ID: 1161397307

View in Genome Browser
Species Human (GRCh38)
Location 19:4051694-4051716
Sequence CGGGCTGCCTTGCCCAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397297_1161397307 28 Left 1161397297 19:4051643-4051665 CCAGGCCTCTGGTTTACTGATCA 0: 1
1: 0
2: 2
3: 17
4: 157
Right 1161397307 19:4051694-4051716 CGGGCTGCCTTGCCCAGATCTGG 0: 1
1: 0
2: 0
3: 10
4: 111
1161397305_1161397307 -8 Left 1161397305 19:4051679-4051701 CCACGGCAAGGTCTCCGGGCTGC 0: 1
1: 0
2: 1
3: 14
4: 94
Right 1161397307 19:4051694-4051716 CGGGCTGCCTTGCCCAGATCTGG 0: 1
1: 0
2: 0
3: 10
4: 111
1161397304_1161397307 -7 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397307 19:4051694-4051716 CGGGCTGCCTTGCCCAGATCTGG 0: 1
1: 0
2: 0
3: 10
4: 111
1161397298_1161397307 23 Left 1161397298 19:4051648-4051670 CCTCTGGTTTACTGATCACCTTC 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1161397307 19:4051694-4051716 CGGGCTGCCTTGCCCAGATCTGG 0: 1
1: 0
2: 0
3: 10
4: 111
1161397300_1161397307 5 Left 1161397300 19:4051666-4051688 CCTTCTGCAAAGCCCACGGCAAG 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1161397307 19:4051694-4051716 CGGGCTGCCTTGCCCAGATCTGG 0: 1
1: 0
2: 0
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397307 Original CRISPR CGGGCTGCCTTGCCCAGATC TGG Intronic
900399327 1:2466590-2466612 CTGCCTGCCCTGCCCACATCCGG + Intronic
902370880 1:16006135-16006157 GGGGATGCCTTGCCCAGGCCAGG + Exonic
904442892 1:30543187-30543209 CTGTCTGTCTTGCCCAGGTCTGG + Intergenic
904492681 1:30870527-30870549 TGGACTGCCTTGCCCCGGTCAGG + Intronic
906642421 1:47449481-47449503 CGGGAAGCCTTGCCCGGATGAGG + Intergenic
912459915 1:109823761-109823783 CAGACTTCCTTGCCGAGATCAGG - Intergenic
915716343 1:157948609-157948631 CTGGCTGCCTTACTCAGAGCTGG - Intergenic
924468181 1:244316436-244316458 AGGTCTGCTTTGCCCAGGTCGGG - Intergenic
1066406081 10:35119858-35119880 CAGGCCACCTTGCCCAGCTCAGG + Intergenic
1067691430 10:48504563-48504585 CTGGCTTTCTTGCACAGATCTGG + Intronic
1069761432 10:70814312-70814334 TGGCCTGACTTGCCCAGATCAGG - Intergenic
1070722129 10:78764202-78764224 CAGGCAGCCTTGCCCACAGCAGG + Intergenic
1072191577 10:93080609-93080631 CAGGCAGCCTTGACCAGACCTGG - Intergenic
1074156574 10:110805377-110805399 AGGGCTGCCTTGACAGGATCTGG + Intronic
1074306160 10:112280503-112280525 CCTGGTGCCTTGCCCTGATCGGG + Intergenic
1074609045 10:115003894-115003916 AGAGCTGCCTTACCCAGACCAGG + Intergenic
1075801635 10:125158635-125158657 CGGGCTTCCTTGCCCTGTCCGGG - Intronic
1076186090 10:128450521-128450543 TGGGCTTCCATGCCCAGCTCTGG + Intergenic
1076607484 10:131698476-131698498 GGGGCTGCCGTGCCCAGCCCAGG - Intergenic
1077256021 11:1583701-1583723 GGGGGTGCCTTGCCTTGATCAGG - Intergenic
1077919089 11:6630058-6630080 CGTGCAGCCTCGCCCAGATCCGG + Exonic
1080680884 11:34474906-34474928 CGGACTGCCTGGCGCAGACCAGG + Intergenic
1082005393 11:47416171-47416193 CGGGCAGCCCTGCCCAGCTCAGG + Exonic
1082961676 11:58923764-58923786 CTGGCTGCCTTCCCCACTTCAGG - Intronic
1082980803 11:59118392-59118414 CTGGCTGCCTTCCCCACTTCAGG - Intronic
1084063210 11:66688956-66688978 CGTGCTGCCTGGCACAGCTCTGG - Intronic
1084970847 11:72771315-72771337 GGGGCTGGCTTGCCTAGAGCTGG + Intronic
1085159833 11:74329900-74329922 TTGCCTGCCTTTCCCAGATCAGG - Intergenic
1089499481 11:118923988-118924010 CGGGCTACCTTCTCCAGGTCAGG - Intronic
1094690214 12:32761353-32761375 AGGGCTCCCTTGCCCAGGTTTGG - Intergenic
1095277171 12:40300041-40300063 CAGGATGCCTTACCCAGCTCAGG - Intronic
1105296899 13:19095678-19095700 AGGTCTGCCACGCCCAGATCAGG + Intergenic
1113543003 13:111123382-111123404 CTGCCTGCCCTGCCCAGAGCAGG + Intronic
1116868076 14:50047484-50047506 CTGGCTGCCTTGCAGAGAACAGG + Intergenic
1117178973 14:53173284-53173306 CTGCCTGACTTGCCCACATCTGG + Intergenic
1118320515 14:64749624-64749646 CGGGCAGCCTAGCCCAGACCTGG - Exonic
1119771912 14:77225361-77225383 TGGCCTGCCCTGCCCAGCTCTGG - Intronic
1122364062 14:101183808-101183830 CGGGTTGCCATCCCCAGAACCGG + Intergenic
1122929930 14:104928478-104928500 GGGGCTGCCTGGTCCAGAGCAGG - Intronic
1125582444 15:40795923-40795945 CTTGGTGCCTTGCCCAGAGCAGG - Intronic
1127817729 15:62626583-62626605 GTCGCTGACTTGCCCAGATCAGG - Intronic
1129104372 15:73296040-73296062 AGGGCTGCCTTGCACAACTCCGG - Intronic
1132393884 15:101458392-101458414 CGGGCCACATTGCCCAGCTCGGG - Intronic
1134188180 16:12100530-12100552 GGGGCTGCTGTGTCCAGATCGGG + Intronic
1136240013 16:28937844-28937866 CAGACTGCCTTGCCCAGCTTGGG + Intronic
1138560881 16:57800426-57800448 CAGGCTGCCTGGCACAGAGCTGG + Intronic
1140457674 16:75114454-75114476 CGGGCTGCCCTGCAGAGACCGGG - Intronic
1141622747 16:85245768-85245790 GGGGGTGCCTTGTCCAGCTCTGG + Intergenic
1142298537 16:89242908-89242930 CGGGCTCCCCAGCCCAGCTCTGG + Intergenic
1142964556 17:3572480-3572502 GGGGCTGCCCTGCCCAGGCCCGG - Intronic
1148100367 17:45086618-45086640 CGGGCTGCGTATCCCAGAACTGG - Exonic
1154170464 18:12047267-12047289 CGGGCTGCATTGCCCATGGCAGG - Intergenic
1160834357 19:1117574-1117596 GGGGATGCCTTGCCCAGGGCTGG - Intronic
1161397307 19:4051694-4051716 CGGGCTGCCTTGCCCAGATCTGG + Intronic
1161698745 19:5783966-5783988 AGGGCTGACTGGCCCAGGTCGGG + Exonic
1162081648 19:8221347-8221369 CTGGCAGCCTTGCCAACATCGGG + Intronic
1162841462 19:13359489-13359511 TGGGCTGCCTTTCCCAGCTCAGG + Intronic
1164053924 19:21606404-21606426 TGGACTGCCTGGCCCAGACCAGG - Intergenic
1165108171 19:33486641-33486663 CAGGCGGCCTGGCCCTGATCTGG + Intronic
1165112805 19:33512122-33512144 CCCGCTGCCATGCCCAGAGCTGG - Intronic
1165749589 19:38251955-38251977 CGGGCTCCCTTCCCCACCTCTGG - Intronic
1167134665 19:47609489-47609511 CCGGCTTCCCTGCCCAGACCCGG + Intronic
1168074431 19:53971866-53971888 GGGGCTGCCTAGCGCAGACCCGG - Intronic
925609563 2:5692220-5692242 CGGGCTGCTTTGCAAAGATGGGG - Intergenic
927475542 2:23411722-23411744 GGAGCTGCCATGCCCACATCTGG - Intronic
933759629 2:85664807-85664829 AGGGCTACCTTGCCCAAATTGGG - Intronic
937012801 2:118576766-118576788 CTGGCTCCCCTCCCCAGATCTGG - Intergenic
938788984 2:134660042-134660064 GAGCCAGCCTTGCCCAGATCTGG + Intronic
944758469 2:202788427-202788449 CCTGCTGCCTTGCCCAGAAAGGG + Intronic
946282657 2:218677412-218677434 AAGGCTGCCTGGCCCAGCTCTGG - Intronic
948366278 2:237457021-237457043 GGGGCTCCCTTGTCCTGATCTGG - Intergenic
948552927 2:238786638-238786660 CGGGGTGCCTTGCTCAGAGCAGG - Intergenic
1169236187 20:3931753-3931775 GGGTCTGCTTTGCCCAGATGAGG - Exonic
1169737075 20:8848724-8848746 GGGCCTGTCTTGCCCACATCTGG + Intronic
1170575184 20:17657251-17657273 CCAGCTGCCCAGCCCAGATCAGG - Intronic
1171463105 20:25309774-25309796 TGGGCTGCCTTCCCCAGGGCTGG - Intronic
1175290706 20:57873269-57873291 CTGGCTGCCTTGCCCTGCCCTGG + Intergenic
1179473438 21:41627613-41627635 CTGGGTGCATTGCCCTGATCTGG - Intergenic
1180623065 22:17174906-17174928 AGGGCTCCCATGGCCAGATCTGG + Intergenic
1183427386 22:37746865-37746887 AGGGCTGGCTTGCCCAGGCCCGG - Intronic
1183737965 22:39654317-39654339 AGGGCAGCCCTGCCCAGCTCAGG - Intronic
1184687848 22:46104520-46104542 CGGGCTGCCTTGCCAAAGGCTGG - Intronic
1184905673 22:47484368-47484390 AGGACTGCCTGGCCCAGACCAGG - Intronic
1185344391 22:50305017-50305039 AGGGCTGCCTTCCCCTGAGCTGG - Intronic
950408778 3:12820814-12820836 TGGGCTGCCCTGCCTAGATGTGG - Intronic
950466814 3:13160729-13160751 CAGGATGCCTTGCACAGAACAGG - Intergenic
951608357 3:24462864-24462886 CTGGGTGCCTTGCCCAGATGAGG - Intronic
952289845 3:32004414-32004436 CTGACTCCCTTGCCCAGATGGGG + Intronic
954334653 3:49909240-49909262 AGGGCTGCCTTACCCAGGCCAGG + Exonic
960971412 3:123142682-123142704 CAGGCTGTCTTGCCCAGCCCAGG + Intronic
961779578 3:129313848-129313870 AGGTCTGCCAGGCCCAGATCAGG + Intergenic
969275042 4:6129042-6129064 CAAGGTGCCTTGCCCAGAGCAGG + Intronic
983077653 4:163344441-163344463 CGGGCTGCTGTTCCCAGCTCCGG - Exonic
990510525 5:56485362-56485384 GGTGCAGCCTTGCCCAGATCAGG + Intergenic
993673600 5:90791855-90791877 CAGGCTGCTCTGCCAAGATCTGG + Intronic
997376142 5:133398966-133398988 CAGGCAGCCTTGAGCAGATCAGG - Intronic
998037464 5:138929030-138929052 TGGGCTGCCTGGCCCACAGCAGG - Intronic
1004260858 6:14106457-14106479 TGGACTGCCTGGCCCAGACCAGG + Intergenic
1005936977 6:30530626-30530648 CGAGCCACCTTGCCCAGCTCAGG + Intergenic
1018837483 6:167496246-167496268 CTGGCTCCCTGGCCCAGAGCTGG - Intergenic
1019487571 7:1296375-1296397 CGGTCTGCCAGGCCCAGATCCGG + Intergenic
1019572466 7:1719425-1719447 GGGGCTGCCTAGCCCAGAGCCGG - Intronic
1022383297 7:29880827-29880849 CGGCCTGCCTTGCCCTGACATGG - Intronic
1023358993 7:39396762-39396784 GAGGCTGCCTTCCCCAGATAAGG - Intronic
1024108883 7:46124480-46124502 CAGGCTGACATGCACAGATCAGG - Intergenic
1035380044 7:158432106-158432128 CGGGATGCCTTGTCCAGGGCGGG + Intronic
1036795544 8:11753902-11753924 CAGGGTGCCTTCCCCACATCTGG - Intronic
1040015453 8:42695724-42695746 CAGGCTGCCTTGACCACAGCTGG - Intergenic
1040610368 8:48977275-48977297 CAGGCTGCCTAGCCCAGGACTGG + Intergenic
1042837823 8:73093263-73093285 GGGGCTGCCCTGCCCAGGTGGGG + Exonic
1043019600 8:74984373-74984395 CGGGCTGCTTCTCCCGGATCTGG + Intergenic
1043526941 8:81107464-81107486 CGGGCCTCCTTGCACAGTTCTGG + Intronic
1047083786 8:121494017-121494039 CTGGCTGCCTTGCACAGAGAAGG + Intergenic
1049498073 8:142946018-142946040 CGGGCTGTCTGGCCTGGATCAGG + Intergenic
1049747245 8:144268226-144268248 CGGTGGGCCTTGCCCAGCTCAGG - Exonic
1059739677 9:117137381-117137403 TGGGCTGCCTGGTCCAGATTGGG - Intronic
1062389989 9:136330058-136330080 GGGGCTCCCTGGCCCAGAGCAGG + Intronic
1187823839 X:23315259-23315281 CAGGCTGCCATGCAAAGATCTGG - Intergenic
1189331022 X:40145306-40145328 GGGGCTGAGTTGCCCAGAGCTGG - Intronic
1197074136 X:122335386-122335408 GGGTCTGCCTTTCCCAGCTCAGG + Intergenic
1197762340 X:130036728-130036750 GGGGCTGGCTTGCCAAGCTCAGG + Intronic
1200208147 X:154332636-154332658 AGGGCTGCCTGGCCCAGAAGCGG - Intergenic