ID: 1161380682

View in Genome Browser
Species Human (GRCh38)
Location 19:3963613-3963635
Sequence CAGCCGAGGGGGCCCCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161380676_1161380682 -4 Left 1161380676 19:3963594-3963616 CCATGCCAGCTGTGTTGCACAGC 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1161380682 19:3963613-3963635 CAGCCGAGGGGGCCCCCGCCAGG 0: 1
1: 0
2: 2
3: 21
4: 233
1161380670_1161380682 23 Left 1161380670 19:3963567-3963589 CCACATGAGACACACGGAGCCGG 0: 1
1: 0
2: 0
3: 22
4: 132
Right 1161380682 19:3963613-3963635 CAGCCGAGGGGGCCCCCGCCAGG 0: 1
1: 0
2: 2
3: 21
4: 233
1161380674_1161380682 4 Left 1161380674 19:3963586-3963608 CCGGGGACCCATGCCAGCTGTGT 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1161380682 19:3963613-3963635 CAGCCGAGGGGGCCCCCGCCAGG 0: 1
1: 0
2: 2
3: 21
4: 233
1161380677_1161380682 -9 Left 1161380677 19:3963599-3963621 CCAGCTGTGTTGCACAGCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1161380682 19:3963613-3963635 CAGCCGAGGGGGCCCCCGCCAGG 0: 1
1: 0
2: 2
3: 21
4: 233
1161380675_1161380682 -3 Left 1161380675 19:3963593-3963615 CCCATGCCAGCTGTGTTGCACAG 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1161380682 19:3963613-3963635 CAGCCGAGGGGGCCCCCGCCAGG 0: 1
1: 0
2: 2
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161380682 Original CRISPR CAGCCGAGGGGGCCCCCGCC AGG Intronic
900226142 1:1534463-1534485 CAGGTGAGGGGGCGCCTGCCAGG + Exonic
900337225 1:2170243-2170265 CAGCCGAGGGGCCTCCAGCATGG + Intronic
900590590 1:3457734-3457756 CAGTCTCAGGGGCCCCCGCCTGG - Intronic
900605811 1:3523073-3523095 CAGCCCTGGGGCCCCCCCCCCGG - Intronic
900609448 1:3538317-3538339 GAGCAGGGGGGGCCCCCACCCGG + Intronic
901005383 1:6169376-6169398 AGGCCGAGGGGGCCCTGGCCGGG + Intronic
901237108 1:7673007-7673029 CAGCTGATGGGACCCCGGCCCGG + Intronic
901435920 1:9247431-9247453 CAGCCGTGGCGCCCCCTGCCTGG + Intronic
901775150 1:11555504-11555526 CAGCCGAGAGGGTCCCCAGCAGG + Intergenic
902881169 1:19372747-19372769 CAGCCGAGCGGGCCGACTCCTGG - Intronic
904810342 1:33159655-33159677 CAGCCGGGGAGGGCCCCGGCGGG + Intronic
905173998 1:36125119-36125141 CAGCCGCGGACGCCCCTGCCCGG - Exonic
905959993 1:42035623-42035645 CAGCTGAGGGGGCCGGCGCCCGG + Intronic
906168905 1:43707586-43707608 CAGCCGCGGGGGACCCCGGCGGG - Exonic
907482496 1:54754670-54754692 CAGGCGAGGGGGACCCCACAGGG + Intergenic
911133787 1:94418274-94418296 CTGCCGAGCGCGCTCCCGCCGGG + Intergenic
920528730 1:206686130-206686152 CAGCTGAGGGGGCCAGCTCCGGG - Intronic
1062930323 10:1348521-1348543 CAGCCGAGGGAGGCACCTCCCGG - Intronic
1063067458 10:2623918-2623940 CAGCCGACGGGGGCCCCACAGGG + Intergenic
1064443208 10:15371370-15371392 GCGCCGAGGGCGCCCCCGCCCGG + Intergenic
1064665240 10:17644129-17644151 GAGCCGAGGAAGCCCCCGCGCGG - Exonic
1067069971 10:43124164-43124186 CAGCCCAGGCTGCCCCTGCCTGG - Intronic
1067498088 10:46776368-46776390 CAGCTGCGCGGGCCCCCGCCTGG - Intergenic
1067539397 10:47140820-47140842 GAGCAGAGGGAGCCCCAGCCTGG + Intergenic
1067596558 10:47564046-47564068 CAGCTGCGCGGGCCCCCGCCTGG + Intergenic
1072881269 10:99232375-99232397 AAGCCGCGGGGGCCCGGGCCCGG - Exonic
1073113379 10:101076214-101076236 CAGCCTAGGTGGCCCCACCCTGG - Intergenic
1073252940 10:102133135-102133157 CTGCCGCGGGCTCCCCCGCCAGG - Exonic
1074585916 10:114767962-114767984 CAGCCGCGCCGGCCCCAGCCCGG - Intergenic
1074815732 10:117139864-117139886 CCGCTCAGGGGGCCCCCTCCTGG - Intergenic
1074865457 10:117542240-117542262 CAGCGGAGGCGGCGCCGGCCAGG + Intergenic
1076888217 10:133272173-133272195 CAGGTGAGGGGGCTCCTGCCCGG - Exonic
1077115489 11:882831-882853 CAACCCAGGAGGCCCCGGCCCGG + Intronic
1077253821 11:1571980-1572002 CGGCTGCGCGGGCCCCCGCCGGG - Intergenic
1079172884 11:18112915-18112937 CAGCCTAGGGGTGCCCAGCCTGG - Intronic
1079190013 11:18269542-18269564 CAGCCTAGGGGTGCCCAGCCTGG + Intronic
1080497054 11:32830215-32830237 CCGCCGAGGTGGCCCCTTCCAGG - Intronic
1080749538 11:35139426-35139448 CAGCCGGAGGGGCTGCCGCCGGG - Intronic
1081638717 11:44738354-44738376 CAGCCGGGGGGGCTCCAGCCAGG - Intronic
1083176147 11:60951559-60951581 GAGCCGCGGGGGGCCCAGCCCGG - Exonic
1083299837 11:61734592-61734614 GAGAGGAGGGGGCCCCAGCCAGG + Intronic
1083430690 11:62612503-62612525 AAGCCGCGGGGGCCACGGCCGGG + Exonic
1084532194 11:69734121-69734143 CAGCCAAGGGGTCCCCCGACAGG - Intergenic
1086983245 11:93221695-93221717 CAGCCGAGGGGGACACGCCCTGG - Intergenic
1088868926 11:113875334-113875356 CTGCGGAGGGCGCCCCGGCCGGG - Intronic
1089494711 11:118902290-118902312 GAGCCTAGGGGGCCCCCCGCTGG - Exonic
1091286797 11:134412385-134412407 CCGGCGAGGGGACCCCCCCCCGG + Intergenic
1094477706 12:30853943-30853965 CAGCGGAGGTGGACCCGGCCCGG - Intergenic
1096389356 12:51217348-51217370 GAGCGGAGGGGGCGGCCGCCAGG - Intronic
1099989804 12:89709481-89709503 CAGCCGAGGGCGCGCTCGCCGGG - Intergenic
1104594017 12:130107663-130107685 CAGGCGCGGGGGCTCACGCCTGG + Intergenic
1104966614 12:132511259-132511281 CAGGCGAGGGGGACCCCACAGGG + Intronic
1105943528 13:25171159-25171181 CTGGCGAGGGAGCCCCCGCCGGG + Exonic
1106073415 13:26435772-26435794 CAGCCTAGTGGGCCCCCCCATGG + Intergenic
1107454918 13:40546190-40546212 CAGCCGAGGTGGGAGCCGCCTGG - Intergenic
1109406276 13:61903779-61903801 CAGCCGAGGAGGTCCCCAGCTGG + Intergenic
1113805872 13:113109837-113109859 CAGCCGAGGGGACCGTCACCCGG - Intronic
1115591965 14:34874090-34874112 CGGCCGAGGGGATCCCCGCTAGG - Intronic
1115754255 14:36517562-36517584 CCGGCGCGGGGGCACCCGCCTGG + Exonic
1118318225 14:64738281-64738303 CAGCAGAGGGGGCCCTCGGGTGG - Intronic
1121122244 14:91383313-91383335 CTGCCGTGGGGGGCCCAGCCAGG + Intronic
1122143867 14:99677406-99677428 CAGCAGCGGGGGCACCTGCCAGG - Exonic
1122282721 14:100633572-100633594 CAGCCGGGGAGGCGCCTGCCCGG - Intergenic
1122640364 14:103155952-103155974 CAGCAGAGGGGCTCCCCCCCCGG + Intergenic
1122942352 14:104987081-104987103 CAGCTCAGGTGGCCCCCACCTGG - Intronic
1124629373 15:31327998-31328020 CAGGCGACCGCGCCCCCGCCGGG + Intronic
1128896935 15:71383205-71383227 CAGACGAGGGGGACCCCTGCTGG - Intronic
1130390061 15:83447430-83447452 CAGCCGCGGGGGGACCGGCCCGG + Exonic
1130656383 15:85794612-85794634 CAGCCGCGGGGCCCCCTCCCGGG + Intronic
1130960467 15:88655495-88655517 CCGCCGAGGGCTGCCCCGCCTGG + Exonic
1132286646 15:100668427-100668449 CAGAGGAGGGGGCTTCCGCCTGG + Intergenic
1132668560 16:1093478-1093500 CAGCCGCGGGGCCCCTCACCCGG + Exonic
1132906501 16:2285280-2285302 GAGGCGAGGGGGCAGCCGCCAGG + Intronic
1132974859 16:2706155-2706177 GAGCCTGGGGGGCACCCGCCTGG + Intronic
1133270313 16:4608157-4608179 CAGCCGGCAGGGCCTCCGCCAGG + Intergenic
1134225395 16:12386012-12386034 CAGCTGAGGCCGCCCCTGCCTGG - Intronic
1137408472 16:48208335-48208357 AAGCAGTGGGGGGCCCCGCCTGG + Intronic
1140410441 16:74737759-74737781 CAGCCGAGGGTCCCCAGGCCTGG - Intronic
1142006927 16:87693770-87693792 CAGTCGGGGGTGCCCCTGCCAGG + Intronic
1142227713 16:88885626-88885648 CAGCAGAGGGGGCCCAGCCCAGG + Intronic
1142412053 16:89921868-89921890 CAGCAGAGGCGGGCCCTGCCAGG - Intronic
1143780323 17:9225731-9225753 CCTCCGAGGGAGCCCCTGCCCGG - Intronic
1146142464 17:30379460-30379482 CCGCCGCGGGGACCCGCGCCTGG + Exonic
1146492356 17:33292138-33292160 CAGCGGCGGCGGCCCCGGCCGGG + Exonic
1147006301 17:37406799-37406821 CGGCCGTGGAGGCCCCCGCCGGG - Intronic
1147137645 17:38443499-38443521 CAGCCCAGGGGGCTCCCTCATGG + Intronic
1151477198 17:74350832-74350854 CACCCGAGGTGGCCGCAGCCCGG + Exonic
1152326683 17:79645608-79645630 CAGCCCAGGGAGCCCAGGCCTGG + Intergenic
1152465845 17:80465810-80465832 CAGGCCAGGGGCCTCCCGCCTGG + Intergenic
1152556440 17:81055414-81055436 CAGCCATGGGGGCCCCTGCAGGG - Intronic
1152611718 17:81318165-81318187 CAGGCGAGGGGTCCCCCTCAGGG + Intronic
1152759108 17:82098952-82098974 CGGCCGCGGGCGCCCCGGCCGGG + Intergenic
1152778616 17:82216729-82216751 GAGGTGCGGGGGCCCCCGCCTGG + Intergenic
1153226801 18:2906325-2906347 CAGCCCTGGGGCCCCCCGGCAGG + Intronic
1155300767 18:24426861-24426883 CAGCCGAGGGGCCCTCCGCCTGG + Intronic
1160678359 19:402174-402196 AGGCCGAGGGAGCCCCCGCCTGG + Intergenic
1160771706 19:835032-835054 CAGCCGGTGGGGGCCCTGCCTGG + Intergenic
1160909757 19:1469111-1469133 CAGCGGTGGCGGCCCACGCCGGG - Exonic
1160954882 19:1686561-1686583 CAGGCGCGGTGGCTCCCGCCTGG - Intergenic
1161051111 19:2164417-2164439 CAGCCGCGGGGCCCTCGGCCGGG - Intronic
1161215800 19:3094568-3094590 CGGCCGAGGCGGCTCCGGCCAGG + Exonic
1161222084 19:3122472-3122494 CAGCCCCGGGGGCCGCCTCCCGG + Exonic
1161308221 19:3578755-3578777 CAGCCGAGGGTGCCCCTCCTCGG + Exonic
1161380682 19:3963613-3963635 CAGCCGAGGGGGCCCCCGCCAGG + Intronic
1161779260 19:6280080-6280102 CAGCCCGGCAGGCCCCCGCCAGG - Intergenic
1161959521 19:7516139-7516161 GGGCCGAGGGGGCCGCCGGCGGG + Exonic
1162426923 19:10602575-10602597 CAGCAGAGGCGGCCCCTGACCGG - Intronic
1162817846 19:13207287-13207309 CGGGCGAGGTGGCGCCCGCCCGG - Exonic
1163480911 19:17555789-17555811 CTGCCGCCGGGGGCCCCGCCGGG + Exonic
1163666455 19:18606157-18606179 CAACCGCGTGCGCCCCCGCCTGG + Intronic
1163688654 19:18726328-18726350 CAGCAGAGGAGGCCCAGGCCCGG + Intronic
1165091110 19:33388851-33388873 CAGCTGAGGGGGCCTCAGCTTGG + Intronic
1165746033 19:38229810-38229832 CGCCCGAGGGCGCCCCTGCCCGG + Intergenic
1166102074 19:40576919-40576941 CAGCCGAGGGGGTCCCCAGTCGG + Exonic
1166790748 19:45396995-45397017 CAGCCGAGGGTCCCCCCGGAAGG - Exonic
1166920564 19:46226572-46226594 CAGCAGAGGGGCCTCCGGCCTGG + Intergenic
1167612153 19:50512792-50512814 GAGCTGAGGGGGACCCCACCTGG + Exonic
1167752463 19:51389118-51389140 CAGCCCCAGGGCCCCCCGCCCGG + Exonic
1168309930 19:55455240-55455262 CAGGTGAGAGGGCCCCTGCCTGG - Exonic
1168405125 19:56106686-56106708 CAGCCCAAGGGGGCCTCGCCTGG - Intronic
1168462130 19:56567914-56567936 CAGCCGAGGCTGCCCCGCCCGGG - Exonic
1168549435 19:57280742-57280764 CAGCCGAGGTCGCCCCGCCCAGG + Exonic
1168553692 19:57320762-57320784 CAGCCGAGGTCGCCCCGCCCAGG + Exonic
1168689715 19:58369130-58369152 CAGCCCCGGGAGCCCCCGCCTGG + Exonic
926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG + Intergenic
926095837 2:10080246-10080268 CCGCCGAGGGGGCCCCCATGAGG + Exonic
927135275 2:20092361-20092383 CAGCGGAGGGGGGCCCAGACTGG + Intergenic
927714043 2:25341428-25341450 CTGCCGCAGGGGCCCCGGCCGGG - Intronic
927714156 2:25341741-25341763 CAGCCGCGGCGCCCCCCGCCCGG + Intronic
932345467 2:70992451-70992473 CAGGCGAGGTGGCTCACGCCTGG + Intronic
936512244 2:113157561-113157583 CGGCCGGGGGTGCCCCCGCCCGG - Intronic
941625147 2:167823119-167823141 CACCCCATGGGGCCCCCACCTGG - Intergenic
942448260 2:176092620-176092642 CCGCCCCGAGGGCCCCCGCCGGG - Intergenic
943646125 2:190408838-190408860 CTGCCCAGGGAGCCCTCGCCGGG + Intronic
946312957 2:218892956-218892978 CCGGCGAGGGTGCCCCCGCTGGG - Exonic
946339973 2:219060578-219060600 CCGCCCATGGCGCCCCCGCCTGG - Intergenic
946397262 2:219449210-219449232 CCGCCGAGGGGCCCGCAGCCAGG + Exonic
947795596 2:232892054-232892076 CTGCCGCTGTGGCCCCCGCCAGG - Intronic
948414703 2:237794560-237794582 CAGTTGAGGGGGCCTCTGCCAGG + Intronic
1169048649 20:2558498-2558520 AAGCCGAGGGGACCCCAGGCAGG + Exonic
1171387980 20:24782977-24782999 CAGCCTAGGGAGGCCCCACCTGG - Intergenic
1171473360 20:25389979-25390001 CAGCCCGAGGGGCGCCCGCCCGG + Intronic
1172083275 20:32358843-32358865 CAGCCGAGGGGGGCTCCGTGGGG + Intronic
1173548077 20:43914628-43914650 CCGCCGCCGGGTCCCCCGCCCGG - Intergenic
1173660980 20:44733576-44733598 CAGCCGAGAGGCCACCTGCCAGG + Intergenic
1173856070 20:46251464-46251486 CAGCCGCGGGGGTACCCGGCTGG + Exonic
1174017755 20:47502268-47502290 GATCCGAGGGGGTCCCCGCGCGG + Intronic
1176076027 20:63248561-63248583 CAGGCGAGGGGGCTCCAGCTGGG - Intronic
1176093481 20:63329180-63329202 CAGCCCACGGGGCTCCCCCCAGG - Intronic
1176547018 21:8206516-8206538 GAGACGAGGGGACCCCCGCGGGG - Intergenic
1176554923 21:8250725-8250747 GAGACGAGGGGACCCCCGCGGGG - Intergenic
1176565969 21:8389563-8389585 GAGACGAGGGGACCCCCGCGGGG - Intergenic
1176573844 21:8433750-8433772 GAGACGAGGGGACCCCCGCGGGG - Intergenic
1179150878 21:38806694-38806716 CGACCGAGGGGTCCCCAGCCCGG - Intronic
1179375508 21:40846929-40846951 CAGCTCAGTGGGCCCCCGGCAGG + Exonic
1179545695 21:42111181-42111203 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545717 21:42111256-42111278 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545734 21:42111316-42111338 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545741 21:42111331-42111353 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1181378117 22:22476685-22476707 CAGCCGCGGGCCCCCACGCCCGG - Intergenic
1181604237 22:23970813-23970835 CAGCCCAGGGGTCCCCAGGCTGG - Intronic
1183370233 22:37427827-37427849 CAGCGCAGGGGGCCGCGGCCGGG - Intergenic
1183674542 22:39292148-39292170 CAGCCGAGGGAGCCCACCACAGG + Intergenic
1184276418 22:43411792-43411814 CACCCGCCGGGGCCCCCGCCAGG - Intronic
1185067645 22:48640100-48640122 CAGCAGATGGGGCCGGCGCCAGG + Intronic
1185333517 22:50261805-50261827 AACCCGAGGCGGCCGCCGCCGGG + Exonic
1203251893 22_KI270733v1_random:122801-122823 GAGACGAGGGGACCCCCGCGGGG - Intergenic
1203259944 22_KI270733v1_random:167884-167906 GAGACGAGGGGACCCCCGCGGGG - Intergenic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950196771 3:11014915-11014937 CAGCAGACTGGGCCCCCGCCGGG + Intronic
950282301 3:11719184-11719206 CGGGCGAGGAGGCCCGCGCCTGG - Intronic
950743029 3:15064878-15064900 CGGACGGCGGGGCCCCCGCCGGG - Intronic
953472616 3:43179864-43179886 CGGCCTAGGGGGCCCCTGGCTGG - Intergenic
954138663 3:48594077-48594099 CAGGCGTGGGGGCCCCCTCCTGG + Intronic
954277851 3:49554299-49554321 CAGCCCCGCCGGCCCCCGCCCGG + Intergenic
956080137 3:65549068-65549090 CAGCCAAGGCGGCCCCTGCTCGG + Intronic
956487736 3:69739945-69739967 CGGCCGAGGGTCCCCGCGCCTGG - Intronic
962263209 3:133927788-133927810 AAGGCGCGGAGGCCCCCGCCGGG - Intergenic
966808785 3:183825681-183825703 CCGCCGAGTGCGCCCCCTCCCGG - Intergenic
968636892 4:1685258-1685280 CACCCCAGGGGCCCCTCGCCAGG - Intergenic
968664814 4:1815280-1815302 CAGCTTTGGGGGCCCCCGGCAGG + Intronic
969613284 4:8238597-8238619 CTGCCAGGGAGGCCCCCGCCCGG + Intronic
978777370 4:112516776-112516798 CCGCCGAGGCTCCCCCCGCCCGG + Intergenic
985064149 4:186104996-186105018 CGGCCGAGGCGGCCCGGGCCGGG - Intronic
985265025 4:188149193-188149215 CAGGCGCGGGGGCTCACGCCTGG - Intergenic
985536277 5:467436-467458 CAGCCTAGAGGGCGCCCTCCTGG + Intronic
985536331 5:467620-467642 CAGCCTAGAGGGCGCCCTCCTGG + Intronic
985783815 5:1883940-1883962 CAGGGGAGGGCGCCTCCGCCAGG - Intronic
991975477 5:72179997-72180019 CTGCCGAGGTGGCCCCTGGCAGG - Intronic
992034151 5:72754785-72754807 CTGCCGAAGTGGCCACCGCCTGG - Intergenic
992530115 5:77645253-77645275 CGGCCGAGGGGCCCCCGGGCGGG - Intergenic
992939616 5:81750375-81750397 CGGCCGAGCGGGGCCCCGCGGGG - Intronic
994072880 5:95621061-95621083 CAGCCGCGGGGGCCTGCGGCCGG - Exonic
998079446 5:139262407-139262429 CATCCCAGGAGGCTCCCGCCAGG + Intronic
999300317 5:150486451-150486473 CAGCCGGTGGGGCCCGAGCCCGG + Intronic
1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG + Intergenic
1002075049 5:176703507-176703529 TAGCAGAGTGGGACCCCGCCTGG + Intergenic
1002200430 5:177524754-177524776 GAGGTGAGGGGGCCCCCTCCCGG - Exonic
1002896958 6:1384901-1384923 CAACCGAGGGGACCCGCGCCCGG + Intergenic
1003872466 6:10413412-10413434 CCGCCGAGGGCGCCCACACCTGG + Intronic
1007557932 6:42782512-42782534 CCGCCGAGGCGCCCCCGGCCCGG - Intronic
1014137546 6:117907203-117907225 CCGCCGCCGGCGCCCCCGCCCGG + Intergenic
1014724929 6:124962489-124962511 CAGCCGCCGGGACCCCCACCCGG - Intergenic
1017446314 6:154510190-154510212 CAGCCGCGGGCGCGCCCTCCCGG - Exonic
1018892515 6:167992060-167992082 CAGGCGAGGTGGCTCACGCCTGG - Intergenic
1019010622 6:168841351-168841373 CTGCCGAGGGGGCCTCAGCGGGG + Intergenic
1019828349 7:3301665-3301687 CGGCCGCGGGGATCCCCGCCCGG + Exonic
1020095497 7:5366598-5366620 CAGCCGCGGTGGCTCACGCCTGG - Intronic
1020137300 7:5594337-5594359 CAGCGGAGGCCGACCCCGCCCGG - Intronic
1023879476 7:44309999-44310021 GAGCCGTGGGCGCCACCGCCAGG + Intronic
1025208589 7:57008052-57008074 CAGCCCGGGGGGCCGCAGCCGGG - Intergenic
1025663358 7:63568826-63568848 CAGCCCGGGGGGCCGCAGCCGGG + Intergenic
1028268639 7:88759529-88759551 CAGCCCAGGACGCCCCCGGCCGG + Exonic
1029269066 7:99365702-99365724 CAGCAGGGGGAGCCCCGGCCTGG + Intronic
1029380891 7:100213891-100213913 CAGCCCAGAGGGCCACCCCCAGG - Intronic
1030033360 7:105388585-105388607 CGGCCGCGGGCGCCCCCGACGGG + Intronic
1031401480 7:121329678-121329700 CATCCGAGAGGGCGCCCGGCTGG + Exonic
1032265419 7:130366888-130366910 AAGCCGAGGGGGCTCCCTGCAGG + Intronic
1035417998 7:158705277-158705299 CTGCCGAGGGGGCACCTGTCCGG + Intergenic
1038400869 8:27283758-27283780 CAGCCCAGGGAGCCCCGGGCAGG + Intergenic
1040323068 8:46328187-46328209 AAGCCCACGGGGCACCCGCCTGG - Intergenic
1040564845 8:48556169-48556191 GTGCCCAGGGTGCCCCCGCCCGG + Intergenic
1042102154 8:65285084-65285106 CAGAGGAGGGGGCCCCCGCCTGG - Intergenic
1048009169 8:130443066-130443088 CCGCCGATGGGGCGCCCTCCCGG - Intronic
1053697397 9:40650737-40650759 CCGCCGCCGCGGCCCCCGCCCGG - Intergenic
1054308702 9:63450183-63450205 CCGCCGCCGCGGCCCCCGCCCGG - Intergenic
1054407366 9:64773876-64773898 CCGCCGCCGCGGCCCCCGCCTGG - Intergenic
1059176709 9:112175083-112175105 CGGCCGGCGGGGCCCCCGGCTGG - Intronic
1060389917 9:123268645-123268667 CAGCCGCGGGGCCCGCCCCCTGG - Intergenic
1061313210 9:129777427-129777449 CAGAGGAGGGGGCCCCCACAGGG - Intergenic
1061580042 9:131530965-131530987 CGGCCGAGGGGCCCCCTGCCAGG - Intronic
1061868806 9:133509230-133509252 CAGCCCTGGGGCCCCCTGCCAGG - Intergenic
1062096532 9:134706721-134706743 CAGCACTGTGGGCCCCCGCCTGG + Intronic
1062414887 9:136443318-136443340 CAGCCGGGGAGGGCCCAGCCTGG + Intronic
1062435710 9:136545813-136545835 CAGCGCAGGAGGCCGCCGCCCGG - Exonic
1062463494 9:136671475-136671497 CTGCCGAGGGGGCCCTGGCCTGG + Intronic
1062569553 9:137178841-137178863 CTGCCCTGGGGGCCTCCGCCTGG + Intronic
1062628974 9:137455165-137455187 GGGCCGAGGGGGCCCAGGCCAGG + Intronic
1062690265 9:137837915-137837937 GAGCCCAGGGGGCCCCAGCCGGG + Intronic
1202779765 9_KI270717v1_random:24095-24117 CCGCCGCCGTGGCCCCCGCCCGG - Intergenic
1203468295 Un_GL000220v1:105952-105974 GAGACGAGGGGACCCCCGCGGGG - Intergenic
1203476116 Un_GL000220v1:149924-149946 GAGACGAGGGGACCCCCGCGGGG - Intergenic
1185658085 X:1702192-1702214 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658092 X:1702235-1702257 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658126 X:1702449-1702471 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658133 X:1702492-1702514 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658183 X:1702792-1702814 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658190 X:1702834-1702856 CAGCGGAGGTGGCCTCTGCCTGG + Intergenic
1190347689 X:49532662-49532684 CCGCTGAGGGGGCACTCGCCAGG - Intronic
1190348790 X:49542218-49542240 CCGCTGAGGGGGCGCTCGCCAGG - Intronic
1190349890 X:49551774-49551796 CCGCTGAGGGGGCGCTCGCCAGG - Intronic
1190350995 X:49561327-49561349 CCGCTGAGGGGGCGCTCGCCAGG - Intronic
1190352096 X:49570885-49570907 CCGCTGAGGGGGCGCTCGCCAGG - Intronic
1190353197 X:49580434-49580456 CCGCTGAGGGGGCGCTCGCCAGG - Intronic
1190355400 X:49599505-49599527 CCGCTGAGGGGGCGCTCGCCAGG - Intronic
1200109129 X:153730314-153730336 CGGGCGCGGGGGCTCCCGCCTGG + Intronic
1200784244 Y:7245508-7245530 CAGCCGTGAGGCCCCGCGCCAGG - Intergenic