ID: 1161388090

View in Genome Browser
Species Human (GRCh38)
Location 19:4007602-4007624
Sequence GCCGCGCGCGCCTGCGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161388086_1161388090 -5 Left 1161388086 19:4007584-4007606 CCGGAGGCCCGGGCGGTGGCCGC 0: 1
1: 1
2: 4
3: 35
4: 273
Right 1161388090 19:4007602-4007624 GCCGCGCGCGCCTGCGCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 129
1161388083_1161388090 4 Left 1161388083 19:4007575-4007597 CCTGATTGGCCGGAGGCCCGGGC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1161388090 19:4007602-4007624 GCCGCGCGCGCCTGCGCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161388090 Original CRISPR GCCGCGCGCGCCTGCGCAGG AGG Intergenic
900106394 1:983033-983055 GCCGCGGGCGACTGCCCGGGCGG + Intergenic
900162828 1:1232423-1232445 GCGGCGCGCGCGGGCGCGGGGGG - Exonic
900269184 1:1778465-1778487 GGCGGGTGCGCCTGCGCAGTGGG - Intronic
900527827 1:3137764-3137786 GCAGTGCGCTCCTGTGCAGGAGG - Intronic
903043947 1:20552431-20552453 GCAGCGCGAGCCTGCGTGGGGGG + Exonic
903250989 1:22052974-22052996 GCCGCGCGCCCCTCCTCAGACGG - Intronic
906027186 1:42683105-42683127 GCCGCTCCGGCCTGCGTAGGCGG - Intronic
906507985 1:46394228-46394250 CCCACGCCCGCCTGCGCGGGAGG - Intergenic
907069189 1:51518952-51518974 GCCGCGCGGGGCGGGGCAGGAGG + Intronic
912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG + Intronic
914880082 1:151540292-151540314 TCCGCGCGCGCCCGCCCAGTTGG + Exonic
921110888 1:212035601-212035623 TCCTTGAGCGCCTGCGCAGGGGG - Exonic
1067812591 10:49441618-49441640 GCCGCCGGCGTCTCCGCAGGTGG + Intergenic
1069673904 10:70233497-70233519 GCGGAGTGCGCCTGCGCACGGGG - Intronic
1071529418 10:86377445-86377467 GCCGCGCGAGCCGCCCCAGGAGG + Intergenic
1072710671 10:97713901-97713923 GCCGCACGCGCCTGGGGCGGCGG - Exonic
1075719008 10:124574325-124574347 TCCGTGCGCGCCCTCGCAGGGGG - Intronic
1076868402 10:133180741-133180763 GCCGAGCGCCCCTGCGCATCAGG - Intronic
1077063278 11:626925-626947 GCCGCGCGCCCTCCCGCAGGCGG + Exonic
1077097569 11:805422-805444 GCCGAGCGCTGCTGCGCGGGCGG - Intronic
1080012314 11:27471990-27472012 GCCGCCCGGGCCTGGGGAGGGGG - Intronic
1080802095 11:35618626-35618648 GCCGCGGGAGCATGGGCAGGAGG + Exonic
1081528278 11:43942077-43942099 CGCGCGCGCGCCTGCGGAGGGGG + Intronic
1083365764 11:62140685-62140707 GCCGCCCGCGCCTTGGCAGGAGG + Exonic
1083432572 11:62621957-62621979 GCCGCCCGCGCCCGAGCAGGCGG + Exonic
1083726316 11:64630375-64630397 GCGGCGCGGGCCCGCGGAGGAGG - Intronic
1083945233 11:65919605-65919627 GGCGCGCCCGCCTGCCCAGCGGG - Intronic
1083965787 11:66042943-66042965 GCCGCCCGCGCCAGCGCCGCGGG + Exonic
1084546644 11:69818177-69818199 CCCGCTCGCGGCTGCCCAGGTGG - Intronic
1085011105 11:73142248-73142270 GCCGGGAGCGGCGGCGCAGGCGG - Exonic
1085123712 11:73983284-73983306 GCCGCGCGCTCGCTCGCAGGAGG - Exonic
1086437937 11:86800329-86800351 GCCGAGCGTCCCTGCGCAGGTGG - Exonic
1096460868 12:51820968-51820990 GCAGCGCGCGGCCGCGAAGGCGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1100869438 12:98894967-98894989 GCGGCGCGCGCCTGCCCTGGCGG + Intronic
1101910574 12:108857670-108857692 CCTGCGCGCGCCGGCGCGGGAGG - Intergenic
1102933805 12:116881073-116881095 GCTGTGCGCGGCCGCGCAGGTGG - Exonic
1103348366 12:120265792-120265814 GCGGGGCGCGCGTGCACAGGGGG - Intergenic
1103509954 12:121467361-121467383 GCCTCGCACGCCCGCGCTGGAGG + Intronic
1107468029 13:40666654-40666676 GGCGCGCGCGCCGCCGCGGGCGG - Intergenic
1113820370 13:113209024-113209046 GGCGCGCGCGCCCGAGGAGGGGG + Intronic
1117920515 14:60722691-60722713 GCCCCCCGGGCCTGCGCTGGAGG - Intronic
1120168062 14:81221035-81221057 CCCCGGCGCGCCTGCGCACGCGG - Intronic
1122942143 14:104986179-104986201 TCCGCGCCCGCCTGCGTGGGAGG + Exonic
1123041084 14:105490491-105490513 GCCGGGCCCGCCTGCACGGGCGG - Intronic
1129676043 15:77632822-77632844 GCGGCGGGCGACAGCGCAGGCGG - Intronic
1132641587 16:980811-980833 GCCCTGGGCGCCTGCGGAGGCGG - Intronic
1133136716 16:3717433-3717455 GCTGCGGGCGCCGGCGCTGGCGG - Exonic
1133311269 16:4848014-4848036 GCGCCGCGCGCCGGCCCAGGAGG - Intronic
1134091156 16:11392336-11392358 GCCGCGCGCGGCTGCCAGGGGGG - Exonic
1135821721 16:25691885-25691907 CTCGCGCGCGCCTGCGAAGGGGG - Intergenic
1136399875 16:30011444-30011466 GCCGCGCGCGCGGGCGGGGGCGG - Intronic
1137594067 16:49712307-49712329 GGCTCGCGTGCCTGAGCAGGTGG + Intronic
1142206470 16:88785320-88785342 GCCGCGCGGGACAGCGGAGGGGG - Intergenic
1143485519 17:7251708-7251730 CCCTAGCGCGCCTGCGCAGCGGG - Intronic
1143528163 17:7484259-7484281 CCCTTGCGGGCCTGCGCAGGCGG + Exonic
1143548614 17:7614890-7614912 GCCCGGTGCGCCTGCGCAGTAGG - Intronic
1147331105 17:39700107-39700129 GCCGCGCGCCCCTTCCCACGGGG + Exonic
1150002934 17:61452542-61452564 GCCGCTGGCGCCTCCGCATGCGG + Intronic
1150217269 17:63477566-63477588 GCCGCGCCCGCCTTCGCCGAAGG + Intergenic
1152406578 17:80101476-80101498 GCCTCGGGCGCCTGCGCGGGAGG + Intergenic
1152716218 17:81902073-81902095 GCCGCGCGGGCGAGCGCTGGAGG - Intronic
1152809586 17:82375296-82375318 CCCGCACGCGGCCGCGCAGGTGG - Exonic
1153805655 18:8706483-8706505 GCCGCGGGCGCCTGTCCCGGGGG + Intronic
1154991379 18:21600980-21601002 AGCGCGCGCGCCTCCGCGGGTGG + Intergenic
1155054448 18:22171623-22171645 GCCGGGCGCGCCGTCGTAGGCGG - Exonic
1157609984 18:48950168-48950190 GCCGCGGGCGCCGGCGCGGCCGG - Exonic
1159369901 18:67516669-67516691 GCAGCGCCCGCGTGCCCAGGCGG + Exonic
1160930744 19:1568419-1568441 GCCCCGCGCGCCTGCGCCCTGGG - Intergenic
1161172518 19:2820086-2820108 GCCGCGCGCGCCGGCCCAGGTGG - Exonic
1161238138 19:3208032-3208054 GCCGCGCGCGATCGGGCAGGGGG - Exonic
1161388090 19:4007602-4007624 GCCGCGCGCGCCTGCGCAGGAGG + Intergenic
1161707237 19:5827852-5827874 GCGGCGCGCGCGTGCGCGGTTGG + Exonic
1162031140 19:7917742-7917764 GCCGCGGGGGCCGGCGCGGGAGG - Exonic
1162572409 19:11480872-11480894 GCCCCGCGGGGCCGCGCAGGGGG - Exonic
1163743913 19:19033579-19033601 GCGGCCCGCGCCTGCGCACCAGG - Exonic
1165851403 19:38852079-38852101 GCCGTGCGCGCCGGCGCGAGGGG - Intronic
1166961041 19:46495920-46495942 CGCGCGTGCGCCTGCGCAGAGGG + Exonic
1167018948 19:46860561-46860583 GGCGAGCGCGCGTGCGCGGGGGG - Intergenic
1168286928 19:55339924-55339946 GGCGCGGGCGCCTGAGGAGGAGG + Exonic
925191912 2:1892015-1892037 GGTACGCGCGCCTGGGCAGGTGG - Exonic
932415441 2:71570689-71570711 GCTGGGTGCGCCTGCGCAGGAGG + Exonic
933139866 2:78779327-78779349 ACCGCGAGCCCCTGAGCAGGGGG - Intergenic
934697031 2:96407387-96407409 GCCGCTTGCTCCTGCTCAGGTGG + Intergenic
941110426 2:161414826-161414848 GCCGCGCGGGAATGAGCAGGAGG - Intergenic
947905035 2:233755031-233755053 GCGGAGGGCGGCTGCGCAGGCGG - Intronic
949079906 2:242088558-242088580 GCAGCGTGCGCCTGCGTAGTAGG - Intergenic
1170026072 20:11891013-11891035 GGCGCGCGCCCCTGCCCGGGCGG - Intronic
1171444726 20:25195603-25195625 TCCGCCCGCGCCTGCGCAACTGG + Intergenic
1174374004 20:50113191-50113213 TGCGCGCGCGCCTGCGCATCAGG - Intronic
1176238019 20:64063262-64063284 GTCGCGCCCGCCTCCGCAGCCGG - Exonic
1176550107 21:8217230-8217252 GTCGCGCGCGCGTCCGCTGGGGG + Intergenic
1176569035 21:8400265-8400287 GTCGCGCGCGCGTCCGCTGGGGG + Intergenic
1176576949 21:8444500-8444522 GTCGCGCGCGCGTCCGCTGGGGG + Intergenic
1179209545 21:39313573-39313595 GCGGCGCGCGCCTGAGAAGAGGG - Exonic
1179675071 21:42975205-42975227 GGGGCGCGCGGCGGCGCAGGCGG + Intronic
1180642987 22:17314418-17314440 GCCGCGCGAGCTTGGGCAAGAGG - Intergenic
1181299279 22:21867754-21867776 GCCGCGCGGGCCGGCGGAAGCGG + Intergenic
1181745422 22:24952605-24952627 GCCGGCCGCGCCTGCGCGGAGGG - Intergenic
1182338000 22:29598138-29598160 GCCGTGGGCTCCTGCGCAGCCGG - Intergenic
1182435436 22:30326833-30326855 GCCGCGCGCGCCCGCGGCCGGGG - Exonic
1184101559 22:42343912-42343934 GCCGTGCGCGCCGGCGGGGGAGG + Intergenic
1184184824 22:42857413-42857435 GCTGCACGCGCGTGCGCAGGAGG + Intronic
1184465781 22:44668472-44668494 GCGGCGCCCGCCGGGGCAGGGGG - Intergenic
1203254999 22_KI270733v1_random:133559-133581 GTCGCGCGCGCGTCCGCTGGGGG + Intergenic
1203263055 22_KI270733v1_random:178638-178660 GTCGCGCGCGCGTCCGCTGGGGG + Intergenic
950749655 3:15118772-15118794 GCCGCGCGCTCGCGCTCAGGTGG - Intergenic
956406421 3:68932678-68932700 GCCCCGCACCCCTGCTCAGGCGG + Intergenic
962259703 3:133895022-133895044 GCTGCGGGCGACCGCGCAGGTGG - Intronic
963091434 3:141487032-141487054 GCCTCGCCCGGCTACGCAGGCGG + Exonic
963888082 3:150603267-150603289 GCTGATCGCGCCTGCGCAGTGGG + Exonic
967098072 3:186193785-186193807 GCCGCGCGGGCCGGAGCAGGGGG - Intronic
968506522 4:973578-973600 GCGGCCCGCGCCTGCGCAGTGGG - Intronic
968514243 4:1009748-1009770 GCAGCGCGTGCCGGCGCGGGAGG + Intergenic
969651658 4:8471665-8471687 GCCCCACGGGCCTGGGCAGGCGG + Intronic
971352001 4:25863137-25863159 GCAGCGGGCGCCCACGCAGGTGG + Intronic
976246765 4:83012705-83012727 GCTGCGAGTGCCTGCGCGGGCGG - Intronic
985537404 5:472978-473000 GCCGCACGCGCTGGAGCAGGAGG - Exonic
985727542 5:1523960-1523982 GCCGGGCGCGCAGGCGCGGGAGG + Exonic
992067456 5:73120709-73120731 GGCCCGCGCGCCTGCGCCGGCGG + Intronic
998083358 5:139294469-139294491 GCCGCGCGCGCGCGCGCGTGTGG - Intronic
1002140236 5:177133530-177133552 GCCGCGAGCGGGCGCGCAGGGGG + Intronic
1002638916 5:180621379-180621401 GCGCGGCGCGCCTCCGCAGGGGG + Intronic
1006180093 6:32149388-32149410 GCCGTGCGCACCTACGGAGGAGG + Exonic
1007760123 6:44128342-44128364 GCCGCCCGGGCCTGCGTTGGAGG + Intronic
1010141883 6:72622141-72622163 GCCGCCAGCGCCTGCGGCGGGGG - Exonic
1014632537 6:123803919-123803941 CCCGAGCGCGCCTCCGCAGGCGG + Intergenic
1019356386 7:582146-582168 GCTGCGTGCACCTGCCCAGGGGG + Intronic
1022396038 7:29989203-29989225 GCGGCGCCCGCCCGCGCAGCAGG + Intronic
1025829551 7:65038004-65038026 GCCGAGCGCGCCAGTGCGGGAGG - Intergenic
1028997539 7:97117684-97117706 GCCGACTGCGCCTGCGCAGAGGG - Exonic
1032306118 7:130733800-130733822 GCCGCCCGCGCCGGGGCTGGGGG + Exonic
1035537942 8:406823-406845 GCAGCGTGCGCCTGCGTAGTAGG - Intronic
1036755159 8:11466678-11466700 GCAGCGCGGACCCGCGCAGGAGG - Exonic
1049661302 8:143820853-143820875 GCCGCCAGCACCTGCCCAGGGGG + Intronic
1054835628 9:69672445-69672467 GCCGGGCGGGCCTGCGAGGGAGG + Intergenic
1057488543 9:95505858-95505880 GCAGCGCGGGGCTGCGGAGGCGG - Intronic
1057869875 9:98709225-98709247 GCCGTGCGCGCCGGGGGAGGGGG + Intergenic
1060514578 9:124257930-124257952 GGCGCGCGGGCCCGCGCAGGCGG + Intronic
1061577960 9:131519417-131519439 GCTGCACTCACCTGCGCAGGTGG + Exonic
1062435716 9:136545824-136545846 GCCCCGCCGGCCAGCGCAGGAGG - Exonic
1062488051 9:136791033-136791055 GGGGAGCGGGCCTGCGCAGGCGG - Intergenic
1203471400 Un_GL000220v1:116702-116724 GTCGCGCGCGCGTCCGCTGGGGG + Intergenic
1203479221 Un_GL000220v1:160674-160696 GTCGCGCGCGCGTCCGCTGGGGG + Intergenic
1195112018 X:101658702-101658724 GCCTGGGGAGCCTGCGCAGGAGG - Intronic