ID: 1161396175

View in Genome Browser
Species Human (GRCh38)
Location 19:4045951-4045973
Sequence GTCACCCACCTCAGCAGGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161396169_1161396175 -3 Left 1161396169 19:4045931-4045953 CCTGGAGGTGGGGGGCCCCTGTC 0: 1
1: 0
2: 10
3: 242
4: 3530
Right 1161396175 19:4045951-4045973 GTCACCCACCTCAGCAGGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 153
1161396168_1161396175 -2 Left 1161396168 19:4045930-4045952 CCCTGGAGGTGGGGGGCCCCTGT 0: 1
1: 0
2: 5
3: 51
4: 470
Right 1161396175 19:4045951-4045973 GTCACCCACCTCAGCAGGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161396175 Original CRISPR GTCACCCACCTCAGCAGGGT AGG Exonic
900098294 1:949322-949344 GACACCCCACTCAGCAGGGGTGG + Intronic
900619101 1:3578835-3578857 GTCACCCAGCTCAGAACGCTGGG + Intronic
901775856 1:11560129-11560151 CTCACCCCCCTCACCAGGGCGGG + Intergenic
901879650 1:12186205-12186227 GTCTCCCACCTCAGCCTGGCAGG - Intronic
904858686 1:33519170-33519192 GTCACACAGCTCAGAAGGGGTGG - Intronic
904989838 1:34583390-34583412 GCCACTCACCTCAGCAGGCGGGG + Intergenic
905394826 1:37660587-37660609 GTCTCCCTCCCCAGGAGGGTCGG - Intergenic
905861511 1:41355127-41355149 GTCAGCCACTTCTGCAGGGCTGG + Intergenic
906530934 1:46523632-46523654 TCCACCCAACCCAGCAGGGTGGG - Intergenic
907158094 1:52352788-52352810 GACACCACCCTCAGCAGGGGAGG + Exonic
911902468 1:103523689-103523711 GTCATCCTCCTCAGCCGAGTGGG - Intergenic
915749758 1:158195622-158195644 GTCAGCCACCTCAGTAAAGTTGG - Intergenic
915754868 1:158249904-158249926 GTCACCCATCTGTGGAGGGTTGG - Intergenic
916053878 1:161054357-161054379 GGCACCTACCTCAGCAGGTTGGG + Exonic
917300839 1:173572313-173572335 ATCCCCCACCTCATCAGAGTGGG - Intronic
918076310 1:181173894-181173916 AGGTCCCACCTCAGCAGGGTGGG + Intergenic
922725478 1:227921048-227921070 CTCACCCTGCACAGCAGGGTTGG + Exonic
922866135 1:228862985-228863007 GTCACTCATCCCAGCAAGGTGGG + Intergenic
923126030 1:231035335-231035357 GTCTCCCACCTGTGCAGAGTGGG - Intronic
1069118617 10:64539381-64539403 GTCTCCCTTCTCTGCAGGGTAGG - Intergenic
1069992504 10:72323970-72323992 GTCGCCCAGCTCAGCGGTGTCGG - Intergenic
1070551858 10:77496213-77496235 GTCACCCTCCTCACCAGGTGCGG + Intronic
1071574341 10:86714995-86715017 CTCACCCAGCTCTGAAGGGTGGG + Intronic
1073057784 10:100713394-100713416 GGCAGCCAGCTTAGCAGGGTAGG + Intergenic
1075133677 10:119763255-119763277 GGCCCCCACCTCAGCAGGTCTGG - Intronic
1075599875 10:123759696-123759718 GTCACCAGCTTCAGCAGGGAAGG + Intronic
1076629216 10:131842444-131842466 CTCACCCACCTCCCCAGGTTGGG + Intergenic
1077005111 11:351338-351360 GAGACCCACCTTAGGAGGGTTGG - Intergenic
1077206255 11:1346282-1346304 CTCACCCACCCCAGCAGCGCGGG - Intergenic
1078188181 11:9069970-9069992 CACACTCACCTCAGAAGGGTGGG - Intronic
1081586080 11:44384815-44384837 GGCACCCACCTGGGCAGAGTGGG + Intergenic
1083200491 11:61118467-61118489 GTTACCCACCTAAGCAGGTCAGG - Exonic
1083305831 11:61761542-61761564 GGCACACAGCTCAGCAGGGCAGG + Intronic
1083410707 11:62490481-62490503 GTCAGCCACCGCACCAGGCTGGG + Intronic
1084509556 11:69594761-69594783 GTCAACCACCTCTGCTGGGAAGG - Intergenic
1084742455 11:71148456-71148478 ATCCCCCACCTCTGCAGGGCAGG + Intronic
1085039710 11:73319790-73319812 CTCACCCACCTCAGGAGGCTAGG - Intronic
1085810923 11:79680295-79680317 GGCAACCACCACAGCAGGGAAGG - Intergenic
1088741846 11:112773924-112773946 AGCACCCACCTCAGCAGGACAGG + Intergenic
1089542818 11:119200578-119200600 TCCTCCCACCTCAGCATGGTGGG + Intergenic
1089964556 11:122645207-122645229 TCCAGCCACCTCAGCTGGGTTGG + Intergenic
1089973563 11:122713397-122713419 CTCACCCACCTGAGGAAGGTGGG + Intronic
1096513825 12:52145746-52145768 ATCCCCCACCTCCGCAGGGCAGG + Intergenic
1096602588 12:52740538-52740560 TTTCCCCACCACAGCAGGGTGGG + Intergenic
1100505669 12:95217815-95217837 GCCACCCGCCTCAGCACGATGGG - Exonic
1103573624 12:121860647-121860669 GGAACCCACCTCTGCATGGTCGG - Intronic
1104405024 12:128510058-128510080 GTCACCAGCCTCAGGAGTGTTGG - Intronic
1106567064 13:30895453-30895475 GTCACCCAGGGCAGCTGGGTTGG - Intergenic
1114538546 14:23438169-23438191 CCCACCCACCCCAGCATGGTGGG - Intergenic
1114690360 14:24574851-24574873 GTCCACCAGCTCTGCAGGGTAGG + Intronic
1119427298 14:74544017-74544039 GACACCCACCCCTGCTGGGTTGG + Intronic
1120339351 14:83199486-83199508 GTCATCCGCCTCAGAAAGGTTGG + Intergenic
1122554881 14:102572948-102572970 GTCAGCCACCACAGCTGGCTGGG + Intergenic
1128635481 15:69299563-69299585 GGCACCCACTTCAACAGGGCCGG - Intronic
1129223816 15:74153728-74153750 GACACCCACATCATCAAGGTTGG - Intergenic
1129473392 15:75767287-75767309 TTCAGGCACCTCAGCAGGTTTGG + Intergenic
1130395688 15:83499083-83499105 ATCCCCCACCTCAGCAGGTGGGG - Intronic
1132674802 16:1117153-1117175 GGGACCCACCTCGGCAGGGGTGG - Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1135381040 16:21996354-21996376 ATCACCCACCTCATCAGGAAGGG - Intronic
1138785814 16:59844948-59844970 GCCACCCAACTCAGCATGATAGG - Intergenic
1141499018 16:84430906-84430928 CCCCCCCACCTCAGCAGGATGGG + Intronic
1144955331 17:19016286-19016308 TTCATCCACCTCAGCGGGCTGGG + Intronic
1148774370 17:50087441-50087463 GTCACACAGCTCATCAGGGAAGG + Intronic
1151578591 17:74964884-74964906 GTCACACACCTCCTCAGGGGTGG - Intronic
1152400741 17:80064961-80064983 GTGAAACACCTCTGCAGGGTTGG - Intronic
1152590550 17:81209387-81209409 GTCTCCTCCGTCAGCAGGGTGGG + Intronic
1156244513 18:35284663-35284685 CACCCCCACCTCAGCAGGCTTGG - Intronic
1156789747 18:40956404-40956426 GCCATCCACCTCAGCAGGTCAGG - Intergenic
1160354404 18:78214838-78214860 TCAACCCACTTCAGCAGGGTTGG - Intergenic
1160940618 19:1618955-1618977 GTCAGCAACTTCAGGAGGGTGGG - Intronic
1161057443 19:2197828-2197850 CCCACCCTCCGCAGCAGGGTTGG - Intronic
1161396175 19:4045951-4045973 GTCACCCACCTCAGCAGGGTAGG + Exonic
1162033410 19:7926860-7926882 GACTCCCCCCACAGCAGGGTGGG - Exonic
1162485689 19:10959362-10959384 GTGAGCCACCTCACCTGGGTGGG - Intergenic
1162514992 19:11142518-11142540 TACTCCCACCTCAGCAGGGCTGG + Intronic
1163527373 19:17830099-17830121 GGCGCTCACCTCAGCAGGGCAGG + Exonic
1164902816 19:31942406-31942428 GTCACACAGCTCAGCAGTGCTGG + Intergenic
1167082970 19:47289942-47289964 GCCTCCTACCTCAGTAGGGTAGG + Intergenic
925001022 2:402948-402970 CTCACACACCTCAGCAGTGATGG + Intergenic
927206152 2:20611806-20611828 ATCACCCTGCTCAGCAGCGTGGG + Intronic
927318646 2:21716974-21716996 GATACCCACCTCAGCATGGCAGG + Intergenic
927412652 2:22844726-22844748 GGCACCCATGTCAGCAGGGGTGG - Intergenic
929581431 2:43083879-43083901 TTCTCCCTCCCCAGCAGGGTGGG - Intergenic
932366032 2:71154146-71154168 GGCAGCCACCTCACCAGGGGAGG + Intergenic
933658077 2:84905581-84905603 CTCACCCGCCGCAGCAGGGGCGG - Intronic
937104037 2:119293937-119293959 ATCAGCCACCTCACCAGGGATGG + Intergenic
937482130 2:122272760-122272782 GACACCCACCTCCCCAGGGAGGG + Intergenic
943121119 2:183737298-183737320 GTGAGCCACCACAGCAGGCTTGG + Intergenic
945843500 2:214915876-214915898 GTCACCCAGTTCACCAGAGTGGG - Intergenic
947946707 2:234109675-234109697 GCCACCGACTTCATCAGGGTTGG + Intergenic
948171464 2:235906673-235906695 CTCACCCACCTGACCATGGTTGG + Intronic
948639844 2:239368692-239368714 GTCTCCCACCTCACCTGGGCAGG - Intronic
1171402075 20:24880179-24880201 CCCAGCCTCCTCAGCAGGGTGGG - Intergenic
1176018841 20:62952603-62952625 GGGACCGACGTCAGCAGGGTGGG + Intergenic
1176049584 20:63110817-63110839 GCCACCTGCCTCTGCAGGGTGGG + Intergenic
1176270792 20:64234825-64234847 GTCACCCACCACAGCCAGCTCGG - Intronic
1176270944 20:64235300-64235322 GTCACCCACCACAGCCAGCTCGG - Intronic
1176271041 20:64235607-64235629 GTCACCCACCACAGCCAGCTCGG - Intronic
1177720761 21:24903780-24903802 GTCAGCCACAACAACAGGGTAGG - Intergenic
1179165881 21:38934762-38934784 GTGAGCCACCTCACCAGGCTGGG + Intergenic
1180618140 22:17141922-17141944 GTAAAGCACCTCAGCAGGGGCGG - Intronic
1181652651 22:24269340-24269362 GTCAGCCACCTCAGTAGAATTGG - Intergenic
1182686970 22:32128521-32128543 GTCACACAACTCATCAGTGTTGG + Intergenic
1182755392 22:32674992-32675014 GTCACACACCTCAGCTGTGCCGG + Intronic
1183209168 22:36439948-36439970 CTCACCCACCCCTGCAGGCTGGG - Intergenic
1183358419 22:37371387-37371409 GCCACCCACCTCAGCTTGGGGGG - Exonic
1184192865 22:42906584-42906606 GTCACCCACCAAAGAAGGGCAGG + Intronic
1184820001 22:46903173-46903195 GTCACAGACCTCAGCCTGGTGGG + Intronic
953366578 3:42350689-42350711 ACCACCCACCTCAGCAGTGAGGG - Intergenic
954367954 3:50156040-50156062 GTCTCCCACATCAGCAGAGTGGG + Intronic
954414603 3:50387082-50387104 GTCACCCACCTCAGAAGTGGTGG - Intronic
960567226 3:119146464-119146486 GTCAGAAACATCAGCAGGGTTGG - Exonic
961191712 3:124967939-124967961 GTCACACACTGCAGCAGGGAAGG - Exonic
962231924 3:133673888-133673910 GTCACAGACCTGAGCAGGATCGG + Intergenic
969576238 4:8037755-8037777 GGGACACCCCTCAGCAGGGTCGG + Intronic
970184162 4:13431406-13431428 CTCACCAACCCCATCAGGGTGGG + Intronic
973267308 4:48223763-48223785 GTGAGCCACCTCATCAGTGTTGG - Intronic
975438320 4:74380227-74380249 GTCAGCCTCCTCCGCAGGTTTGG + Intronic
978149448 4:105415532-105415554 CCCACCCACCTCTGCAGGCTCGG - Intronic
985998117 5:3608568-3608590 GTCACCTTGCTCAGCAGAGTGGG - Intergenic
988450359 5:31336212-31336234 GTCATCCAGCTGTGCAGGGTAGG + Intergenic
990611103 5:57457697-57457719 TTCCCCCACCCCAGCAGAGTCGG - Intergenic
991687322 5:69193507-69193529 TCCTCCCACCTCAGCTGGGTGGG - Intronic
993535008 5:89073139-89073161 GCCACCCACATCAGCAGCATGGG + Intergenic
998135802 5:139673929-139673951 GGCACCCACCCCAGCAGGAGGGG + Intronic
998390671 5:141785243-141785265 AGCAGCCACCTCGGCAGGGTTGG + Intergenic
1001586543 5:172836686-172836708 GCCACCCACCTCCTCACGGTGGG - Intronic
1002185516 5:177453046-177453068 GTCACACAGCTCAGAAGGGGAGG - Intronic
1003354321 6:5352403-5352425 GCCACACACCTGAGCAGAGTGGG - Intronic
1006468773 6:34213511-34213533 GTGAGCCACCTCACCAGGCTGGG + Intergenic
1006980474 6:38143773-38143795 GTCAGCCAACTCAGCAAGCTGGG + Intronic
1012258437 6:97060668-97060690 GTCACCAATCCAAGCAGGGTTGG - Intronic
1013289238 6:108706511-108706533 GTAATGCACCTCATCAGGGTAGG + Intergenic
1014377925 6:120700153-120700175 GTCCCACACCGCAGCAGGATGGG + Intergenic
1021021217 7:15600320-15600342 GCCCCCCACCTCAGCAGGTTTGG - Intergenic
1022208545 7:28185955-28185977 GGCATCCAGCTCAGCAGGGAAGG - Intergenic
1024250329 7:47501414-47501436 GTCCCCACCTTCAGCAGGGTTGG - Intronic
1026776087 7:73231835-73231857 GTCCCCCTCCACAGCAGTGTAGG - Intergenic
1027016944 7:74785206-74785228 GTCCCCCTCCACAGCAGTGTAGG - Exonic
1027071083 7:75160730-75160752 GTCCCCCTCCACAGCAGTGTAGG + Intergenic
1035231644 7:157469270-157469292 CTCACACACCTCAGCCTGGTTGG + Intergenic
1037837100 8:22220862-22220884 GAGACCCAGCTCAGCAGGGAGGG + Exonic
1042493784 8:69433490-69433512 GGGACCCATCCCAGCAGGGTGGG + Intergenic
1045706980 8:104935513-104935535 GTCACCCACATCATCAAAGTTGG - Intronic
1048470498 8:134700303-134700325 GTCCCCCACCTCAGAAATGTGGG - Intronic
1048899488 8:139023986-139024008 GTGTCCCTCCTCACCAGGGTGGG - Intergenic
1049102690 8:140590608-140590630 GTCACCCACCTCCACAGGGGAGG + Intronic
1050536147 9:6632701-6632723 GTGACCCGCCTCAGGAGGCTGGG - Intronic
1050705822 9:8395782-8395804 CTCAGCCTCCTCAGCAGTGTGGG - Intronic
1055023039 9:71690502-71690524 GTCACCCAGCTTAGCTGAGTGGG - Intronic
1062730137 9:138104060-138104082 GTCAGCCAGCACAGCTGGGTGGG - Intronic
1185475016 X:410066-410088 GTGAGCCACCGCAGCAGGCTGGG + Intergenic
1185908739 X:3962765-3962787 TTTCCCAACCTCAGCAGGGTAGG - Intergenic
1185908762 X:3962958-3962980 TTTCCCAACCTCAGCAGGGTAGG - Intergenic
1189232186 X:39461159-39461181 CTCTCCCACCTCTGCAGGATAGG - Intergenic
1189975444 X:46457212-46457234 GCCACCCACTTCAGCACGATGGG + Intronic
1195504631 X:105643145-105643167 ATCACCCACCTCAGCCCTGTAGG - Intronic
1195953928 X:110308514-110308536 ATCACCCACCTCATTAGTGTCGG + Intronic
1196891247 X:120292790-120292812 TTCTCCCACCTCAACAGGCTAGG + Intronic