ID: 1161388244

View in Genome Browser
Species Human (GRCh38)
Location 19:4008061-4008083
Sequence GGTCCCGGTCCCTGAGCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161388227_1161388244 21 Left 1161388227 19:4008017-4008039 CCCCGGCTTCAGGCAGGGTCCCC No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388237_1161388244 -5 Left 1161388237 19:4008043-4008065 CCCAGCCCGAGCCCTTAGGGTCC No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388226_1161388244 22 Left 1161388226 19:4008016-4008038 CCCCCGGCTTCAGGCAGGGTCCC No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388231_1161388244 1 Left 1161388231 19:4008037-4008059 CCCCCACCCAGCCCGAGCCCTTA No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388238_1161388244 -6 Left 1161388238 19:4008044-4008066 CCAGCCCGAGCCCTTAGGGTCCC No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388240_1161388244 -10 Left 1161388240 19:4008048-4008070 CCCGAGCCCTTAGGGTCCCGGTC No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388233_1161388244 -1 Left 1161388233 19:4008039-4008061 CCCACCCAGCCCGAGCCCTTAGG No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388228_1161388244 20 Left 1161388228 19:4008018-4008040 CCCGGCTTCAGGCAGGGTCCCCC No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388229_1161388244 19 Left 1161388229 19:4008019-4008041 CCGGCTTCAGGCAGGGTCCCCCC No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388232_1161388244 0 Left 1161388232 19:4008038-4008060 CCCCACCCAGCCCGAGCCCTTAG No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388230_1161388244 2 Left 1161388230 19:4008036-4008058 CCCCCCACCCAGCCCGAGCCCTT No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data
1161388235_1161388244 -2 Left 1161388235 19:4008040-4008062 CCACCCAGCCCGAGCCCTTAGGG No data
Right 1161388244 19:4008061-4008083 GGTCCCGGTCCCTGAGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161388244 Original CRISPR GGTCCCGGTCCCTGAGCGCC AGG Intronic