 GGAAAAGGCCACCTGGGGCCAGG + Intergenic
1190945808 X:55093024-55093046 GGAAAAGGCCACCTGGGGCCAGG + Intronic
1190964360 X:55284405-55284427 GGAAAAGGCCACCTGGGGCCAGG + Intronic
1191848899 X:65571048-65571070 GTAGAACTCCACCATGGCCCTGG - Intergenic