ID: 1161388483

View in Genome Browser
Species Human (GRCh38)
Location 19:4009137-4009159
Sequence ATGTGAAAGGGGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1102
Summary {0: 1, 1: 0, 2: 10, 3: 88, 4: 1003}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161388483_1161388499 20 Left 1161388483 19:4009137-4009159 CCCTCCCCCATCCCCTTTCACAT 0: 1
1: 0
2: 10
3: 88
4: 1003
Right 1161388499 19:4009180-4009202 ACCTGTACGTATCTTCTTCTCGG 0: 1
1: 0
2: 0
3: 12
4: 95
1161388483_1161388492 -8 Left 1161388483 19:4009137-4009159 CCCTCCCCCATCCCCTTTCACAT 0: 1
1: 0
2: 10
3: 88
4: 1003
Right 1161388492 19:4009152-4009174 TTTCACATCTTCCCTCCCCACGG 0: 1
1: 0
2: 1
3: 18
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161388483 Original CRISPR ATGTGAAAGGGGATGGGGGA GGG (reversed) Intronic
900281338 1:1871462-1871484 AGGTGAATGGGGGTGGGGAAAGG - Intronic
900723250 1:4194377-4194399 AGGTGGAAGAGGATGGGGGGTGG + Intergenic
900929751 1:5729040-5729062 ATGGGCAAGGGGGTGGGGCAGGG + Intergenic
901193311 1:7425430-7425452 CTGTGAATGGCGATGGGGGCAGG + Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
902148338 1:14421831-14421853 AAGTGAAAGAGGCCGGGGGAGGG - Intergenic
902227156 1:15003672-15003694 TTGGGAAAAGGGGTGGGGGACGG + Intronic
902257048 1:15196426-15196448 ATGTGAAAGAGAGAGGGGGAGGG + Intronic
902402475 1:16165826-16165848 AGGGGAATGGGAATGGGGGAGGG - Intergenic
902536274 1:17120684-17120706 ATGTGAGTGGGGAAGAGGGAAGG + Intergenic
902730235 1:18364379-18364401 AGGTGGGAGGGGATGGGGGTAGG - Intronic
902805752 1:18860379-18860401 GTGTCAAAGAGGGTGGGGGAAGG + Intronic
902906007 1:19557861-19557883 AAGTGAAAGGGGAAGGGGAAGGG - Intergenic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903193881 1:21670837-21670859 CTGTGAAAGGGCAGAGGGGAAGG + Intergenic
903283716 1:22264474-22264496 GTGAAAAAGGGGTTGGGGGAGGG - Intergenic
903501891 1:23805032-23805054 ATGAGAATGAGGATGGGGAAGGG - Intronic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903757554 1:25673042-25673064 AGGTGAACGGGGAGGGGGAAAGG + Intronic
904055115 1:27664949-27664971 GGGTGAAAGGAGATGGGGGCGGG + Intergenic
904428496 1:30446904-30446926 GTGAGAAAGGGAATGGGTGAAGG - Intergenic
904576773 1:31509919-31509941 AAGAGAAAGGGAATGGAGGAAGG - Intergenic
904586071 1:31581349-31581371 AGGTGAGAGGTGATGAGGGACGG + Intronic
904807734 1:33143565-33143587 ATGAGAACGAGGATGGGAGAGGG - Intergenic
904819624 1:33233384-33233406 GTGTGAGAAGGGATGGGTGAGGG - Intergenic
904891499 1:33783013-33783035 AAGTGAGAGGTGATGAGGGAGGG + Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905481776 1:38266703-38266725 ATGGGAAAGGGGATGGTGTCGGG + Intergenic
905598551 1:39230346-39230368 ATGTGGAAGGGGATAGGCCACGG + Intronic
905796289 1:40818409-40818431 ATGTGGCAGGGGACTGGGGAGGG - Intronic
905807418 1:40887007-40887029 ATAGGCAAGGGGCTGGGGGAGGG - Intergenic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
905946606 1:41906513-41906535 TTTTGCAAGGGGATGGGGGTAGG + Intronic
906135974 1:43501244-43501266 AAGGGAGAGGGGAGGGGGGAGGG - Intergenic
906214570 1:44031286-44031308 ATGGTAAGGGGGCTGGGGGAAGG - Intronic
906238394 1:44226074-44226096 AGGTCTTAGGGGATGGGGGAGGG + Intronic
906500882 1:46341258-46341280 ATGGGCAAGGGAAAGGGGGAGGG - Intronic
906517163 1:46446485-46446507 AAGAGGAATGGGATGGGGGAAGG - Intergenic
906698847 1:47843068-47843090 TAGTGAAAGGGGGTGGAGGAGGG + Intronic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
907688501 1:56638012-56638034 ATGAAAGTGGGGATGGGGGAGGG - Intronic
907869805 1:58432885-58432907 ACGTGAAGGGGGCTGGGGGGAGG - Intronic
908330705 1:63068190-63068212 AAGGGAAAGGGGTTGGGGAAGGG - Intergenic
908431583 1:64063897-64063919 GTGAGAAGGGGGATGGGAGAGGG - Intronic
908475487 1:64483861-64483883 ATATGCAAGGGGGGGGGGGAAGG - Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909659077 1:78062430-78062452 ATGTAAAAGTGGGTGGAGGAAGG + Intronic
910093500 1:83493414-83493436 ATGTTAAGGGGGCTGGGGGGTGG - Intergenic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
911505778 1:98748823-98748845 ATGGGATATGGGGTGGGGGAAGG - Intronic
911512192 1:98820432-98820454 ATGTGAATGGGGATTGGGCAGGG + Intergenic
911789284 1:101991569-101991591 ATGTGAAAGGTTATTTGGGAAGG - Intronic
911951008 1:104173169-104173191 GTGTGAAAGGGGACGGGAGCAGG - Intergenic
912296307 1:108474116-108474138 GTGGGAAAGGGGTTGGGGCATGG - Intergenic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
912930081 1:113950206-113950228 ATGTGCAGGGGGTTGAGGGAAGG - Intronic
912963048 1:114213098-114213120 ATGTGAAAAGGGATGAGAGTGGG + Intergenic
913702486 1:121386123-121386145 GTATGAAGGGGGATGAGGGAGGG + Intronic
913975617 1:143452229-143452251 AGGGGAAAGAGGTTGGGGGAAGG - Intergenic
914043049 1:144066618-144066640 GTATGAAGGGGGATGAGGGAGGG + Intergenic
914070012 1:144277846-144277868 AGGGGAAAGAGGTTGGGGGAAGG - Intergenic
914109143 1:144688508-144688530 AGGGGAAAGAGGTTGGGGGAAGG + Intergenic
914135037 1:144893870-144893892 GTATGAAGGGGGATGAGGGAGGG - Intronic
914419085 1:147512116-147512138 ATATGAAAGGGGGTTGGGGTGGG - Intergenic
915244208 1:154544697-154544719 ATGTGAAAGTGGAGGTAGGAGGG - Intronic
915323812 1:155070414-155070436 GTGTGCAAAGGGGTGGGGGAGGG - Intergenic
915345487 1:155195042-155195064 ATGGCAAGGGGGAGGGGGGAGGG - Intergenic
915754907 1:158250127-158250149 TTGTGAAAGGTGATGGCAGAAGG + Intergenic
916013593 1:160728455-160728477 AAGTGAAAGGAGGTTGGGGATGG + Intergenic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
916670247 1:167011033-167011055 AAGTGAAAGAGGAAGGGGGAAGG - Intronic
916891174 1:169113896-169113918 TCCTGAAAGGTGATGGGGGAAGG - Intronic
917168567 1:172143519-172143541 AGGTGAAAGAGGGTGGGAGAGGG - Intronic
917954897 1:180085097-180085119 AAGGGAAAGGGGAAAGGGGAAGG - Intronic
918200341 1:182260504-182260526 ATATGACTGGGGATGGGGCAGGG - Intergenic
918475693 1:184922063-184922085 ATGTGAAAGGTAATTGGTGAGGG - Intronic
918656809 1:187037010-187037032 ATGAGAAGGGGGATGGGGGAGGG + Intergenic
918808972 1:189091505-189091527 TGGTGTTAGGGGATGGGGGAGGG - Intergenic
918849214 1:189663380-189663402 CGGGGAAAGGGGTTGGGGGAGGG - Intergenic
918965749 1:191345070-191345092 ATGTGAGAGGAAAAGGGGGAGGG - Intergenic
919754281 1:201056956-201056978 AGGTGAGAGGCGATGGGGGCCGG - Intronic
919833111 1:201555849-201555871 CTGTGAAGGGAGATGGGGGGCGG + Intergenic
920039005 1:203084030-203084052 ATCTGTAAGGGGAGGTGGGAAGG + Exonic
920127888 1:203708205-203708227 GTGAGAAATGGGATGTGGGATGG - Intronic
920489915 1:206404866-206404888 GTATGAAGGGGGATGAGGGAGGG + Intronic
920513253 1:206566149-206566171 ATGTGAAAGGGGGTGAGCCAAGG + Intronic
920525397 1:206662380-206662402 ATGTGAGACGGGGTGGAGGAGGG + Intronic
921004715 1:211081817-211081839 ATGGGATGGGGGACGGGGGAGGG + Intronic
921752389 1:218811055-218811077 ATGTGACAAGGGTTGGGGGAGGG - Intergenic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
922589674 1:226765282-226765304 ATGAGACAGGACATGGGGGATGG - Intergenic
922817427 1:228459619-228459641 ATGGGAGTGGGGGTGGGGGAAGG + Exonic
922934650 1:229413548-229413570 GTGGGAAAGGGGTTGGGGCATGG - Intergenic
923842397 1:237687411-237687433 AAGAGAAAAGGGAAGGGGGAAGG - Intronic
924262903 1:242250393-242250415 AGGTGAAGGGGAATGGGGAAGGG + Intronic
924316417 1:242802138-242802160 AGGGGAAAGGGAATGGGAGAGGG + Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063919731 10:10920795-10920817 GAGGGAGAGGGGATGGGGGAGGG + Intergenic
1064125704 10:12658416-12658438 AAGTGATAGGGGAGGGGGGCAGG + Intronic
1064267342 10:13835833-13835855 TGGTGAAAGGGGGAGGGGGATGG - Intronic
1065216783 10:23456772-23456794 ATGTTAAAGAGGATTTGGGATGG + Intergenic
1065368700 10:24960042-24960064 ATGGGAAAGGGGGTGGGGGATGG - Intergenic
1065815776 10:29481275-29481297 ATGGGGAAGGGGGTGTGGGAAGG + Intronic
1065957150 10:30703957-30703979 ATGGGGAAGGGGGTGTGGGAAGG - Intergenic
1066457618 10:35585588-35585610 ATGTGGAATGGGATGCAGGAAGG - Intergenic
1066721883 10:38348061-38348083 AGGTGAAGGGGAATGGGGAAGGG - Intergenic
1067371046 10:45682828-45682850 AGGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067388736 10:45843322-45843344 AGGAGAGAGGGGAAGGGGGAAGG - Intronic
1067417329 10:46113634-46113656 AGGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067445528 10:46341245-46341267 AGGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067448421 10:46367037-46367059 ATGTGGAGGGGGTGGGGGGAAGG + Intergenic
1067502742 10:46820517-46820539 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067588954 10:47493729-47493751 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1067591848 10:47519496-47519518 AAGAGAGAGGGGAAGGGGGAAGG - Intronic
1067636080 10:48001820-48001842 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1067638963 10:48027569-48027591 AAGAGAGAGGGGAAGGGGGAAGG - Intergenic
1067832305 10:49617177-49617199 GGGGGAAAGGGGAAGGGGGAAGG - Intronic
1067874519 10:49992732-49992754 AGGAGAGAGGGGAAGGGGGAAGG + Intronic
1068091699 10:52440339-52440361 TTCTGAGAGGGGCTGGGGGAAGG - Intergenic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1068226053 10:54108267-54108289 TTCTGCCAGGGGATGGGGGAGGG - Intronic
1068891352 10:62151289-62151311 AGGAGGAAGGGGATGGGGGAAGG - Intergenic
1069202462 10:65638128-65638150 AGAGAAAAGGGGATGGGGGATGG - Intergenic
1069840147 10:71334755-71334777 GTATGAATGGGGATGGGGGGAGG - Intronic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070132639 10:73665827-73665849 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1070135951 10:73693726-73693748 AGGAGAGAGGGGAAGGGGGAAGG - Intronic
1070165629 10:73895614-73895636 ATGTGAACTGAGATGGGGGTGGG - Intergenic
1070327417 10:75397526-75397548 AAGTGAAAGGGGGTGTGGGGCGG - Intergenic
1070601594 10:77870013-77870035 ATGGGATGGGGGATGGGGGATGG - Intronic
1070601598 10:77870020-77870042 TGCTGAAATGGGATGGGGGATGG - Intronic
1070721346 10:78759411-78759433 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1070782136 10:79143776-79143798 GTGTGATAGGGGCTGGGGGGTGG + Intronic
1071864168 10:89707642-89707664 GTGTGAAGGGGGAAAGGGGATGG - Intronic
1072160463 10:92761372-92761394 ATGGGATAGGGAATAGGGGAAGG - Intergenic
1072379750 10:94855950-94855972 ATGGGGTGGGGGATGGGGGAGGG - Intergenic
1072979502 10:100087911-100087933 AGGAGAAAGGGGAAGGGAGAGGG + Intergenic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1073592696 10:104771815-104771837 ATGAGAAGGACGATGGGGGAGGG + Intronic
1074192273 10:111148363-111148385 TAGTGAGGGGGGATGGGGGATGG + Intergenic
1074248334 10:111716619-111716641 ATGTCATAAGGGATGGGGGAAGG + Intergenic
1074326393 10:112455346-112455368 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
1074418398 10:113287078-113287100 ATCTGAAGGGGGTTGGGGGAGGG + Intergenic
1074571982 10:114632596-114632618 ACCTGAATGGGGCTGGGGGAAGG + Intronic
1074769799 10:116725825-116725847 GTGTGGCAGGGGTTGGGGGAGGG - Intronic
1074983429 10:118637697-118637719 ATTTGAAAGGGAAGGGGGAAAGG - Intergenic
1075013136 10:118891814-118891836 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1075263364 10:120981097-120981119 GAGTGGAAAGGGATGGGGGAGGG - Intergenic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075959928 10:126559580-126559602 AGGTGAAAGGAGAGGAGGGAGGG - Intronic
1076666820 10:132097929-132097951 ATGGGAAAGGGAAAGGGGAAGGG - Intergenic
1076666825 10:132097941-132097963 AAGGGAAAGGGGATGGGAAAGGG - Intergenic
1076684284 10:132190087-132190109 ATGAGAGAGGGGCTGGGAGAAGG - Intronic
1076760939 10:132605420-132605442 ATGGGAAAGGGGCTGGGGATGGG + Intronic
1077337558 11:2012187-2012209 ATGTGAGAGGGGGTGACGGAAGG + Intergenic
1077632092 11:3817639-3817661 AGGGACAAGGGGATGGGGGAAGG + Intronic
1077766560 11:5164874-5164896 ATGGGCAAGGGGTTGGGGCACGG + Intronic
1077806587 11:5596540-5596562 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077974846 11:7237292-7237314 TTGTCAGAGGGAATGGGGGATGG + Intergenic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078992505 11:16664326-16664348 CTGTGCCAGGGGATGGGGTAGGG - Intronic
1079079882 11:17406839-17406861 TTGGGAGTGGGGATGGGGGAAGG - Intronic
1079311968 11:19374892-19374914 ATCAGGAAGGGGATGGGGCAAGG - Intronic
1080117034 11:28632802-28632824 ATTTGAAAGAGGATATGGGAGGG - Intergenic
1080144928 11:28970120-28970142 ATCTGGGAGGGGTTGGGGGAAGG - Intergenic
1080405145 11:31972030-31972052 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1080540898 11:33263771-33263793 AAGAGGAAGGGGTTGGGGGAGGG - Intronic
1080635626 11:34120968-34120990 ATGTGCATGGGCCTGGGGGAGGG + Intronic
1080741194 11:35065951-35065973 ATGGAAAAGGGGATGGGGCAAGG - Intergenic
1081069639 11:38595238-38595260 ATGTAAAAGTGGATGGGGTTGGG - Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081617156 11:44597724-44597746 ATGTGGGAGGGAATGGGGCAGGG + Intronic
1082016823 11:47495370-47495392 TTAGGAATGGGGATGGGGGAAGG + Intronic
1082244427 11:49905182-49905204 AAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1082835867 11:57649784-57649806 ATTGGGAAGGGGATGGGGGTGGG + Intronic
1083193488 11:61069004-61069026 AAGAGAAGGGGGAAGGGGGAGGG - Intergenic
1083352590 11:62041536-62041558 ATGTGCAAGGGGATAAGGGCGGG - Intergenic
1083427026 11:62593530-62593552 TTGTGAAAGGGGATGGGGAGGGG - Exonic
1083827929 11:65213676-65213698 TAGAGAAAGGGCATGGGGGAGGG + Intergenic
1084116532 11:67045876-67045898 AGGTGAGGGGGGCTGGGGGATGG + Exonic
1084868703 11:72081004-72081026 CTGTGAAAGGTGATGAGGGTCGG - Intronic
1085131287 11:74041168-74041190 AAGTGAAAGGTGTTGGAGGAAGG - Intronic
1085377741 11:76082085-76082107 ATGAGAAAGGGGCTTGTGGAAGG + Intronic
1085483401 11:76841579-76841601 GTGAGAAAGGGGATGGGGAAAGG - Intergenic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1085732761 11:79013440-79013462 CAGTGAAGGGGGTTGGGGGAAGG - Intronic
1085858285 11:80201154-80201176 ATGTGTGTGAGGATGGGGGAGGG - Intergenic
1086323894 11:85678935-85678957 ATGGGAATGGTGGTGGGGGAGGG + Intronic
1086457071 11:86969524-86969546 AGGAGAAAGGGGATGGCAGAGGG - Intergenic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1087762138 11:102111814-102111836 AGGGGAAACGGGAGGGGGGAAGG - Intronic
1088324292 11:108586439-108586461 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324302 11:108586460-108586482 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324312 11:108586481-108586503 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324329 11:108586522-108586544 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324339 11:108586543-108586565 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324360 11:108586585-108586607 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324377 11:108586626-108586648 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324387 11:108586647-108586669 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088339300 11:108745059-108745081 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
1088605324 11:111524626-111524648 ATGTGATTGGAGTTGGGGGAAGG - Intronic
1088713604 11:112529431-112529453 AGGTGAAAGGGAAGGGAGGAAGG + Intergenic
1088891626 11:114049284-114049306 AAATGAAAGAGGATGGGGGAGGG - Intergenic
1089346559 11:117795296-117795318 TTGCGAAAGGGGATGGGGGTTGG + Intronic
1090039321 11:123276487-123276509 AAGTGAAAAGGGAAGGGAGAAGG - Intergenic
1090172621 11:124617990-124618012 ATGTGTTGGGGGATGGGGGTAGG + Intronic
1090430541 11:126642500-126642522 AGAGGAAAGGGGATGGGGAATGG - Intronic
1090727911 11:129544177-129544199 ATGTGAGAAGGGCTGGGGGCAGG - Intergenic
1090851924 11:130578462-130578484 ATGGGAACTGGGATGGTGGAAGG - Intergenic
1091124416 11:133082545-133082567 AGGGGAAGGGGGATGGGCGAGGG - Intronic
1202820542 11_KI270721v1_random:67369-67391 ATGTGAGAGGGGGTGACGGAAGG + Intergenic
1091408148 12:221563-221585 AAGAGAAAGGGGTTGGGGGGCGG + Intronic
1091521471 12:1248386-1248408 CTGTGATAGATGATGGGGGAGGG + Intronic
1091618570 12:2068288-2068310 ATGTGACAGGGACTGGGGCAGGG - Intronic
1091712397 12:2751343-2751365 ATGCTAAAGGGGATTGGGAAGGG - Intergenic
1091843418 12:3636714-3636736 ATGTGGAAGGGCATGCAGGAGGG + Intronic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092237422 12:6818943-6818965 AGGGGAAAGGGGGAGGGGGAGGG + Intronic
1092394176 12:8110713-8110735 AGGAGTTAGGGGATGGGGGAAGG - Intergenic
1092798726 12:12141171-12141193 ATGAGAAAGGGGAAGAGGAAAGG + Intronic
1092844861 12:12574778-12574800 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1092990763 12:13896693-13896715 ATGTGTTGGGGGATTGGGGAGGG + Intronic
1093204270 12:16228260-16228282 AACTGAAAGAGGATTGGGGAGGG + Intronic
1093345928 12:18038283-18038305 TAGTGAAAGGGGAGGGGTGATGG - Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093534816 12:20210275-20210297 AGGGGAGAGGGGAAGGGGGAAGG - Intergenic
1094574214 12:31669283-31669305 ATGTGATAAGGTATGGGAGAAGG + Exonic
1095505075 12:42888042-42888064 ATGTGAAATGGGTTAGAGGAGGG + Intergenic
1095583729 12:43828679-43828701 ATCGGTAAGGGGATGGGGGCAGG - Intergenic
1096453945 12:51769984-51770006 AGGTGAAAGGGGATGAGGAGCGG + Exonic
1096553401 12:52388958-52388980 AGGTGAAAGGGGAAGGGAGTGGG + Intergenic
1096569124 12:52509856-52509878 CTATCAAAGGGGTTGGGGGAAGG - Intergenic
1096626566 12:52899550-52899572 AGGTGAAAGGGGACTGGGGCAGG - Intronic
1096774597 12:53956240-53956262 AGGTGAAAGGGTCTGGGGAAGGG + Intronic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097416524 12:59322954-59322976 GTCTGCAGGGGGATGGGGGAGGG - Intergenic
1097540699 12:60938522-60938544 TGGTGAAAGGGAAAGGGGGAAGG - Intergenic
1097546683 12:61011292-61011314 AAGTGAGAGTGGGTGGGGGAGGG - Intergenic
1097651494 12:62303602-62303624 ATGTGGCGGGGGATGGGGGGAGG - Intronic
1097721861 12:63030461-63030483 ATGAGGTGGGGGATGGGGGAGGG - Intergenic
1098171187 12:67748931-67748953 ATGTGGAAGGGGTGGGGTGAAGG + Intergenic
1098689276 12:73466317-73466339 ATGGAAATGGGGATGGGAGAAGG - Intergenic
1099662254 12:85578834-85578856 AGGTGAAATGGGCTGGGGGAGGG - Intergenic
1099662464 12:85581875-85581897 ATGTGTAAGTGAAAGGGGGAAGG - Intergenic
1099856729 12:88177509-88177531 ATGTGAGAGAGGATGAGGGATGG + Intronic
1099869624 12:88330476-88330498 AAGAGAAAGGGGATGGAGGAGGG + Intergenic
1101301129 12:103483803-103483825 ATGTGGTGGGGGCTGGGGGAGGG - Intronic
1101909463 12:108850644-108850666 ATGGGAGAGGGGATTGGGGAGGG + Intronic
1102011587 12:109622386-109622408 ATCTGAAAAGAGGTGGGGGAGGG - Intergenic
1102180118 12:110906267-110906289 ATGTGAGAGGGGGAGGGAGAGGG + Intronic
1102210361 12:111122440-111122462 ATATAAAACGGGACGGGGGAGGG + Intronic
1102419713 12:112794091-112794113 ATGTGATGGGGGAGGAGGGAGGG - Intronic
1102618763 12:114177013-114177035 ATAGGAATGGGGGTGGGGGAAGG + Intergenic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1102749163 12:115277210-115277232 AGGGGAAAGGGGAGGGGGGGAGG + Intergenic
1102795699 12:115687320-115687342 AAGAGAAAGGGGGTGGGTGAGGG + Intergenic
1103125101 12:118415063-118415085 AAGTAAATGGGGTTGGGGGAGGG + Exonic
1103319245 12:120081154-120081176 ATGGGAATGGGGGTGGGGGTGGG - Intronic
1103350345 12:120279035-120279057 AGGGGGAGGGGGATGGGGGAGGG + Intergenic
1103424914 12:120825003-120825025 ATGAGAAAGGGACTGGGGGTGGG - Intronic
1104224307 12:126816365-126816387 AAGGGTGAGGGGATGGGGGAGGG - Intergenic
1104536294 12:129621133-129621155 ATGAGGAAGGATATGGGGGATGG - Intronic
1104544425 12:129698576-129698598 AGGGGAGAGGGGAGGGGGGAGGG + Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104983018 12:132582420-132582442 GGGTGAGAGGGAATGGGGGAGGG - Intronic
1105461266 13:20590724-20590746 ATGTGCAAAGGAATGGGGCATGG + Intronic
1106049695 13:26178504-26178526 ATGTGGGCGGGGGTGGGGGAGGG + Intronic
1106117478 13:26829903-26829925 ATGTGGAATTGGGTGGGGGATGG + Intergenic
1106720750 13:32432369-32432391 AGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1106997972 13:35509428-35509450 ATATGTAAGGGAATGGGGGCAGG + Intronic
1107158134 13:37193685-37193707 ATGGAAAAGGGCATGGGGGATGG + Intergenic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108733544 13:53259068-53259090 GGGAGAAAGGAGATGGGGGAGGG + Intergenic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1110034726 13:70668874-70668896 ATGAGAATGGGGGTGGGGGAAGG - Intergenic
1110542036 13:76717722-76717744 ATATAAATGGGGTTGGGGGAGGG - Intergenic
1110812769 13:79828777-79828799 ATGGGATGGGGGAGGGGGGAGGG + Intergenic
1111436488 13:88216438-88216460 ATGTGAAAGTGGTTTTGGGATGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112015171 13:95325564-95325586 AGGGGAAAGGGAAAGGGGGAAGG + Intergenic
1113611381 13:111647025-111647047 AGGTGGAAAGGGGTGGGGGAGGG - Intronic
1114382656 14:22224397-22224419 ATGGGAATGGGGAAGGGAGAAGG - Intergenic
1115160042 14:30383673-30383695 ATGTGAATGAGGGTGGGGGATGG - Intergenic
1115245171 14:31287261-31287283 AGATTAAAGGGGATGGGGGTAGG + Intergenic
1115319991 14:32069439-32069461 TTGTGGAGGGGGATGGGGTAAGG + Intergenic
1115360881 14:32500829-32500851 AGGATAAAGGGAATGGGGGAAGG - Intronic
1115387361 14:32813392-32813414 CTGGGAAAGGGGTTGGGGGGGGG - Intronic
1115479053 14:33844083-33844105 TTCTGATGGGGGATGGGGGAAGG - Intergenic
1115698158 14:35922949-35922971 ATGGGGTGGGGGATGGGGGAGGG + Intronic
1117010798 14:51468297-51468319 ATGGGAGAGGGGGAGGGGGAGGG + Intergenic
1117252708 14:53952584-53952606 GGGTGAAAAGGGGTGGGGGAGGG + Intronic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1117478556 14:56119690-56119712 CAGTGAAAGGGGAGGGGGAAGGG + Intronic
1117623969 14:57616905-57616927 TTGAGAAAGGGGATGGGGCGAGG - Intronic
1117770897 14:59133786-59133808 ATTTGAAGGAGGTTGGGGGAAGG + Intergenic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118435100 14:65763978-65764000 ATGGGAAAGAGGATGAGGAAAGG - Intergenic
1118622991 14:67631123-67631145 AGGTCAAGGGGGATGGTGGAGGG - Intronic
1118663633 14:68042603-68042625 ATGGGAAAGGGGAGGGAGAAAGG - Intronic
1118668359 14:68095576-68095598 AAATGAATGGGGATGGGGCAGGG - Intronic
1118693835 14:68364527-68364549 GAGTGGAAGGGGCTGGGGGAGGG - Intronic
1118980268 14:70710490-70710512 ATGTGGAAGGAGGTAGGGGAGGG + Intergenic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119387798 14:74268692-74268714 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1119437906 14:74610263-74610285 AGGAGAAAGAGGATGGGGCACGG + Intronic
1119579440 14:75763818-75763840 ATGAGAAATGGGATGTGGAAAGG - Intronic
1119922219 14:78457025-78457047 GGGGGAGAGGGGATGGGGGAGGG - Intronic
1119940270 14:78633448-78633470 ATGTTGAAGGGGAGTGGGGAGGG - Intronic
1120651309 14:87136534-87136556 GTGTGAAAGGGGAGAGGGTAAGG - Intergenic
1121447525 14:93988206-93988228 ATGGGAGAGGGGATGAGAGAGGG + Intergenic
1121447633 14:93988540-93988562 ATGGGAGAGGGGATGGGAGGAGG + Intergenic
1121447700 14:93988713-93988735 ATGGGAGAGGGGATAGGAGAGGG + Intergenic
1121593313 14:95137328-95137350 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1121593390 14:95137567-95137589 AAGGGAAAGGGGAAGGGGAAAGG + Intronic
1121670110 14:95702509-95702531 TTGTGAAAGGTGATGTGGGAGGG + Intergenic
1121701583 14:95958675-95958697 ATGTAAAAAGGCTTGGGGGAAGG - Intergenic
1122155086 14:99746057-99746079 GTGTGAAAGGGCCTAGGGGAGGG - Intronic
1122461942 14:101903320-101903342 ATGTGACAGGGCAAGGAGGAAGG + Intronic
1122497182 14:102166102-102166124 GTGAGAAGGGGGGTGGGGGATGG - Intronic
1122600802 14:102920781-102920803 ATGTGAATGGTGATGGGTGGTGG - Intergenic
1122647900 14:103207304-103207326 AGGAGGGAGGGGATGGGGGAGGG - Intergenic
1122897968 14:104769760-104769782 ATGGGACCAGGGATGGGGGATGG - Exonic
1123112482 14:105879867-105879889 GTGTGTAAGTGGTTGGGGGAGGG + Intergenic
1123116996 14:105899342-105899364 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123540515 15:21285180-21285202 AAGAGAAAGGTGAGGGGGGAGGG + Intergenic
1124836454 15:33200084-33200106 AACTGAAAGGGAATGAGGGAAGG - Intergenic
1124849820 15:33325682-33325704 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
1125191385 15:36997955-36997977 ATATGACAGGGGATAGGGCAAGG - Intronic
1125792909 15:42383198-42383220 TTGTGATGGGGGTTGGGGGAAGG + Intronic
1126293974 15:47116632-47116654 GTGTGAGAGGGGAGGTGGGATGG - Intergenic
1126405120 15:48315450-48315472 ATTGGAAAGGGGATGGGTGTGGG + Intergenic
1126579188 15:50227590-50227612 GGATGAAAGGGGTTGGGGGAAGG - Intronic
1126956660 15:53940166-53940188 ATGTAAAAAGGTTTGGGGGAAGG + Intergenic
1127155254 15:56117622-56117644 CTGGGAAAGGGGATGGGGATAGG - Intronic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127507266 15:59609518-59609540 AACTCAAAGGGGGTGGGGGATGG - Intronic
1127730663 15:61799021-61799043 TTGTGAAGGGGGATGAGCGAAGG - Intergenic
1128179640 15:65590482-65590504 ATGTGAGAGTGGGTGTGGGAGGG - Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128509356 15:68303884-68303906 ATCTGCAAGGGGAGGGGGGCCGG + Exonic
1128586370 15:68853940-68853962 TGGTGTAAGGGGTTGGGGGAGGG + Intronic
1128746329 15:70116957-70116979 ATGGGAGAGAGTATGGGGGAGGG + Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129044981 15:72725982-72726004 AGGGGAAAGGGGAAGGGAGATGG - Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129192830 15:73947400-73947422 ATGGGAAAGGGGCTGGGGCAGGG - Intronic
1129234388 15:74215059-74215081 ATGCAAAATGGGATGGAGGAGGG + Intergenic
1129384020 15:75185783-75185805 AAGGGAGTGGGGATGGGGGAGGG + Intergenic
1129446883 15:75625236-75625258 AGGGGGAAGGGGATGGGGGAGGG - Intronic
1129868753 15:78927875-78927897 ATGTGCCAGGGCCTGGGGGATGG + Intronic
1131046635 15:89320735-89320757 GTGTTAAAGTGGATGGGAGAGGG + Intronic
1131401434 15:92128498-92128520 ATGGGGCAGGGGATGGGGCAGGG + Intronic
1131484788 15:92810698-92810720 ATGTGAAGGGGGGCGGCGGAGGG + Intergenic
1132118979 15:99160040-99160062 ATGTGAGGGGGGAATGGGGAGGG + Intronic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1132252700 15:100346147-100346169 CAGTGAAAAGGGATAGGGGAGGG - Intergenic
1202948829 15_KI270727v1_random:12322-12344 AAGAGAAAGGTGAGGGGGGAGGG + Intergenic
1132671145 16:1102772-1102794 AGGTGAGGGGGGCTGGGGGAGGG - Intergenic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133579036 16:7125169-7125191 AAGTGTAAGGGCTTGGGGGACGG + Intronic
1133813201 16:9177267-9177289 ATGGGAAAGGGGAAGGGGAGAGG - Intergenic
1134294854 16:12936455-12936477 ATGGGAGAAGGGATGGAGGAGGG + Intronic
1134449430 16:14354290-14354312 AGGGGAAAGGGGAGGGGGAAGGG + Intergenic
1134803362 16:17105532-17105554 AAGTGAAGTGGGATGTGGGAAGG + Exonic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135047609 16:19168198-19168220 ATGGGAATGGGGAAGGGGGTGGG - Intronic
1135048286 16:19171864-19171886 AAAAGAAAGGGGATGGGGGAGGG + Intronic
1135061822 16:19277532-19277554 ATGTGAAAAGGAATGAGTGAGGG + Intergenic
1135666380 16:24338813-24338835 AGGTGAAAGGAGAGGGGTGATGG - Intronic
1135714017 16:24745371-24745393 ATGAGAAAAGGAATGGGGGGTGG + Intronic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1136165007 16:28447963-28447985 AAGTGAGAGAGGAAGGGGGAGGG - Intergenic
1136214305 16:28781194-28781216 AAGTGAGAGAGGAAGGGGGAGGG + Intergenic
1136224905 16:28853649-28853671 ATGTGAAAGGTATTGGGGGCTGG - Intronic
1136244224 16:28964131-28964153 TGGTGAAAGGGGAGGGGTGAAGG - Exonic
1136535937 16:30899532-30899554 ATGTGAGTGGGAATGGGGGTGGG + Exonic
1137615130 16:49841843-49841865 ATGTGAAAGGGAAAGAAGGAGGG + Intronic
1137965020 16:52922547-52922569 AGGTGGAAGGGAATGGGAGAAGG - Intergenic
1138316342 16:56073346-56073368 AGGGGAAAAAGGATGGGGGAGGG - Intergenic
1138358552 16:56406029-56406051 AGGGGAGAGGGGAGGGGGGAGGG + Intronic
1138420876 16:56898195-56898217 ATGGGCAAGGGGTTGGGGGGAGG + Intronic
1138483014 16:57316649-57316671 CTGTGAATGAGTATGGGGGAAGG + Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1139242155 16:65404084-65404106 ATTTGATAGGGCATGAGGGAAGG + Intergenic
1139430396 16:66908034-66908056 ATGTGGCAGGAGATGGGGAAGGG + Intergenic
1140315418 16:73891550-73891572 ATATGAAAAGGGAGGGGGCATGG + Intergenic
1140490003 16:75327437-75327459 ATGTTACGGGGAATGGGGGAAGG + Intronic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1140859253 16:79004993-79005015 ATGAAAAAGGGGAAGGGAGAGGG + Intronic
1141376333 16:83534131-83534153 ATTACAAAGGGCATGGGGGATGG - Intronic
1141837804 16:86554111-86554133 ATGTGGAAGGGGATTGGAGAGGG - Intronic
1142092881 16:88224497-88224519 ATGTGGACGGGGTTGGGGGCTGG + Intergenic
1142735684 17:1897552-1897574 TTGTGAGCGGGGATGGGGGGGGG - Exonic
1142825721 17:2508963-2508985 AGGTGAAAGGCGATGGTGGGAGG - Intronic
1143005164 17:3827077-3827099 GGGGGAAAGGGGAAGGGGGAAGG + Intronic
1143007860 17:3848490-3848512 ACAGGAAAGGGGATGGGAGATGG - Intergenic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143180614 17:4981950-4981972 AAGAGAAAGGGGCTTGGGGATGG - Intronic
1143216606 17:5229830-5229852 GGGAGAAAGGAGATGGGGGAAGG - Intronic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143491346 17:7286884-7286906 GGAGGAAAGGGGATGGGGGAAGG - Exonic
1146070875 17:29680114-29680136 ATCTGAAAGTGATTGGGGGAAGG + Intronic
1146520457 17:33521900-33521922 AGGTGCCAGGTGATGGGGGAAGG - Intronic
1146680113 17:34801110-34801132 GTGGTAAAGGGCATGGGGGATGG - Intergenic
1147214368 17:38890789-38890811 GTGTGAATGGGGAAGAGGGAGGG - Intronic
1147786537 17:42982275-42982297 TGGTGAAAAGGGATGGGGCATGG - Intronic
1147933183 17:43995493-43995515 TTGTGGAAGGGCATGTGGGATGG - Intronic
1148398543 17:47331737-47331759 GTTTGCCAGGGGATGGGGGAAGG - Intronic
1148657483 17:49298587-49298609 GTGTGAGAAGGGGTGGGGGATGG + Exonic
1148767157 17:50046124-50046146 AAGAGAAAGGGGAAGGGGAACGG + Intergenic
1148810609 17:50288498-50288520 ATGTGAATGAGGGTGGGGGTGGG - Intergenic
1148899964 17:50867665-50867687 AGGGGAAAGGGGAAAGGGGAAGG - Intronic
1149475636 17:56959039-56959061 AGCTTAAAGGGGGTGGGGGAAGG + Intronic
1150685320 17:67316074-67316096 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1151328333 17:73392180-73392202 ATGGGGCAGGGGGTGGGGGAGGG + Intronic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1151576239 17:74953891-74953913 ATGGGCACAGGGATGGGGGAGGG - Intronic
1152123824 17:78434636-78434658 ATGGGATAGAGGATGGGGGATGG + Intronic
1152123831 17:78434655-78434677 ATGGGATAGAGGATGGGGGATGG + Intronic
1152467578 17:80474801-80474823 TTGTAAAAGGGGAGGGGGGGGGG - Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1154966763 18:21366289-21366311 TGGGGTAAGGGGATGGGGGAGGG - Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155048956 18:22129989-22130011 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1155180188 18:23338636-23338658 ATGTGAAAATGGCTGGGGGGTGG - Intronic
1155200833 18:23516183-23516205 CTGTGAGAGGACATGGGGGACGG + Intronic
1155329462 18:24699874-24699896 ATGGGGATGGGGATGGGGGTAGG + Intergenic
1155332077 18:24728638-24728660 CTGTGATAGAGGCTGGGGGAAGG - Intergenic
1155397529 18:25402522-25402544 ATATGTAAGTGGATGGGAGAAGG - Intergenic
1156474707 18:37398186-37398208 TATTGAAAGGGAATGGGGGAAGG - Intronic
1156608390 18:38696553-38696575 ATGTGAGGGGTGATGGGGGGTGG + Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157422677 18:47559567-47559589 AGGAGAAAGGGGAAGGGGAAGGG - Intergenic
1157437383 18:47682344-47682366 ATCTGAATGGGGCTGGGGGAAGG - Intergenic
1157812802 18:50709663-50709685 ATGTCATTGGGGATGGGGGAAGG + Intronic
1158311965 18:56168712-56168734 ATGTGAAAGGGGTGGTGGGGTGG + Intergenic
1159190806 18:65039713-65039735 GGGTGAAAAGGGATGGAGGAGGG - Intergenic
1159622145 18:70650980-70651002 ATGTGAAATGTGATGGAGAAAGG + Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159983266 18:74811881-74811903 AGGGGAAGGGGGAGGGGGGAGGG + Intronic
1160226888 18:77018689-77018711 ATGTATGAGTGGATGGGGGATGG - Intronic
1160519771 18:79498053-79498075 ATTTGGAGGGGGATGGGGGGGGG + Intronic
1160798410 19:956138-956160 ATGTGAATTTGGGTGGGGGATGG + Intronic
1160968905 19:1758751-1758773 ATGGGAGAGGGGCTGGGGGAGGG + Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161562164 19:4979460-4979482 ATCTGAGAGGGGATGGGGTCAGG + Intronic
1161619776 19:5291965-5291987 ATGTGAAAGGGTATGCTGGGTGG - Intronic
1161756585 19:6138479-6138501 AGGGGAAGGGGGAAGGGGGAGGG + Intronic
1161939436 19:7393713-7393735 GTGTGGAAGTGGATAGGGGAGGG + Intronic
1161942031 19:7411262-7411284 AAGGGAAAGGGGAAGGGGAAGGG - Intronic
1161944687 19:7428152-7428174 ATGTGAAACTGAATGGGGGTGGG + Intronic
1162219592 19:9164844-9164866 ATTTGAAAGGGGATTTGGGGAGG + Intergenic
1162275456 19:9650478-9650500 ATGTGAAAAGAGAAGGGGGCGGG + Intronic
1162309992 19:9900587-9900609 GTGTGAAACGTGATGGGGGTGGG + Intronic
1162352145 19:10157343-10157365 GTGTGAAAAGGGATGTGGGAAGG + Intronic
1162450803 19:10753385-10753407 AAGGGAAGGGGGAGGGGGGAAGG - Intronic
1162686182 19:12386473-12386495 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1162686195 19:12386503-12386525 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1162876791 19:13626609-13626631 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1163004589 19:14389307-14389329 AAGGGGAGGGGGATGGGGGAGGG + Intronic
1163088687 19:15002744-15002766 ATGTGAAAGAGCACAGGGGAGGG + Intronic
1163101400 19:15099194-15099216 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1163634068 19:18430369-18430391 ATCTGAGAGAGGCTGGGGGATGG + Intronic
1163702497 19:18793172-18793194 GTTTGAAAGGGGATGGGTCAGGG + Intergenic
1163729598 19:18941322-18941344 CTGGGAGAGGGTATGGGGGAGGG + Intergenic
1164406899 19:27957248-27957270 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1164685503 19:30164004-30164026 ATGTGAATGGGGCTGGTGAAGGG - Intergenic
1165317804 19:35067196-35067218 TGGAGAAAGGGGTTGGGGGAGGG - Intergenic
1165400409 19:35596103-35596125 AAGGGAAAGGGGAAGGGGAAGGG + Intergenic
1165431569 19:35776062-35776084 ATGAGAAAGGGGCTGTGGGGAGG - Intronic
1165925242 19:39322015-39322037 ATGGGACAGGGGATGGGCAAAGG - Intergenic
1166348572 19:42182487-42182509 AGGAGAAAGGAGATGGGAGAAGG + Intronic
1166704993 19:44903567-44903589 ATGGGAAAGTGGACGGGGCAGGG - Exonic
1166959058 19:46487170-46487192 CTGAGATAGGGGTTGGGGGAGGG + Intronic
1166962205 19:46504357-46504379 AAGTGAAAAGGAATGGGAGAGGG - Intronic
1167055952 19:47111977-47111999 TCGGGGAAGGGGATGGGGGAGGG - Intronic
1167389111 19:49182500-49182522 ATGGGCAAGGGTATGAGGGACGG - Intronic
1167566610 19:50261228-50261250 ATGTGAAGAGTGATAGGGGAGGG - Intronic
1167694579 19:51007178-51007200 GTATGAAAGGGGATGGGATATGG + Intronic
1168022515 19:53619962-53619984 CTGTGACAGGGGATGAGGCAGGG - Intergenic
1168411236 19:56141504-56141526 ATGGGGAAGGGGCTGGGAGAGGG + Intronic
1168547231 19:57263522-57263544 TTGATAAAGGGGGTGGGGGAAGG - Intergenic
1168570075 19:57459365-57459387 ATGTCAAAGGGGTCGGGGGATGG - Intronic
925250591 2:2433825-2433847 ATGTGATAGAGGAAGGGGAAGGG + Intergenic
925573392 2:5334863-5334885 AAGGGAAAGGGGAAGGGGAAAGG + Intergenic
925755413 2:7128128-7128150 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755436 2:7128169-7128191 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755459 2:7128210-7128232 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755489 2:7128264-7128286 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925911009 2:8573649-8573671 CTGTGCAAGGTGGTGGGGGAAGG + Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
927910127 2:26891561-26891583 TTTTGAAAGGAGATGGGTGAGGG - Intronic
928109351 2:28494126-28494148 ATGTGAAAGGAGTTAGAGGAAGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929042763 2:37761443-37761465 ATGTCAAAAGAGATGGGGGCAGG - Intergenic
929095853 2:38262723-38262745 ATGTGGAGGGGGAGGGGGCAGGG - Intergenic
929139792 2:38656805-38656827 ATAAGAAAGGGGACAGGGGAGGG - Intergenic
929216924 2:39424345-39424367 AGGTGGGAGGGGATGGAGGAAGG + Intronic
929467037 2:42154377-42154399 ATGTGAGAAGTGATTGGGGAAGG + Intergenic
929967040 2:46543454-46543476 GTAGGAAAGGGGATGTGGGAAGG - Intronic
930084092 2:47480299-47480321 AGGGGAAAGGGGAAGGGGAAGGG - Intronic
930358144 2:50346509-50346531 AATAGAAAGGGGATGGGGGAAGG - Intronic
930639513 2:53840578-53840600 AGGGGAGAGGGGAGGGGGGAGGG + Intergenic
931129796 2:59322289-59322311 CTGTGAAAGAGGATGGGCCAGGG - Intergenic
931591869 2:63893308-63893330 AAGTGAACTGGGGTGGGGGAAGG - Exonic
931899111 2:66768271-66768293 AGGTGGAATGGAATGGGGGAGGG + Intergenic
932003020 2:67901891-67901913 ATTTGCAAGGGGATGAGGGTAGG + Intergenic
932322832 2:70834591-70834613 ATGTGAAAGTGGGTGGGGCAAGG - Intronic
932714185 2:74089742-74089764 TTGAGAAAGGGGTTGGGGGTGGG + Intronic
932739633 2:74281850-74281872 ATGTCAAAGAGAATCGGGGAGGG - Intronic
932887274 2:75559684-75559706 ATGAGAAAGGAGGTGGGGGGGGG + Intronic
933232297 2:79822904-79822926 ATCTGAATGGGGATGGTGGTAGG - Intronic
933366900 2:81364363-81364385 ATGTGAAAGTGAATAGGTGAAGG - Intergenic
933650067 2:84843382-84843404 ATGTGAAAGGAGAAAGGGGTTGG - Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
933897971 2:86827948-86827970 ATGTGCTGGGGGATGGGGCAAGG + Intronic
934094091 2:88582473-88582495 ATGGGAAAGGGAATATGGGATGG + Intronic
934180318 2:89613201-89613223 AGGGGAAAGAGGTTGGGGGAAGG - Intergenic
934290617 2:91687464-91687486 AGGGGAAAGAGGTTGGGGGAAGG - Intergenic
934523435 2:95034082-95034104 ATGGCAAAGGTGATGGGGGCGGG - Intronic
935171836 2:100616190-100616212 ATCTGAAATGGGGTGGGGGTTGG - Intergenic
935221858 2:101022085-101022107 TTCTGAAGGGGGATGGGAGAGGG - Intronic
935351136 2:102152608-102152630 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
935831468 2:107005023-107005045 ATGAGGAATGGGATGAGGGAGGG + Intergenic
936400326 2:112159931-112159953 AGATGGAAGGTGATGGGGGAAGG - Intronic
936972976 2:118192432-118192454 ATGTGCTTGGGGGTGGGGGATGG + Intergenic
937159739 2:119748834-119748856 AGGTGAAAGGGGAGGGGAGAGGG - Intergenic
937277811 2:120696679-120696701 ATGGGACAGGGGCTGGGGAAGGG + Intergenic
937458033 2:122060816-122060838 TTGAGTAAGGGGGTGGGGGAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938190741 2:129277904-129277926 AGGAGAAAGGGGATGAAGGAAGG - Intergenic
938600246 2:132830307-132830329 ATGTGGAGGGGGATGGGAGGGGG + Intronic
939035024 2:137120509-137120531 AAGGGAGAGGGGATGGGGAAGGG + Intronic
939330492 2:140753041-140753063 GTTTGCCAGGGGATGGGGGAAGG - Intronic
939354632 2:141085133-141085155 AAGAGAAATGGGGTGGGGGAAGG + Intronic
939587203 2:144020146-144020168 AAATGATAGGGAATGGGGGAAGG + Intronic
939989197 2:148861443-148861465 AAGTGAATTGGGCTGGGGGAGGG - Intergenic
940346767 2:152636813-152636835 AAGTGAAAGGGGAGGGGGAGGGG - Intronic
940503934 2:154528274-154528296 AGCTGCAAGGGGATGGGGGAGGG + Intergenic
940639724 2:156333388-156333410 ATCTGAAAGGGAATGGGAGTGGG + Intronic
940644516 2:156376517-156376539 ATGAGAAAGGGAAAGAGGGAGGG + Intergenic
940807707 2:158206507-158206529 CCCTGAAAGGGGATGGAGGAGGG + Intronic
940977240 2:159959828-159959850 GTGGGAATGGGGATGGGTGAGGG - Intronic
941413373 2:165188086-165188108 ATGTGGAGGGGGATGAGGTAGGG + Intronic
941497015 2:166218252-166218274 ATGTAAAATGGGGTGGGGGGAGG + Intronic
941629249 2:167865968-167865990 ATGGGGAGGAGGATGGGGGAGGG - Intergenic
941633094 2:167905571-167905593 TTGGGAAAGGAGATGGGGGGCGG + Intergenic
942205601 2:173617444-173617466 GTGTGAAAAGGAATGAGGGAGGG - Intergenic
942248852 2:174031133-174031155 ATGGGAGAGGGAAAGGGGGAAGG - Intergenic
942520089 2:176794676-176794698 ATGTGATAGGGGCTGGGGCAGGG - Intergenic
942593426 2:177569507-177569529 CTGTGAAAGGGCATGGGGTTTGG + Intergenic
942777010 2:179593982-179594004 ATGAGAAAGGGAATAGGGGAGGG + Intronic
944354751 2:198773970-198773992 ATAAGAAATGGGATGGGGAAGGG - Intergenic
945259718 2:207832302-207832324 AAGAGAAAAGGGTTGGGGGAGGG - Intronic
946227598 2:218272533-218272555 ATGTGCACGGGGTTTGGGGAGGG - Intronic
946308149 2:218867795-218867817 AGGTGAAAGGTGAGTGGGGATGG + Intronic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
946740295 2:222794565-222794587 ATTTGACAGGGGGTGGGGGAAGG + Intergenic
947429445 2:230013236-230013258 ATGGAAAATGAGATGGGGGAGGG - Intergenic
947651875 2:231793668-231793690 AGATGAAAGGGGAGGGGAGAGGG - Intronic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
947744851 2:232502241-232502263 ATCTGCCAGGGAATGGGGGAGGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948188781 2:236042697-236042719 ATGTGAGTGCGGATGGGGGGTGG + Intronic
948517870 2:238516702-238516724 ACTTGAAAGGGGATGAGGGTAGG + Intergenic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948912007 2:241009541-241009563 ATGAGAAAGGGCACGGGGGCTGG + Intronic
949064238 2:241980043-241980065 AAGGGATGGGGGATGGGGGATGG - Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169178640 20:3542599-3542621 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1170503962 20:17004635-17004657 AAGTGAAAGGGAAGGGGAGAGGG + Intergenic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171121911 20:22575856-22575878 AGGTAAAAGGAGATGGGGGATGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1171474523 20:25397837-25397859 AGGGGAAGGGGGAAGGGGGAGGG + Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172054626 20:32145442-32145464 GAGGGAAAGGGGATGGGGGTTGG + Intronic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172221325 20:33276955-33276977 AGGTGAGATGGGATTGGGGATGG - Intronic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1172586867 20:36091828-36091850 ATCTGAAAGAAGATGGGGCAGGG - Intronic
1173019859 20:39258058-39258080 ATAGGAAAGGGGAGAGGGGAGGG - Intergenic
1173053023 20:39583674-39583696 AGAGGAAAGGGGAAGGGGGAAGG + Intergenic
1173192520 20:40887261-40887283 GTGTGAAAGGGGCTGGGGCCTGG - Intergenic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1174599797 20:51715033-51715055 CTTTAAAAGGGGATAGGGGAAGG - Intronic
1174680224 20:52399399-52399421 ATTTGAGAGGGGATTTGGGAAGG + Intergenic
1174963391 20:55183737-55183759 ATGGGGAAGGGGATGGGGATGGG + Intergenic
1175289793 20:57868140-57868162 AGGTGAGAGGGGAAGGGGGCAGG - Intergenic
1175430622 20:58900066-58900088 ATCTGAGGGGGGAGGGGGGATGG + Intronic
1175871967 20:62213202-62213224 AGGAGAGCGGGGATGGGGGAGGG + Intergenic
1175872002 20:62213287-62213309 AGGAGAGCGGGGATGGGGGAGGG + Intergenic
1175872058 20:62213422-62213444 AGGAGAGCGGGGATGGGGGAGGG + Intergenic
1175872092 20:62213507-62213529 AGGAGAGCGGGGATGGGGGAAGG + Intergenic
1175872100 20:62213527-62213549 AGGAGAGCGGGGATGGGGGAAGG + Intergenic
1175872129 20:62213594-62213616 AGGAGAGCGGGGATGGGGGAGGG + Intergenic
1175872166 20:62213681-62213703 AGGAGAGCGGGGATGGGGGAGGG + Intergenic
1175930304 20:62490683-62490705 AAGTGTGAGGGGTTGGGGGAGGG - Intergenic
1176072727 20:63235380-63235402 AGGTGGAGGGAGATGGGGGAAGG + Intergenic
1176076542 20:63250929-63250951 CTGGGATGGGGGATGGGGGATGG - Intronic
1176513650 21:7767340-7767362 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177867051 21:26525017-26525039 ATCAGAAAGGGGATGACGGAGGG - Intronic
1177908513 21:27000832-27000854 ACTTGAAAGGGGATGGTGGGAGG + Intergenic
1177951515 21:27543831-27543853 AGGGTAAAGGGGATGGGGGCTGG + Intergenic
1178246021 21:30953434-30953456 AGGTGAAAGGGGATGAGGTCTGG - Intergenic
1178596392 21:33957233-33957255 GAGGAAAAGGGGATGGGGGAGGG + Intergenic
1178607753 21:34054527-34054549 ATCTGAAGGGGGATGAGGAAGGG + Intergenic
1178647763 21:34397864-34397886 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1178793670 21:35723473-35723495 ATGTGAGAGGGGTTGGGGGGGGG - Intronic
1179050811 21:37887292-37887314 ATGAGGATGGGGCTGGGGGAGGG - Intronic
1179057568 21:37950169-37950191 ATGTGAGAGAATATGGGGGATGG - Intergenic
1179125506 21:38587297-38587319 ATGTTCAAGGGGATGGGGGAGGG + Intronic
1179189115 21:39108293-39108315 ATGAGAAACAGGATGGAGGAGGG + Intergenic
1179413892 21:41182516-41182538 ATTCTAAAGGGGAGGGGGGAAGG + Intronic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1180076040 21:45463342-45463364 ATGGGAATGGGGGTGGAGGATGG + Intronic
1180164019 21:46011210-46011232 AGGAGCAAGGGGTTGGGGGAGGG - Intergenic
1180182328 21:46123513-46123535 ATGGGCAAGTGGATGGGGGTGGG + Intronic
1180487536 22:15816606-15816628 ATGTGGATGGGGGTGGGGGGTGG + Intergenic
1180600598 22:17012802-17012824 ATGTGACAGGCCATGGGGCAGGG - Intergenic
1180719046 22:17893272-17893294 ACGTGAGAGGGGTTGGAGGAGGG - Intronic
1180924576 22:19544745-19544767 AAGTGACAGGGGATGGAGAAGGG + Intergenic
1180941693 22:19663786-19663808 AGGGGAAAGGGGATGGGGGAAGG - Intergenic
1181080729 22:20413186-20413208 AAGAGAAAGGGGAAGGGGCAAGG + Intergenic
1181375176 22:22452383-22452405 ATGTGGAAGGGGAGAGGGTAAGG - Intergenic
1181637708 22:24181987-24182009 ATGGGAAATGGGGTGGGGGACGG - Intronic
1181885666 22:26020325-26020347 ATCTGAAAGGGGAAGGGGTATGG + Intronic
1181903158 22:26171369-26171391 ATTCAAAAGGGGGTGGGGGAGGG - Intronic
1182282827 22:29226971-29226993 TAGAGAAAGGGGATGGGGCAGGG - Intronic
1182292265 22:29289504-29289526 AGGGAAAAGGGGATGGGAGAAGG - Intronic
1182455260 22:30446380-30446402 AAGGGAAATGGGATGGGGGGCGG - Intergenic
1182459118 22:30471848-30471870 AGGGGAAAGGGGCTGGGGGGTGG - Intronic
1183245584 22:36690962-36690984 ATGGGAGAGGAGATAGGGGAAGG - Intronic
1183848458 22:40562711-40562733 AGGGGAAGGGGGAAGGGGGAAGG + Intronic
1184031199 22:41895841-41895863 TGTTGAAAGGGGATGGGGGCTGG + Intronic
1184107548 22:42376946-42376968 AATTGAAAGGAGGTGGGGGAGGG + Intergenic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184449688 22:44575641-44575663 AGGAGAAGGGGGATGGGAGAAGG + Intergenic
1184651343 22:45920672-45920694 ATGAGGGATGGGATGGGGGATGG + Exonic
1184651370 22:45920744-45920766 ATGGGATGGGGGATGAGGGATGG + Exonic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185047020 22:48533629-48533651 ATCTGGAAGGGAATGGGAGAAGG + Intronic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1203294947 22_KI270736v1_random:32932-32954 ATGTCAAAAGAGATGGGGGCAGG - Intergenic
949235254 3:1801475-1801497 AGGTGGCAGGGGGTGGGGGAGGG - Intergenic
949405075 3:3705496-3705518 AAATGAAGGGGGTTGGGGGAGGG + Intronic
949542431 3:5043886-5043908 ATATGAAATAGGATGAGGGATGG + Intergenic
950047330 3:9956800-9956822 GAGTGAAAGGGAATGGGGTAAGG - Intergenic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
950395284 3:12729373-12729395 ATGTGGAAGGGGATGGGCTTTGG - Intergenic
950477284 3:13222145-13222167 AGGTGCCAGGGGCTGGGGGAGGG - Intergenic
950891755 3:16410382-16410404 ATGTGGATGGGGATGGGGATGGG + Intronic
951368858 3:21818180-21818202 ATGGGGGTGGGGATGGGGGAGGG + Intronic
951719138 3:25679625-25679647 AGGGGAAAGGGGAAGGGCGAGGG + Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952107551 3:30087617-30087639 AGGTGGAGGGGGAGGGGGGAGGG - Intergenic
952749943 3:36816960-36816982 GTGGGAAAGGGGAAGGGGAAGGG - Intergenic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
953081387 3:39622166-39622188 ATGGGGGAGGGGATGGGGGCAGG + Intergenic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
953872481 3:46639270-46639292 ATGTGTTTGGGGATGGGGGTGGG + Intergenic
953919611 3:46942949-46942971 AGGTGACTGGGGTTGGGGGAGGG + Intronic
954770078 3:52959120-52959142 CTGTCAAGGGGGACGGGGGAGGG + Intronic
955150686 3:56363869-56363891 AAGGGAAAGGGAAAGGGGGAGGG + Intronic
955439202 3:58937354-58937376 ATCTGACTGGGGATGGGGGAAGG - Intronic
955933073 3:64077199-64077221 ATGGGAATGGGGATGGGGATGGG + Intergenic
956009634 3:64817047-64817069 AAGAGAAAGGAGCTGGGGGAGGG - Intergenic
956364407 3:68484397-68484419 AGGTGAAAGGGGATGAGCCAGGG + Intronic
956529891 3:70206506-70206528 ATTTTACAGGGGATGGGGGTTGG + Intergenic
956679903 3:71768880-71768902 ATGCGGAAGGGGCTGGGAGAGGG + Intergenic
956747689 3:72322526-72322548 ATGAGAAAGGAGATAGGGAAGGG + Intergenic
956809983 3:72855530-72855552 AGGTGAAAGGGAATGGGAAAAGG - Intronic
957127932 3:76186343-76186365 ACGAGAGAGGGTATGGGGGAAGG - Intronic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
957532789 3:81461526-81461548 AACTGGAAAGGGATGGGGGAAGG + Intergenic
957563303 3:81854051-81854073 ATGGAAAAGGGGATGAGGGATGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957602436 3:82355476-82355498 ATGTGCATAGGGATGGGGGCAGG - Intergenic
957840051 3:85656021-85656043 ATGTGACAGGGAATGGAGTAGGG - Intronic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958429559 3:94021979-94022001 ATTGGAAAGGGGATGTGGTACGG - Intronic
958880285 3:99661941-99661963 ATGTGCCAGGGGATGAGGGAAGG + Intronic
958885453 3:99721425-99721447 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961519406 3:127458047-127458069 AGGTGAGTGGGGCTGGGGGAAGG - Intergenic
961717035 3:128864816-128864838 ATCTGAAAGGGGGAAGGGGATGG - Intergenic
961804866 3:129482138-129482160 ATCTGAAAGGGGGAAGGGGATGG + Intronic
961864319 3:129942524-129942546 AGCTGAAAGGAGATGGAGGAGGG + Intergenic
962740991 3:138362449-138362471 ATGGGAAAGGGGATGGGAATAGG - Intronic
963447589 3:145434319-145434341 ATGTGTGTGGGGGTGGGGGAGGG + Intergenic
963527397 3:146431362-146431384 ATGTGAAGGGAGTTGTGGGATGG - Intronic
964412048 3:156408031-156408053 TTGTGGAAGGTGACGGGGGAGGG + Intronic
964569681 3:158097880-158097902 ATGCGATAGGGGACGAGGGATGG + Exonic
964833329 3:160910244-160910266 AGGGGAAAGGGGAAGGGGAAAGG - Intronic
964922548 3:161914873-161914895 ATGCGAAGGGGGAGGGGAGACGG + Intergenic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
965925729 3:173977319-173977341 ATGGGAGTGGGGATGGGGGAAGG + Intronic
965949051 3:174281263-174281285 ATGTGAATGGGGGTGGGGATGGG - Exonic
966641402 3:182194858-182194880 ATGTGATTGGGGGTGAGGGAAGG - Intergenic
966927061 3:184651529-184651551 ATGGGAAAGGGGTTGCGGGGAGG + Intronic
967851234 3:194084034-194084056 ATGTGAGAATGGATGGGGGGCGG + Intergenic
967976778 3:195039926-195039948 TTTTGATGGGGGATGGGGGATGG + Intergenic
968168640 3:196490056-196490078 ATGTGGAAGGGTATTGGTGATGG - Intronic
968432750 4:568366-568388 CTGAGAAGGGGGATGAGGGATGG - Intergenic
968658974 4:1791216-1791238 ATGGGAGAGGGGCTGGGGAAGGG + Intergenic
968876317 4:3269603-3269625 CTGCGAAAGGGGAGCGGGGAGGG + Intronic
968884275 4:3318882-3318904 TTGTGACAGGTGATGGGGGTGGG + Intronic
968954041 4:3709125-3709147 ATGTGTGAGTGGATGGGTGAGGG - Intergenic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969490443 4:7496470-7496492 CTGAGATGGGGGATGGGGGACGG - Intronic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969543178 4:7806689-7806711 AGGGGAAAGGGGAGAGGGGAGGG - Intronic
969548735 4:7849935-7849957 ATGTAAAAGGGGCTGGGGATGGG + Intronic
970183378 4:13422749-13422771 ATGGGATGGGGGACGGGGGAGGG + Intronic
970238962 4:13988270-13988292 AAGAGAAATGGGATGAGGGAGGG + Intergenic
970346987 4:15161930-15161952 GTGTGGCAGGGGGTGGGGGAAGG + Intergenic
970554828 4:17220692-17220714 ATGTGAAGATGGAAGGGGGATGG + Intergenic
970836013 4:20408492-20408514 AGGGGAAAGGGGATCAGGGATGG - Intronic
971119258 4:23685890-23685912 ATGTGAATAGGGATGTGTGAGGG - Intergenic
971307546 4:25496794-25496816 ATGAGAAAGGGGAAGGGTGGGGG - Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
973263171 4:48185785-48185807 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
973263183 4:48185810-48185832 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
973584221 4:52375076-52375098 ATGTGACAGGGAAGGGAGGAGGG + Intergenic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
973647680 4:52966446-52966468 ATGTGGAAGGTAATGTGGGAAGG - Intronic
973822748 4:54677247-54677269 ATGAGAGTGGGGATGGGGGCGGG - Intronic
973897943 4:55434937-55434959 AAGGGAGAGGGGTTGGGGGAGGG + Exonic
974214945 4:58832973-58832995 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
974586303 4:63883084-63883106 GTGAGGAAGGGGATGGGGGGTGG - Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975096006 4:70457080-70457102 AAGGGAATGGGGATGGGGCAGGG + Intronic
975399537 4:73918579-73918601 ATATGGAAGGGGATTGGGCATGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976579715 4:86721725-86721747 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
976679764 4:87743668-87743690 ATGTGAAGGGTGGCGGGGGAGGG + Intergenic
976725785 4:88214396-88214418 ATTTGAGAGAGAATGGGGGAGGG - Intronic
976865079 4:89715295-89715317 ATGGGGTGGGGGATGGGGGAGGG + Intergenic
978268555 4:106859031-106859053 AAAGGTAAGGGGATGGGGGAGGG + Intergenic
978430084 4:108624370-108624392 ATGGGAAATGGGGTGGGGGAAGG + Intronic
978438444 4:108710175-108710197 GTGGGAAAGGGGTTGGGGCATGG - Intergenic
979367020 4:119837429-119837451 AAGGAGAAGGGGATGGGGGAGGG + Intergenic
980538187 4:134158131-134158153 ATTTGTAGGGAGATGGGGGAGGG - Intergenic
981086541 4:140689655-140689677 AGGAGAAAGGGGAGGGGGGAAGG - Intronic
981319026 4:143370169-143370191 AAGTAAAAGGGTATGGGGCAAGG + Intronic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
982099206 4:151952173-151952195 ATGGGAGAGGGGGTGGGGGTGGG - Intergenic
982123370 4:152162901-152162923 AGGAGAAAGGGGAAAGGGGAGGG + Intergenic
982311424 4:153989022-153989044 ATGTGAAAGGGTGGGGGTGAGGG + Intergenic
984153125 4:176159423-176159445 ATGTGAAGGGAGAAAGGGGATGG - Intronic
984210390 4:176840203-176840225 ATTTGTCGGGGGATGGGGGAGGG - Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
984371996 4:178880078-178880100 ATGTGAAAGTGGAAGGGGTGAGG - Intergenic
984612723 4:181858657-181858679 ATATGCCAGGGGATGGAGGAGGG + Intergenic
984859028 4:184220130-184220152 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
984911433 4:184676922-184676944 AGGGGAAGGGGGAAGGGGGAAGG - Intronic
984911446 4:184676949-184676971 AAGGGAAGGGGGAAGGGGGAAGG - Intronic
985575917 5:673452-673474 AGGTGAATGGGGAGGGGGGGAGG + Intronic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
985808197 5:2063762-2063784 ATGTCACAGGGTGTGGGGGAAGG + Intergenic
986178800 5:5374329-5374351 ATGTGAGAGGAGAAAGGGGATGG + Intergenic
986606483 5:9528380-9528402 ATGAGAAATGGGGTGGGAGATGG + Intronic
986723450 5:10577092-10577114 AAGGGAAAGGGGAAGGGGAAGGG - Intronic
986970040 5:13322759-13322781 AGGTGAAGGGGGCTGGTGGATGG - Intergenic
987396730 5:17431541-17431563 AAAGGAAAGGGGGTGGGGGATGG - Intergenic
987508136 5:18799826-18799848 ATGTAAAAAGGTTTGGGGGAAGG - Intergenic
988834337 5:35016562-35016584 AAGGGAAAGGGGAAGAGGGAGGG - Intronic
989194934 5:38707442-38707464 GGGTGAAAGGGGAGGTGGGAGGG - Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989375707 5:40757549-40757571 AAGGGAAAGGGGAAGGGGAAAGG + Intergenic
989600231 5:43193455-43193477 ATGAGGAATGGGGTGGGGGAGGG - Exonic
989611332 5:43295412-43295434 ATGGAAAAGGGCATGGGGGCAGG + Intronic
989651735 5:43697712-43697734 ATGTGGATGGTGATGGTGGAAGG + Intronic
989778595 5:45237999-45238021 GTGTGATGGGGGGTGGGGGAGGG - Intergenic
990257616 5:53987455-53987477 AAGTGAAAGGGGTTTGTGGATGG - Intronic
990421707 5:55642025-55642047 AAGGGAAAGGGGAAGGGGAAGGG - Intronic
990589647 5:57249757-57249779 AGGGGAGAGGGGAAGGGGGAGGG - Intronic
990939365 5:61186730-61186752 ACGTGAAAGATGATGGGAGAGGG - Intergenic
990976311 5:61564696-61564718 ATGTGAGAGGGGATGATGCAAGG + Intergenic
991368553 5:65894520-65894542 ATGTGATAGAGGGTGGGGGTGGG - Intergenic
991424869 5:66480339-66480361 ATGGGGTGGGGGATGGGGGAGGG - Intergenic
992009338 5:72511109-72511131 ATATGAAAGTGCAGGGGGGATGG + Intergenic
992094674 5:73351806-73351828 AGTTGCAAGGGGCTGGGGGAAGG + Intergenic
992349680 5:75916292-75916314 ACGAGAAAGGGGAAGGGGAAGGG - Intergenic
993282238 5:85939382-85939404 ATTTGAGAGGTAATGGGGGAAGG - Intergenic
993302918 5:86235595-86235617 ATGAGGAAAAGGATGGGGGAAGG + Intergenic
993335050 5:86646603-86646625 AAGTGAAAAGGGCTGTGGGAAGG + Intergenic
993727425 5:91383777-91383799 GTGTGAAGAGAGATGGGGGAAGG + Intergenic
993841140 5:92880250-92880272 TTTTTAAAGGGGTTGGGGGATGG + Intergenic
993946883 5:94125882-94125904 ATGTTAAAAGTGATGGGAGAGGG + Intergenic
994049974 5:95351047-95351069 AGGTCCAAGGGGATGAGGGAAGG + Intergenic
994743877 5:103654982-103655004 ATATGAAAGGGTTTGGGGGTGGG - Intergenic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995397433 5:111702460-111702482 AGGTGAGAGGGTATGGGGGTAGG - Intronic
996287866 5:121815944-121815966 ATGTGTAAGGGATTGGGGTAGGG - Intergenic
997008384 5:129847873-129847895 AGGTGAAAGGGGATGGTAAAAGG - Intergenic
997131337 5:131279448-131279470 TTCTGAAAGGGGGGGGGGGAGGG - Intronic
997167535 5:131676797-131676819 AAATGGAAGGGAATGGGGGAGGG + Intronic
997287230 5:132688915-132688937 CTCTAAAAAGGGATGGGGGAGGG + Intergenic
997299174 5:132789850-132789872 ATGTGAAGGGGGCTGGAGGCAGG - Intronic
997584420 5:135035885-135035907 ATGGGGATGGGGATGGGGGTAGG - Intronic
997675960 5:135713714-135713736 ATTTGAAATATGATGGGGGAGGG - Intergenic
998350118 5:141494921-141494943 ACGTGGGAGGAGATGGGGGAGGG + Intronic
998491652 5:142551956-142551978 AGGGGAAAGGGGGTGGGCGAGGG - Intergenic
998985430 5:147751509-147751531 ATGTGAAGGGGGTGGGGGGAGGG - Intronic
998987262 5:147773902-147773924 ATGTGAAATTGATTGGGGGAAGG + Intronic
999409323 5:151336684-151336706 ATGTGTGGGGGGGTGGGGGACGG - Intronic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
999890219 5:155970204-155970226 GGGTGAAATGGGATGGGGGCTGG - Intronic
1000051243 5:157564618-157564640 AGGAGAAAGCAGATGGGGGAAGG - Intronic
1001151795 5:169235947-169235969 ATGTGAAAAGGGAAGGGAGTGGG - Intronic
1001696451 5:173673817-173673839 GTGTGGAAGGGCATGAGGGAGGG + Intergenic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002257953 5:177972897-177972919 AAGTAAATGGGGTTGGGGGAGGG + Intergenic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002853727 6:1020022-1020044 GTGTGAAAGAGAATGGGTGAGGG + Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003102155 6:3184975-3184997 ATGTGCAGGGGTATGGGGGAAGG + Intergenic
1003915278 6:10781029-10781051 AGGTGAAGGGGGATGAGTGAGGG - Intronic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004813469 6:19286594-19286616 TGGTGACAGGGGCTGGGGGAGGG + Intergenic
1004921634 6:20381457-20381479 GTGGGCAAGGGGATGGGGAATGG + Intergenic
1004924237 6:20402990-20403012 ATGGAGAAGGGGGTGGGGGAGGG + Intronic
1005399240 6:25414760-25414782 ATGTGGAAGGGGATGGGGGTTGG - Intronic
1005693706 6:28332045-28332067 AAGTGAAAGGGGATATAGGAGGG - Intronic
1005816800 6:29559640-29559662 TTGATAAAGGGGATGGGGAAAGG - Intronic
1006265765 6:32921892-32921914 ATGTCAATGGAGATGGGGGCGGG + Intergenic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006567806 6:34974309-34974331 AAGAGAAAGGGGAAGGGGAAGGG - Intronic
1006576226 6:35048467-35048489 AGGCAGAAGGGGATGGGGGAGGG - Intronic
1006803877 6:36776440-36776462 ATGGGAATGGGGATGGGAGCAGG + Intronic
1006934110 6:37705513-37705535 ACGTAAAAGGGGGTGGGGGGCGG + Intergenic
1006990006 6:38207189-38207211 ATGAGCTGGGGGATGGGGGATGG + Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007116183 6:39344985-39345007 ATGGAAAAGGGGATGGGGGAGGG - Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1007383255 6:41503985-41504007 ACGTGAGAGGGGGTGGGGGTGGG + Intergenic
1007407893 6:41645271-41645293 GGGGGAAAAGGGATGGGGGATGG - Intronic
1007428119 6:41760201-41760223 ATCTGAGCGGGGCTGGGGGAGGG - Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1007920271 6:45602660-45602682 ATTTGCAAAGGAATGGGGGAAGG - Intronic
1007954276 6:45902188-45902210 ATGAGAAAGTGGATGGGAGTGGG - Exonic
1008003071 6:46381151-46381173 TTCTGAAATGAGATGGGGGAGGG - Intronic
1008391812 6:50960588-50960610 ATTTGAAAGGGGAAGAGGGTGGG + Intergenic
1008556157 6:52674820-52674842 ATGAGGAAGGGTATGGGGGAGGG - Intronic
1008630325 6:53358482-53358504 ATGTCAAAGAGGATGAGGAAAGG + Intergenic
1008816990 6:55579910-55579932 ATGTGAAAGTGAGGGGGGGAAGG - Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1010529706 6:76952664-76952686 GTGTAAAAGGGGATGTGGGATGG + Intergenic
1011227128 6:85119828-85119850 ATGTGAAAGGGAATGTTTGAGGG - Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012206840 6:96472219-96472241 AGGGGAAGGGGGATTGGGGAGGG - Intergenic
1012790101 6:103682408-103682430 GTGTGTAGGGGGGTGGGGGAAGG - Intergenic
1013210027 6:107978504-107978526 ATGTACATGGGGATGGGGAAAGG + Intergenic
1013231953 6:108167800-108167822 GAGTGAAAGGGGGAGGGGGAGGG - Intronic
1013246584 6:108293560-108293582 AGGGGAAGGGGGAAGGGGGAGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013647147 6:112156233-112156255 GTGTGAAAGGGCAGGGGTGAGGG - Intronic
1013711110 6:112900298-112900320 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1013943914 6:115699377-115699399 AGCTGGAAGGGGATGGGTGATGG - Intergenic
1014091680 6:117411275-117411297 AGGTGAAAGGAGTGGGGGGATGG - Intronic
1014098352 6:117483176-117483198 AAGTGAAATGGGCTGGGGGGCGG - Intronic
1014155176 6:118101591-118101613 ATGAGAAGTGGGATGGGAGAAGG + Intronic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1015217685 6:130768723-130768745 ATGTGAAAGATGAAGGGGAATGG - Intergenic
1016582773 6:145647695-145647717 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1016582783 6:145647725-145647747 AAGTGAAAGGGGAAGAGGAAGGG + Intronic
1016904479 6:149135455-149135477 ATGTGCAAGGGTATCAGGGAAGG - Intergenic
1017038153 6:150285621-150285643 ATAGGACAGGGTATGGGGGAAGG - Intergenic
1017563605 6:155660532-155660554 ATGTAAAAAGGCTTGGGGGAAGG + Intergenic
1017754882 6:157521061-157521083 AAGTGCAAGGGATTGGGGGAGGG + Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018441802 6:163820567-163820589 AGGTGCATGGGGATGAGGGAGGG - Intergenic
1018863061 6:167725956-167725978 ACGTGAAAGAGGGTGGGGAAGGG - Intergenic
1019101381 6:169633270-169633292 AGGTGGACGGGGGTGGGGGAGGG + Intronic
1019159073 6:170057611-170057633 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019159097 6:170057658-170057680 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019851551 7:3563183-3563205 ATAGGAAAGGGGAAGTGGGATGG + Intronic
1020403670 7:7805834-7805856 ATGTGACAGTGACTGGGGGAAGG - Intronic
1021270980 7:18585241-18585263 AAGGGAAATGGGGTGGGGGAGGG - Intronic
1022264343 7:28739372-28739394 ATCTGAAAGGTGAGAGGGGAGGG + Intronic
1022347427 7:29530010-29530032 TTGGGTAGGGGGATGGGGGAGGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022645433 7:32224927-32224949 CTCTGGAAGGGGATGGGAGAAGG + Intronic
1022815720 7:33912394-33912416 GTTTGAAATGGGATGGGGAAGGG - Intronic
1023077468 7:36498366-36498388 TTGAGCCAGGGGATGGGGGATGG + Intergenic
1023095611 7:36656832-36656854 ATGTAAAAAGGCTTGGGGGAAGG + Intronic
1023996688 7:45162884-45162906 AGGAGTAAGGGCATGGGGGATGG - Intronic
1024554079 7:50588302-50588324 CTGGGAAATGGGATGGGGCAGGG + Intergenic
1024616338 7:51117074-51117096 TTGTGCAGGGGGAGGGGGGAGGG - Intronic
1024700501 7:51900413-51900435 ATGTGGAAGGGGACCGGAGAGGG + Intergenic
1025850107 7:65238042-65238064 ATGTGAAAGTGGGTGGGGGAGGG + Intergenic
1025935817 7:66035883-66035905 AAGGGAAGGGGGAAGGGGGAAGG + Intergenic
1026211459 7:68309620-68309642 ATATCAAAGGGGATGGGATAAGG + Intergenic
1026713069 7:72760256-72760278 AAGTGGCAGGGGTTGGGGGATGG + Intronic
1026814355 7:73498510-73498532 TTGTGAAAGAGGATGAAGGAAGG - Exonic
1026828395 7:73597370-73597392 ATGGGGAAGGGGGTGGGGGCTGG + Exonic
1027513733 7:79115093-79115115 ATGTGCAAGAGGATCGGGGGAGG + Intronic
1028089504 7:86680765-86680787 ATGTGAAATGGGAAGGGGCTGGG - Intronic
1028093080 7:86727316-86727338 ATATGAATGGGGCTGGGGTAGGG - Intronic
1028451810 7:90993606-90993628 ACGTGAAAGGGAGTGGGGTATGG + Intronic
1028742947 7:94297388-94297410 AGATGAAAGGGGATGGCTGAAGG - Intergenic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1030295490 7:107921851-107921873 ATGGACAAGGGGATGGGGGTGGG - Intronic
1030299162 7:107957894-107957916 ATGAGAAAGGGTATGGGAGAAGG - Intronic
1030537260 7:110784371-110784393 ATGTGGAAGGGGAGGGGAGGAGG - Intronic
1030885344 7:114929803-114929825 AGATGAAAGGAGATGGAGGAGGG + Intronic
1030998765 7:116390191-116390213 ATGTGTAAGGGAGTGGGGAAGGG + Intronic
1031317668 7:120275760-120275782 ATGGGAAATGGGATGGAGGTTGG + Intronic
1031355374 7:120781703-120781725 GTGGGAAAGGGGTTGGGGCATGG + Intergenic
1031595112 7:123640730-123640752 AGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1031866123 7:127039971-127039993 AGGGGAAAGGGGAAGGGGAAGGG + Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032129711 7:129218086-129218108 AGGTGTAAGAGGATGTGGGATGG - Intergenic
1032179698 7:129664124-129664146 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1032431829 7:131868303-131868325 AGGTGAAAGGGGACAGGAGAAGG + Intergenic
1032930225 7:136658113-136658135 ATGTGAAAGGGGATTTGTTAAGG + Intergenic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1033222919 7:139540500-139540522 AGGTGAAGGGGGTTGGGGGAAGG + Intronic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1034092705 7:148378849-148378871 AATTGAAAGGGAATCGGGGAAGG + Intronic
1034264255 7:149773516-149773538 ATGGGAGAGGGGGTGGAGGAGGG + Intergenic
1034350060 7:150409652-150409674 ATGTGATAGGAGCTGGGGCAGGG + Intronic
1034401166 7:150862557-150862579 ATGGGGATGGGGATGGGGCAAGG + Intergenic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034573215 7:151973758-151973780 ATGTGAAATGAGATTTGGGAGGG + Intronic
1034625183 7:152487244-152487266 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1034944924 7:155255659-155255681 AGGGGAAAGGGGAAGGGGAAGGG + Intergenic
1034993266 7:155561282-155561304 AAGAGAAAGGGGAATGGGGATGG + Intergenic
1035035483 7:155891582-155891604 ATGGTGAAGGGGATGGGGGTAGG + Intergenic
1035122454 7:156579666-156579688 ATGTGAGAGGGGATAGGCCAAGG + Intergenic
1035204807 7:157288343-157288365 ATGTGAGAGGGGGTAGGGGAAGG + Intergenic
1035220446 7:157403207-157403229 ATATGAGAGGGGGTAGGGGAAGG + Intronic
1035301974 7:157903262-157903284 ATGTGAGAGGGAATGTGAGAGGG + Intronic
1035435850 7:158858824-158858846 AGGGGAAAGGGGAGGGGGGAGGG - Intronic
1035435894 7:158858919-158858941 AAAGGAAAGGGGAGGGGGGAGGG - Intronic
1035451176 7:158977883-158977905 AGGTAGAAGGGGGTGGGGGATGG - Intergenic
1035911145 8:3567513-3567535 AGGGGGAAGGGGATGGGGGAGGG + Intronic
1036560262 8:9895802-9895824 ATTTTCAAGGGGCTGGGGGAAGG + Intergenic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1037778075 8:21848896-21848918 AGGTGGCAGGGGATGGGGAAAGG - Intergenic
1037811755 8:22090485-22090507 TTTTGACTGGGGATGGGGGAAGG - Intronic
1038575442 8:28700774-28700796 ATGGAACAGGGGATGGGGGTGGG - Intronic
1038631764 8:29252033-29252055 AAGGGAAGGGGGATGGGAGAAGG + Intronic
1039163429 8:34648770-34648792 AAGAGTAAGGGGTTGGGGGAAGG - Intergenic
1040506369 8:48052486-48052508 ATGATAAATGGGTTGGGGGAAGG - Intronic
1040913601 8:52545546-52545568 AGTTGAAGGGGGATGGGGGAGGG - Intronic
1041284829 8:56249539-56249561 AAGGGAAAGGGGAAGGGGAAGGG - Intergenic
1042020549 8:64369305-64369327 GGGAGAAAGGGGAGGGGGGAGGG + Intergenic
1042021258 8:64372763-64372785 ATGTGAAAGGGGGGAGGGGCAGG + Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042592791 8:70413918-70413940 ATCTAAAAGGGCATGGGGGTGGG - Intergenic
1042611926 8:70608897-70608919 ATGGGGACGGGGATGGGGGTGGG - Intronic
1043178205 8:77048142-77048164 GGGAGAAAGGGGAGGGGGGAGGG + Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043514903 8:80986796-80986818 AAGTGAATAGGGAGGGGGGAGGG + Intronic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044569068 8:93698203-93698225 ATGGGAATGGGGCTGGGGGAGGG + Intergenic
1045127123 8:99104556-99104578 AAGGGAGAGGGGAGGGGGGACGG - Intronic
1045319333 8:101069920-101069942 GTGTGCGAGGGGGTGGGGGAAGG + Intergenic
1045412083 8:101929535-101929557 AAAGGAAAGGGGAGGGGGGAGGG + Intronic
1045816257 8:106280558-106280580 GTTTGCAAGGGGATGGGTGATGG + Intronic
1046126074 8:109910226-109910248 AAGGGAAAGGGGAAGGGAGAGGG - Intergenic
1047701392 8:127452696-127452718 AGGAGAAAGGGGAAGGGAGAGGG + Intergenic
1047737550 8:127779849-127779871 ATTTGAATGGGGATGGGGAAGGG + Intergenic
1047875158 8:129128353-129128375 ATGTGGCAGGGGATGGGAGTTGG + Intergenic
1049404179 8:142444299-142444321 GAGAGGAAGGGGATGGGGGATGG + Intergenic
1049404183 8:142444306-142444328 AGGGGATGGGGGATGGGGGAAGG + Intergenic
1049526002 8:143127316-143127338 GAGTGGTAGGGGATGGGGGAAGG + Intergenic
1049712403 8:144071244-144071266 AGGGGAGAGGGGAGGGGGGAGGG - Intergenic
1049759423 8:144325388-144325410 ATGGGGAGGGGGTTGGGGGAGGG - Intronic
1050018332 9:1259326-1259348 ATTTGGTAGGGGATGAGGGAGGG - Intergenic
1050063789 9:1737730-1737752 CTGTGAAAGGGAATGCAGGAAGG + Intergenic
1050090408 9:2012822-2012844 ACTTGAAGGGTGATGGGGGAAGG + Intergenic
1051284600 9:15483347-15483369 ATGGTAAAGGGGGCGGGGGAGGG - Intronic
1051395144 9:16612370-16612392 ATGAGAAAGTGGCTGGGGAAGGG - Intronic
1051487335 9:17623075-17623097 ATAGGAAAGGGGAAGGGGAAGGG - Intronic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1052020916 9:23524471-23524493 ATGGGAAACGGGATGGGAGAGGG - Intergenic
1052383449 9:27796948-27796970 ACGTGAATAGAGATGGGGGAAGG + Intergenic
1052951838 9:34219771-34219793 ATGGGAAAGGGGAGAGGAGAAGG - Intronic
1053233812 9:36434310-36434332 AGGGGGAGGGGGATGGGGGAAGG + Intronic
1053340952 9:37330794-37330816 AAATGACAGGGGGTGGGGGAAGG - Intronic
1053612503 9:39729180-39729202 AGGTGAGAGGGGTTGGGGGTCGG + Intergenic
1053750909 9:41253903-41253925 AGGGGTAGGGGGATGGGGGAGGG - Intergenic
1054085750 9:60741976-60741998 AGGTGAGAGGGGTTGGGGGTCGG - Intergenic
1054241012 9:62613213-62613235 ATGTGAGAGGGGTTGGGGGTCGG - Intergenic
1054555144 9:66647737-66647759 AGGTGAGAGGGGTTGGGGGTCGG - Intergenic
1054983748 9:71237084-71237106 AAGGGAAGGGGGATGGGGAAAGG + Intronic
1055237703 9:74143876-74143898 ATGGGAATGGGGAAGGGAGATGG - Intergenic
1055791340 9:79926227-79926249 AGGAGAAAGGGGAAGGGAGAAGG + Intergenic
1056586450 9:87930549-87930571 ATGTTAAAGGTGGTGGGGGCTGG - Intergenic
1056604936 9:88077828-88077850 ATGGGAGAGGGGAGAGGGGAGGG + Intergenic
1056610429 9:88122393-88122415 ATGTTAAAGGTGGTGGGGGCTGG + Intergenic
1056969525 9:91190918-91190940 TTGTAAAAGGGGCTGGGGGGTGG - Intergenic
1057410189 9:94811018-94811040 ATGTGACAGGGGTAGGGGGCAGG - Intronic
1057454092 9:95191651-95191673 ATGAAAAAGGGGCTTGGGGATGG - Intronic
1057499093 9:95582599-95582621 GGGTGAGGGGGGATGGGGGAAGG + Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057876088 9:98755600-98755622 AGGAGAAGGGGGATGGGTGAGGG - Intronic
1058633793 9:107017155-107017177 ATGTAAAAGGGGATGTAGAAGGG - Intergenic
1059032744 9:110717434-110717456 AAGTGACAGAGGATGAGGGAAGG - Intronic
1059451146 9:114372166-114372188 CTGAGAGAGGGGTTGGGGGAGGG + Intronic
1059455156 9:114395702-114395724 AGGTGAAGGGTGTTGGGGGATGG - Intergenic
1059490806 9:114666018-114666040 AAGGGAAGGGGGAAGGGGGAAGG - Intergenic
1059517278 9:114907640-114907662 AAGGGAAAGGGGAGGAGGGAAGG - Intronic
1059563291 9:115356361-115356383 ATGTGAAAGATGAGGGGGTAAGG - Intronic
1060108581 9:120890653-120890675 ATTTCAAAGGGCATGGGGGAGGG + Intronic
1060190330 9:121588549-121588571 GGGTGAAGGGGGAAGGGGGAAGG + Intronic
1060206231 9:121684441-121684463 ATGTGATGGGGGCTGGGAGAAGG - Intronic
1060241383 9:121906668-121906690 AAGGGAAAGGGGAAAGGGGAAGG + Intronic
1060244101 9:121929518-121929540 ATGAAAAACGGGATGGGGAAGGG + Intronic
1060738056 9:126079202-126079224 ATGGGAAAGGGGTTGGGGTGTGG + Intergenic
1060861480 9:126958196-126958218 ATTTCAAGGGGAATGGGGGAGGG + Intronic
1061189168 9:129071633-129071655 ATGGGAAAGGGGTCTGGGGATGG + Exonic
1061590282 9:131593622-131593644 ATGCAAGAGGGGATGGGGCAAGG - Intronic
1061836480 9:133333143-133333165 ATGGGAAAGGCCATTGGGGAGGG - Intronic
1061945767 9:133907580-133907602 ATGTTTTAGGGGATGGGAGAAGG + Intronic
1062113422 9:134795185-134795207 ACGTGCCAGGGGCTGGGGGAAGG + Intronic
1185511628 X:668233-668255 ATGGGAAGGGGGAGGGGGAAAGG - Intergenic
1185540483 X:899381-899403 AAGTGGAAGGGGATGGGGAAGGG - Intergenic
1185640649 X:1588142-1588164 AGAGGAAAGGGGAGGGGGGAGGG - Intergenic
1185739848 X:2523033-2523055 ATGGGAAAGAGGCCGGGGGAAGG + Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1186250140 X:7656828-7656850 ACATGGCAGGGGATGGGGGAAGG + Intergenic
1186293228 X:8121853-8121875 AGGGGGGAGGGGATGGGGGAGGG - Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186732083 X:12420612-12420634 GTGTAAATGGGGATGGGGCAGGG - Intronic
1187036126 X:15541864-15541886 AAGTGAAAGAGGGTGGGGGTGGG + Intronic
1187608683 X:20915967-20915989 ATGAGAAATGAGATGGGGAAGGG + Intergenic
1187707088 X:22019678-22019700 ATGTGAAAAGAGAAAGGGGATGG + Intergenic
1187707090 X:22019685-22019707 AAGAGAAAGGGGATGGGCCAAGG + Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188668251 X:32851689-32851711 CTCTGCCAGGGGATGGGGGAGGG - Intronic
1188702033 X:33277121-33277143 ATGTGATATGGATTGGGGGAAGG - Intronic
1189117025 X:38353392-38353414 AAGGGAAAGGGGAAGGGGAAGGG + Intronic
1189208271 X:39260668-39260690 AGGTGTAAGGGGAAGGGGCATGG - Intergenic
1189758552 X:44297395-44297417 AGGGGAAAGGGGAAGGGGAAAGG + Intronic
1190089694 X:47427018-47427040 AAGGGAAGGGGGAAGGGGGACGG - Intergenic
1190298188 X:49040737-49040759 AGGGAAAGGGGGATGGGGGAAGG - Intronic
1190806330 X:53840945-53840967 AGGTGAAGGGGGAGTGGGGAGGG + Intergenic
1191086450 X:56572707-56572729 ATGTGAAATGTGATGGCAGAGGG + Intergenic
1191111193 X:56804057-56804079 ATGTGAAGGGGTATGGGGGAGGG + Intergenic
1192588685 X:72341290-72341312 ATGTGTCAGGGGATGAGGGTGGG + Intronic
1192656451 X:72999829-72999851 GTGTGAGAGGGGATAGAGGAAGG - Intergenic
1192665669 X:73083172-73083194 GTGTGAGAGGGGATAGAGGAAGG + Intergenic
1192728555 X:73778557-73778579 ATCTGAGAGGGGATGGAGGCAGG + Intergenic
1193898675 X:87147924-87147946 ATGTTAAAGTTGATGGTGGAAGG - Intergenic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194669148 X:96708534-96708556 ATGTCGCAGGGGGTGGGGGACGG - Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195316934 X:103688163-103688185 ATCAGAAAGGGGAGGGGGGAGGG - Intergenic
1195385836 X:104313035-104313057 ATATGAATGGGGGTGGGGGGTGG - Intergenic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195687060 X:107597058-107597080 ATGGGAAAAGGCATGGGGTATGG - Intronic
1195819945 X:108933845-108933867 ATGGGATGGGGGAGGGGGGAGGG - Intergenic
1196087862 X:111705905-111705927 TTGAGGAAGGGAATGGGGGAAGG - Intronic
1196287594 X:113900258-113900280 CAGTGAATGGGGATGGGGGTGGG - Intergenic
1196892584 X:120305691-120305713 AGGGGAGAGGGGATGGAGGAAGG + Intronic
1196900903 X:120381782-120381804 ATGTGAAGGGTGATTGGAGAAGG + Exonic
1197446256 X:126554151-126554173 TTGCAAAAAGGGATGGGGGAAGG - Intergenic
1197470786 X:126864241-126864263 GTGGGAAAGGGGTTGGGGCATGG - Intergenic
1197806465 X:130402778-130402800 AAGGGAAGGGGAATGGGGGAGGG - Intronic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1198219390 X:134585846-134585868 ATGTACAAGGAGTTGGGGGAGGG + Intronic
1198225657 X:134642665-134642687 AAGTGAAAGGGAAGGGGGAAAGG + Intronic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198517826 X:137427060-137427082 GGGAGGAAGGGGATGGGGGAGGG + Intergenic
1198613496 X:138428371-138428393 ATAGGAAAGGGGATGGAGTAAGG - Intergenic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199872731 X:151913237-151913259 ATGGGAATGGGGTTGCGGGATGG - Intronic
1199874305 X:151919306-151919328 ATGGGAAAGGGGAGGGGGTGGGG - Intronic
1199895097 X:152119869-152119891 ATGAGGGTGGGGATGGGGGAGGG + Intergenic
1199895127 X:152119966-152119988 ATGGGAATGGGGATGTGGTAGGG + Intergenic
1199947258 X:152679615-152679637 ATGGGAATGGGAATGGAGGAGGG - Intergenic
1199962422 X:152788839-152788861 ATGGGAATGGGAATGGAGGAGGG + Intergenic
1200042280 X:153379198-153379220 CAGTGAATGGGGGTGGGGGATGG + Intergenic
1201219927 Y:11758694-11758716 AGGGGAAAGGGAATGGGAGAGGG + Intergenic
1201276226 Y:12301281-12301303 ATGTGATGGGGGTTGGGGGTTGG - Intergenic
1201887705 Y:18903963-18903985 AGGTAAAAGGGGATGGAGGAAGG + Intergenic