ID: 1161397304

View in Genome Browser
Species Human (GRCh38)
Location 19:4051678-4051700
Sequence CAGCCCGGAGACCTTGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 77}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397304_1161397311 4 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397311 19:4051705-4051727 GCCCAGATCTGGCACAGGGCCGG 0: 1
1: 0
2: 4
3: 47
4: 381
1161397304_1161397315 6 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397315 19:4051707-4051729 CCAGATCTGGCACAGGGCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 187
1161397304_1161397307 -7 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397307 19:4051694-4051716 CGGGCTGCCTTGCCCAGATCTGG 0: 1
1: 0
2: 0
3: 10
4: 111
1161397304_1161397319 21 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397319 19:4051722-4051744 GGCCGGGGTCACAGAGGGGATGG 0: 1
1: 0
2: 4
3: 50
4: 479
1161397304_1161397310 0 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397310 19:4051701-4051723 CCTTGCCCAGATCTGGCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 262
1161397304_1161397316 15 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397316 19:4051716-4051738 GCACAGGGCCGGGGTCACAGAGG 0: 1
1: 1
2: 3
3: 47
4: 430
1161397304_1161397308 -1 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397308 19:4051700-4051722 GCCTTGCCCAGATCTGGCACAGG 0: 1
1: 0
2: 1
3: 23
4: 201
1161397304_1161397318 17 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397318 19:4051718-4051740 ACAGGGCCGGGGTCACAGAGGGG 0: 1
1: 0
2: 2
3: 17
4: 284
1161397304_1161397317 16 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397317 19:4051717-4051739 CACAGGGCCGGGGTCACAGAGGG 0: 1
1: 0
2: 5
3: 39
4: 446
1161397304_1161397313 5 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397313 19:4051706-4051728 CCCAGATCTGGCACAGGGCCGGG 0: 1
1: 1
2: 9
3: 52
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397304 Original CRISPR CAGCCCGGAGACCTTGCCGT GGG (reversed) Intronic
900310171 1:2029731-2029753 CGGCCTGGAGACCTTGACCTTGG - Exonic
901205947 1:7496033-7496055 CAGCCCAGAGAGCTGGCCCTGGG - Intronic
901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG + Exonic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906640691 1:47438929-47438951 CAGCCCGTAGCCGTAGCCGTAGG - Exonic
908872945 1:68635363-68635385 CAGCCCAGTAACCTTGCTGTTGG + Intergenic
913967326 1:143387889-143387911 CAGCCCGAAGACTTTGTGGTGGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
920703844 1:208237486-208237508 CACCCTGGAGTCCTTGCCGTAGG + Intronic
922570445 1:226631636-226631658 CAGCCCTGAGACCTGGCTGAGGG - Intergenic
1071595788 10:86922947-86922969 CAGGCCTGAGACCTTCCCTTAGG - Intronic
1083811392 11:65108698-65108720 CCGCCCGGAGACCCTGCAGGTGG - Exonic
1088651857 11:111964623-111964645 CATCCCGGAGATCTTGTCGCAGG - Exonic
1089735418 11:120547298-120547320 AAGGCCAGAGACCTTGCCTTGGG + Intronic
1090832298 11:130428089-130428111 CAGCACGAAGCCCTTGCCGAAGG + Exonic
1091321854 11:134657388-134657410 CAGCCCGGAGACCAGCCCGCAGG + Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG + Intronic
1119383234 14:74241420-74241442 CTGCCCGGGGGCCTTGGCGTCGG + Intronic
1120953200 14:90061107-90061129 CGGCCAGGAGACCTTGACCTTGG - Intergenic
1121449404 14:93997883-93997905 CAGCCCGAAGACCTTGGACTTGG + Intergenic
1122156276 14:99752354-99752376 CCGCCCGGCGACCCTGGCGTTGG - Intronic
1122193661 14:100068361-100068383 CAGCTCGCAGGCTTTGCCGTTGG - Intronic
1123051930 14:105548127-105548149 CAGGCCGGAGCCCATGCCGGCGG - Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1136516828 16:30773481-30773503 CTGGCCAGAGACCCTGCCGTGGG - Intronic
1138023347 16:53503582-53503604 CACCACGGAGACCTTCCCGGAGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1141863491 16:86733940-86733962 CCGCCCTGACACCTTGACGTTGG - Intergenic
1142058663 16:88015972-88015994 GAGTCCGGGGACCTTGCAGTGGG + Intronic
1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG + Intergenic
1145394982 17:22487656-22487678 CAGCCTGGAGAGCTTGCCCAGGG - Intergenic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152596721 17:81241453-81241475 AAGCCTGCAGACCTTGCTGTGGG + Intergenic
1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG + Intergenic
1160825257 19:1077212-1077234 GAGCCCGGAGACGCTCCCGTGGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1165923799 19:39314799-39314821 CAACCTGGAGGCCCTGCCGTGGG - Exonic
1166734386 19:45075791-45075813 CTGCCTGCAGACCTTCCCGTTGG - Exonic
1168340659 19:55621469-55621491 CAGCCCGTGGGCCTTGCCTTTGG + Exonic
1202701112 1_KI270712v1_random:165383-165405 CAGCCCGAAGACTTTGTGGTGGG - Intergenic
925154363 2:1638568-1638590 CAGCCAGGTGACCTTGCTGGAGG - Intronic
925190282 2:1876681-1876703 CAGTCCGGAGCCCTGGCAGTGGG - Intronic
927503683 2:23599170-23599192 CAGCCCAGAGTCCTTGCCGCAGG - Intronic
934172039 2:89548859-89548881 CAGCCCGAAGACTTTGTGGTGGG - Intergenic
934282347 2:91623176-91623198 CAGCCCGAAGACTTTGTGGTGGG - Intergenic
936145210 2:109976118-109976140 CAGCCCGGAGAGCTTGCCCAAGG - Intergenic
936199475 2:110395360-110395382 CAGCCCGGAGAGCTTGCCCAAGG + Intergenic
938722059 2:134076025-134076047 CAGACAGGAGACCCTGCAGTAGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG + Intronic
1176195003 20:63832662-63832684 CATCCCGGCGACCTTGGCGAGGG - Intergenic
1176300172 21:5095581-5095603 CAGCCTGGAGTCCTGGCCATGGG - Intergenic
1179667010 21:42919903-42919925 CTGCCCGGGTACCTTGCCCTGGG + Intergenic
1179789293 21:43747196-43747218 CAGCCCACAGACCTGGACGTCGG + Intronic
1179856850 21:44166330-44166352 CAGCCTGGAGTCCTGGCCATGGG + Intergenic
1185050958 22:48553705-48553727 CAGCCCGGAGAGAGAGCCGTGGG - Intronic
951908086 3:27722774-27722796 CAGCCCGGAGACCCTCCTATTGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
962880587 3:139572903-139572925 AAGTCGGGAGACCCTGCCGTAGG + Intronic
965466283 3:169034548-169034570 CAGCCCTGAGACATTCCCTTAGG - Intergenic
969100186 4:4762830-4762852 CAGCCCGGTGACTTTGGCCTGGG + Intergenic
970116349 4:12700736-12700758 CAGCCCTGATATCTTGCCTTGGG - Intergenic
978566654 4:110089795-110089817 CAGCCCTGAGGTCTTTCCGTTGG - Intronic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
990492074 5:56312349-56312371 CAGCCCTGAGTCCTTGCCTGAGG + Intergenic
992005669 5:72475192-72475214 CAGCCTGAAGACCTTCCTGTAGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
1019526987 7:1484920-1484942 CAGCACAGAGACCCTGCCCTGGG - Intronic
1019810899 7:3164495-3164517 CAGCCCGGAGACCTTTCCAGAGG + Intronic
1020248246 7:6447439-6447461 CAGCGCCGAGACCTGGCCCTGGG - Intronic
1035083071 7:156233528-156233550 CAGCCCCAAGACCTTGCAGGCGG + Intergenic
1037384001 8:18318150-18318172 CAGGCAGGGGACCTTCCCGTAGG + Intergenic
1041472404 8:58225365-58225387 CAGCCCTGAGACCTTGGCAGTGG - Intergenic
1041477109 8:58278827-58278849 CAGCCAGAAGTCCTTGCCCTGGG - Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1050903420 9:10974528-10974550 CAGCGCTGAGAACTTGCCGGAGG - Intergenic
1051665529 9:19464430-19464452 CAGCCTGGAGACCTTTCCCCTGG - Intergenic
1057253420 9:93522917-93522939 CAGCACTGAGACCTAGCTGTTGG + Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG + Exonic