ID: 1161391127

View in Genome Browser
Species Human (GRCh38)
Location 19:4020996-4021018
Sequence CTGGGAAACTACCCTTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161391127 Original CRISPR CTGGGAAACTACCCTTATAA AGG (reversed) Intronic
907121930 1:52015557-52015579 CTGGGAAATCACCTTTATTATGG + Intergenic
907416723 1:54319481-54319503 TTTGGAAATTTCCCTTATAAAGG - Intronic
911737905 1:101357742-101357764 CTGGGAAAATAGCATTATATTGG + Intergenic
919256014 1:195126194-195126216 CAGGGAAACTAACCTGAGAATGG + Intergenic
921709558 1:218360091-218360113 TTGGGAATCTACATTTATAAAGG - Intronic
922702861 1:227771871-227771893 CTGGGAAACTACCGGTGCAAAGG + Intronic
1067711961 10:48656766-48656788 CTGGGAAACTACGGTCACAAAGG + Intergenic
1072905669 10:99451018-99451040 CTGGGAAAATACCCTTGTACTGG - Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1083394430 11:62380205-62380227 GTGGGAACCTTCCCTTTTAATGG + Intronic
1087856086 11:103092917-103092939 CTGTGAAACTACCCTCACAATGG + Intergenic
1088692773 11:112342037-112342059 CTGGGAAAGAAGCCTGATAATGG - Intergenic
1088806895 11:113360727-113360749 CTGGGAAACCAGCCTTTCAAGGG + Intronic
1091667849 12:2432008-2432030 CTGGGGACCTGCCCTTAAAAGGG - Intronic
1092710606 12:11333176-11333198 CTGGGAATTTCCCCATATAAAGG + Intergenic
1098207740 12:68131251-68131273 CTGGGAAAATAGCCTCAAAAAGG - Intergenic
1098487124 12:71034431-71034453 CTGGGAAACAACCCATATTTTGG + Intergenic
1105309123 13:19190542-19190564 CTCTGAAACTACCCCTACAAAGG - Intergenic
1105528479 13:21197603-21197625 CTCTGAAACTACCCCTACAAAGG + Intergenic
1106045306 13:26134282-26134304 CTCTGACACTACCCTTATAGGGG + Intronic
1106344343 13:28861104-28861126 CTGGGAAACTGCCCCTGTAAGGG - Intronic
1107618291 13:42196221-42196243 CTGTGAAACTATTCTTAAAATGG - Intronic
1108746069 13:53395744-53395766 CTGGGAAATTATCCTTAGTATGG + Intergenic
1108821037 13:54350275-54350297 CTAGAAAACTACCCTGATTATGG + Intergenic
1108855728 13:54790672-54790694 CTGGAAAAATAACCATATAATGG + Intergenic
1109984082 13:69952750-69952772 TTGGGAAAGGACACTTATAATGG - Intronic
1110813003 13:79830927-79830949 CTTGGAAGCCACACTTATAAGGG - Intergenic
1125594971 15:40879044-40879066 CTGGGAAACTCCCCTCCTAAGGG + Intergenic
1127537768 15:59906428-59906450 TTGGGAATCTACATTTATAATGG + Intergenic
1145293105 17:21565487-21565509 CTGGGAAAGTTCCCTTATGAGGG + Intronic
1149954228 17:61028865-61028887 CTGGGAAAGTAACATTTTAAAGG - Intronic
1150272757 17:63877036-63877058 CTGGGGAAACACCTTTATAAGGG + Intronic
1150274099 17:63884795-63884817 CTGGGGAAACACCTTTATAAGGG + Intergenic
1150278412 17:63914329-63914351 CTGGGGAAACACCTTTATAAGGG + Intronic
1153053597 18:924339-924361 CTGGGAAACCAGCCTTTTATTGG + Intergenic
1156060527 18:33069453-33069475 CTGGGAAACTAGACTTCTATAGG + Intronic
1159188391 18:65009094-65009116 CTAGGAAAGTACCACTATAAAGG + Intergenic
1159856179 18:73591583-73591605 CTAGGAAACTACCCGGAGAAAGG - Intergenic
1161391127 19:4020996-4021018 CTGGGAAACTACCCTTATAAAGG - Intronic
1167572923 19:50301207-50301229 CTGGGAATCTGCACTTATAACGG - Intronic
926315987 2:11710133-11710155 TTGGATTACTACCCTTATAAGGG - Intronic
926739104 2:16096302-16096324 CTGGTAAACTCTCCTTATACTGG - Intergenic
928427346 2:31190027-31190049 CAGGGAAAACACCCTTGTAAAGG + Intronic
928539269 2:32269190-32269212 CTGGGAAACTGCCCAAATACTGG - Intergenic
929625434 2:43402086-43402108 CTGGGAAACTCCCCCCACAAGGG - Intronic
937796505 2:126028901-126028923 CTCAAAAACTACCCTTGTAAAGG - Intergenic
939294699 2:140245502-140245524 TTGAGAAACTACCATTAAAAAGG + Intronic
940026649 2:149215464-149215486 CTGGGAAGCCTCCCTGATAAAGG + Intergenic
1168752348 20:291738-291760 CTGGGATACTACAATGATAAAGG - Intergenic
1169656113 20:7925045-7925067 CAGGGGAACTACCATCATAAAGG + Intronic
1172832635 20:37848983-37849005 CTGGTAAACTGCCCTAATATGGG - Intronic
1174653528 20:52150414-52150436 CTGGGAAACTTCCATTGTCATGG - Intronic
953935912 3:47042482-47042504 CTGTAAAACTCCCCTTATAGTGG + Intronic
954942126 3:54383200-54383222 CTCTGAAAGTACTCTTATAAAGG - Intronic
961669387 3:128517923-128517945 CTGGGAGGCTACCCTCCTAAGGG - Intergenic
962586227 3:136844932-136844954 ATGACAAACTACCCTTATACAGG - Intronic
962839907 3:139223947-139223969 CTGGGAAACTCCTATTATGATGG + Intronic
967653499 3:192016373-192016395 CTGGGAAAGTAGCCTGAAAATGG + Intergenic
967781034 3:193439850-193439872 CTGAGAAGCTAGCCTGATAACGG + Intronic
976224109 4:82781626-82781648 CTGGGCCACTACCCTTATGAAGG + Intronic
980874115 4:138643407-138643429 CTTGAAAACTACCCTAAAAATGG + Intergenic
983853535 4:172613128-172613150 CTGGGAAATAAGCCCTATAAAGG - Intronic
991433939 5:66576897-66576919 CTGGGAAACTGCAGTTAAAATGG + Intergenic
992573823 5:78090502-78090524 CTGGCAAGCTACCCTTTAAAAGG + Intronic
994294554 5:98075386-98075408 CTGGGAAATTAACCTTTGAAAGG - Intergenic
994519960 5:100821419-100821441 TTGGGAAACTAACCTCATATAGG - Intronic
995664002 5:114520361-114520383 CTGGAAAACAACCCTAAAAATGG + Intergenic
996421303 5:123265921-123265943 CTGGGAAAATACTTTTATTATGG - Intergenic
999461938 5:151764742-151764764 CTAGCAAACTACCCTCAGAAAGG + Intronic
1003415273 6:5902009-5902031 CTGAGAAGCTTCCCTTATAAGGG - Intergenic
1005688853 6:28282142-28282164 TTGGGAATTTACCCTTAGAAGGG + Intronic
1006996238 6:38264008-38264030 GTGGGAAACCTCCCTTATGATGG + Intronic
1010009447 6:71033312-71033334 CTAGGAAACTACACTTGTTAGGG + Intergenic
1011528283 6:88290762-88290784 CTGTGAAACTACCCTGGCAAAGG - Intergenic
1012564238 6:100626339-100626361 CTGGGAAACAAGGTTTATAATGG + Intronic
1021209702 7:17832935-17832957 CTGGGAGACTTCCATAATAAAGG + Intronic
1028870500 7:95766332-95766354 CTTGGAAATTACCTTTATACAGG + Intergenic
1033576296 7:142688343-142688365 CTAGGAAACTACCTTTAGAGAGG - Intergenic
1037698004 8:21244295-21244317 CTGGGAAAATACCCTCTTGAAGG + Intergenic
1044830946 8:96248133-96248155 CTGGAAAACAACCCCTATGAAGG + Intronic
1051274015 9:15381768-15381790 CTGGGAAACACCATTTATAAAGG + Intergenic
1051713742 9:19959887-19959909 CAGGGAGGCTACCCTTAGAAAGG + Intergenic
1052889865 9:33688581-33688603 CTAGGAAACTACCTTTAGAGAGG - Intergenic
1056280720 9:85038811-85038833 CTGGGAAAATAACTTTTTAAGGG + Intergenic
1061224154 9:129270978-129271000 CAGAGAAACCACCCTTACAAGGG - Intergenic
1197528881 X:127598308-127598330 CTTGGAATCTACACATATAATGG + Intergenic
1198607521 X:138357927-138357949 CTGGCCATGTACCCTTATAATGG - Intergenic