ID: 1161397308

View in Genome Browser
Species Human (GRCh38)
Location 19:4051700-4051722
Sequence GCCTTGCCCAGATCTGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397298_1161397308 29 Left 1161397298 19:4051648-4051670 CCTCTGGTTTACTGATCACCTTC 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1161397308 19:4051700-4051722 GCCTTGCCCAGATCTGGCACAGG 0: 1
1: 0
2: 1
3: 23
4: 201
1161397305_1161397308 -2 Left 1161397305 19:4051679-4051701 CCACGGCAAGGTCTCCGGGCTGC 0: 1
1: 0
2: 1
3: 14
4: 94
Right 1161397308 19:4051700-4051722 GCCTTGCCCAGATCTGGCACAGG 0: 1
1: 0
2: 1
3: 23
4: 201
1161397304_1161397308 -1 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397308 19:4051700-4051722 GCCTTGCCCAGATCTGGCACAGG 0: 1
1: 0
2: 1
3: 23
4: 201
1161397300_1161397308 11 Left 1161397300 19:4051666-4051688 CCTTCTGCAAAGCCCACGGCAAG 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1161397308 19:4051700-4051722 GCCTTGCCCAGATCTGGCACAGG 0: 1
1: 0
2: 1
3: 23
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397308 Original CRISPR GCCTTGCCCAGATCTGGCAC AGG Intronic
901447254 1:9316140-9316162 GCCTTGCCCTGGGCTGGCAGGGG + Intronic
901670298 1:10852042-10852064 GCCTGGCACAGACCTGGCTCAGG - Intergenic
901928034 1:12579286-12579308 CCCTTACCCAGAACTGGCCCAGG + Exonic
903005061 1:20293001-20293023 GTCTGGCCCAGATCTGGGGCTGG - Intronic
903048991 1:20587133-20587155 GCCCTGCCCAGGCCTGGGACCGG - Intergenic
903128334 1:21262540-21262562 GCCTTCCCCAGCGCTGGCCCTGG - Intronic
903161307 1:21491066-21491088 TCCTTGCCCTGCTCTGGCCCAGG - Intergenic
903226134 1:21895076-21895098 GCCTTGGCCAAATCTGGCCTGGG - Intronic
904383130 1:30124788-30124810 GACTTCCCCAAATCTGGCATTGG + Intergenic
904541095 1:31233951-31233973 GCTTCGCTGAGATCTGGCACAGG - Intronic
904894045 1:33800755-33800777 CCCTCGCCCAGATCTGGCTGTGG - Intronic
905004092 1:34696402-34696424 GTCATGCCAAGATCTGGCAGAGG - Intergenic
905454044 1:38075455-38075477 GCCTTGCCCAGGTGTGGCCCAGG - Intergenic
906073736 1:43036307-43036329 GCCTTGTCCAGCTCTGTCCCAGG - Intergenic
906276841 1:44523184-44523206 GACTTCCCCAGATGTGGCAGTGG - Intronic
906658406 1:47565489-47565511 GCAGTGGCCAGATCTGGCCCAGG + Intergenic
907239210 1:53071367-53071389 ACCTGGCCCAGAGCTGGCACCGG + Intronic
907246816 1:53114094-53114116 GCCTGGCACAGAACTGGCACTGG + Intronic
912451170 1:109768609-109768631 GCTTTCCCCAGCCCTGGCACAGG + Intronic
913446052 1:118951840-118951862 CCCTTGCCCAGGGATGGCACAGG - Intronic
918262778 1:182811080-182811102 GCTTTGCATATATCTGGCACTGG - Intronic
919288204 1:195593439-195593461 ACTTTGCCCAGATCTGTCAGAGG + Intergenic
921621120 1:217327456-217327478 GCCTTGCCCAGAAGTTTCACAGG + Intergenic
922765202 1:228152820-228152842 GCCTGGCCCAGGTCTGGGAGTGG - Intronic
923679935 1:236111110-236111132 ACCTTGCCCACTTCTGCCACAGG - Intergenic
1062952599 10:1516017-1516039 GTTTTGTCCACATCTGGCACTGG - Intronic
1063077270 10:2729979-2730001 GCCTTGCCCAGAGCCGTCAGTGG - Intergenic
1063426241 10:5952242-5952264 GCCTTGCCTAAAGCTGGCTCCGG - Intronic
1067836202 10:49643441-49643463 GCCTTGGCCAGGTCTGGGTCAGG - Intronic
1068409166 10:56632699-56632721 GCTTTGCCCACAGATGGCACAGG + Intergenic
1069016825 10:63439012-63439034 GCCTTGTACATATCAGGCACTGG - Intronic
1069551398 10:69366918-69366940 GCCTAGCCCATGCCTGGCACAGG - Intronic
1069842480 10:71348460-71348482 GCCCTGCCCAGCTCTGTCATCGG - Intronic
1074443038 10:113495484-113495506 GCTCTGCCGAGATCTGGCATTGG - Intergenic
1077215934 11:1395132-1395154 GCCTTCCCCACATCAGGCCCTGG + Intronic
1077268112 11:1662010-1662032 GCCTCGCCCACACCTGGCCCCGG + Intergenic
1077910195 11:6566476-6566498 ACCTGGCCCAGAGCAGGCACAGG + Intronic
1079104883 11:17564162-17564184 GCCCAGCACAGAGCTGGCACAGG - Intronic
1081270018 11:41071756-41071778 ACTTTGCCCAGATCCGTCACAGG - Intronic
1083822704 11:65181943-65181965 GCCCTGCCCTGAGCTGCCACCGG + Intronic
1084970849 11:72771321-72771343 GGCTTGCCTAGAGCTGGCATGGG + Intronic
1085392414 11:76189290-76189312 GCCTTGTCTGGATCTGACACTGG - Intronic
1085740024 11:79070363-79070385 GCCTGACCCAGCTCTGGCCCAGG + Intronic
1089152034 11:116371765-116371787 GCCCTGCCCAGCCCTGGGACAGG + Intergenic
1089188266 11:116635771-116635793 GGCTTTGCCAGAACTGGCACAGG + Intergenic
1092029237 12:5270072-5270094 GCTTTGCCCAGGTGTGGCACTGG + Intergenic
1094736954 12:33245562-33245584 GCCTTGTCCAGATCTAGAAAAGG + Intergenic
1097225528 12:57475076-57475098 TCCTTGCCCAGGCCTGGCACAGG - Intronic
1101387435 12:104270226-104270248 ACTTTGCCCAGATCTGTCAGAGG + Intronic
1101727223 12:107398137-107398159 ACCTTGCACAGCTCTGGCATTGG + Intronic
1101969201 12:109300993-109301015 GCCTTGCCCAGAGCTACCACAGG - Intronic
1102046131 12:109831544-109831566 GCCCAGCCCAGAGCTGGCACAGG + Intronic
1104348919 12:128027875-128027897 CCCTGGCCCGGCTCTGGCACGGG - Intergenic
1104717820 12:131028056-131028078 GCCTTCTCCAGAGCGGGCACTGG + Intronic
1104988489 12:132611028-132611050 GCCAGGCCCAGCTCTTGCACTGG - Intergenic
1109832641 13:67812298-67812320 GCCTTGGACAGCTCTGCCACTGG + Intergenic
1109944800 13:69419969-69419991 GCCTCGCACAGAGCTGGTACTGG - Intergenic
1109971128 13:69770223-69770245 GCTTTGCCCACATCTGGACCAGG - Intronic
1113946987 13:114049960-114049982 GCCATGCCCACCTCTGGGACTGG - Intronic
1114652058 14:24291472-24291494 CCAGTGCCCAGATCTGGCTCGGG - Intronic
1115464313 14:33698063-33698085 GGCCTGCCCAGCTCTGGCACAGG - Intronic
1117926689 14:60788037-60788059 GCTTTGCCCAGATCTATCAGAGG + Intronic
1119380733 14:74226437-74226459 GCCTTGCCAAACTCTGGCACTGG - Intergenic
1125015937 15:34935453-34935475 GCCTTCTATAGATCTGGCACTGG - Intronic
1127842017 15:62840047-62840069 GCCTTGCCCATACCTGGACCGGG + Intronic
1129150103 15:73683416-73683438 GCCCTGCCCAGTACTGCCACTGG + Intergenic
1130432308 15:83860846-83860868 GCCTTGCCCTGCTTTGGCTCAGG - Intronic
1130802667 15:87281283-87281305 GCCTTGCCCTGCTTTGGCTCAGG + Intergenic
1132875350 16:2134741-2134763 GCCTGGCACAGACCTGGCTCTGG + Intronic
1133131484 16:3678800-3678822 GCTTTGCCCAGAGCTGGAAAAGG + Intronic
1134519632 16:14912619-14912641 GCCTGGCACAGACCTGGCTCTGG - Intronic
1134554299 16:15153616-15153638 GCCTGGCACAGACCTGGCTCTGG + Intergenic
1134707304 16:16311275-16311297 GCCTGGCACAGACCTGGCTCTGG - Intergenic
1134960237 16:18400850-18400872 GCCTGGCACAGACCTGGCTCTGG + Intergenic
1135673138 16:24391785-24391807 ACCTTTCCCAGAGCTGGCAAGGG - Intergenic
1135821093 16:25686904-25686926 GCATGGTCCAGTTCTGGCACAGG + Intergenic
1136029393 16:27491824-27491846 GCCCTCCCCAGCTCTGGCCCTGG + Intronic
1136723832 16:32342093-32342115 GCCCTGCCCTGAACCGGCACTGG - Intergenic
1136842160 16:33548137-33548159 GCCCTGCCCTGAACTGGCACTGG - Intergenic
1137642030 16:50040510-50040532 GCATTCCCCAAATCTAGCACGGG - Intergenic
1138109926 16:54315739-54315761 ACCTTGCCCGCATCTGGCAGAGG + Intergenic
1139515422 16:67449807-67449829 GCCTGGCCCAGAGCAGGTACTGG + Intronic
1139924729 16:70479807-70479829 TGCTTGCCCAGATCTTGCTCTGG - Exonic
1203002599 16_KI270728v1_random:175672-175694 GCCCTGCCCTGAACCGGCACTGG + Intergenic
1203134205 16_KI270728v1_random:1712078-1712100 GCCCTGCCCTGAACCGGCACTGG + Intergenic
1203152325 16_KI270728v1_random:1848434-1848456 GCCCTGCCCTGAACTGGCACTGG - Intergenic
1143388445 17:6545895-6545917 GCCCAGCCCTGACCTGGCACAGG - Intronic
1143747883 17:9006689-9006711 GCTATGCCCAGATATGGCCCTGG + Intergenic
1144563748 17:16343194-16343216 GCCTTGGCCAAACCTGGCTCAGG - Intronic
1145305197 17:21670245-21670267 GCCTTGCCCTGAACTGGAAAGGG + Intergenic
1146418273 17:32657343-32657365 CCATTGGCCAGATTTGGCACAGG - Intronic
1147320415 17:39642553-39642575 GCCTGGTACAGTTCTGGCACTGG + Intronic
1148803641 17:50251551-50251573 ACCTTGCCCAGATCCAGCAGAGG + Intergenic
1150794942 17:68229408-68229430 GACATGCCCAGTTCTAGCACAGG - Intergenic
1151348305 17:73516606-73516628 GCCTGGCCCAGCTCTGGCCCCGG + Intronic
1153175594 18:2368835-2368857 ACTTTGCCCAGATCCAGCACAGG - Intergenic
1153849560 18:9080382-9080404 GGCCTGCTCAGATTTGGCACTGG + Intergenic
1154176390 18:12088955-12088977 TCCTGGCCCTGAGCTGGCACTGG + Intergenic
1159604872 18:70464954-70464976 GGCTTGGCCAGATCCGGCAGAGG - Intergenic
1160015564 18:75137736-75137758 GCCCTGCCCAGAGCTGGGAGAGG - Intergenic
1160347556 18:78146258-78146280 GCATTGCCCAGATCTGCAAGGGG + Intergenic
1160986908 19:1843287-1843309 GCTTTGCCCAGCTGTGGCTCTGG - Intronic
1161397308 19:4051700-4051722 GCCTTGCCCAGATCTGGCACAGG + Intronic
1162081649 19:8221353-8221375 GCCTTGCCAACATCGGGAACTGG + Intronic
1162538482 19:11278414-11278436 GCCTTGCCCAGCTCATGTACAGG - Intergenic
1163572608 19:18091212-18091234 GGCTTGCCAAGATGTGGCAAGGG - Intronic
1164413264 19:28022812-28022834 CCCTGGCCCAGATCTCCCACAGG + Intergenic
1164517754 19:28950267-28950289 CCCTGGCCCAGATCTCCCACGGG + Intergenic
1166252086 19:41578095-41578117 CCCTTGCCCAGATGGGGCTCTGG - Intronic
1166255616 19:41602071-41602093 CCCTTGCCCAGATGAGGCTCTGG - Intronic
1166266227 19:41686309-41686331 TCCTTGCCCAGATGAGGCCCTGG + Intronic
1166415571 19:42592968-42592990 TCCTTGCCCAGATGAGGCTCTGG + Intronic
1166423513 19:42656035-42656057 TCCTTGCCCAGATGAGGCTCTGG - Intronic
1166466418 19:43035740-43035762 TCTTTGCCCATATCTGGGACTGG - Intronic
1167034677 19:46988091-46988113 GCCTTGACCAGCTCTGGCCTCGG - Intronic
925905265 2:8536324-8536346 ACCTTCCCCAGGCCTGGCACTGG - Intergenic
926276971 2:11411401-11411423 CCCTTTCCCAGATCTAACACAGG + Intergenic
927071818 2:19538531-19538553 GCCTAGCCCATATATTGCACAGG - Intergenic
927156243 2:20223441-20223463 GACTTCCCCAGCTCTGGCAAAGG - Intronic
927722871 2:25397988-25398010 GCCTGGCCCAGATCATGCAGAGG - Intronic
928852474 2:35766615-35766637 GCCTTGCCCTGCTTTGGCTCAGG - Intergenic
929429061 2:41871404-41871426 GCCTTGGTCAGAACTGGCTCCGG + Intergenic
929543450 2:42840513-42840535 GGCCTGTCCAGATCTGGCAGAGG + Intergenic
930187585 2:48425884-48425906 GCCATGCCAAGATCTGGGAAAGG + Intergenic
930859554 2:56056164-56056186 ACCTTGCCCAGATCTATCAGAGG + Intergenic
930919535 2:56735360-56735382 ACATTGCCCAGATCTGTCAGAGG - Intergenic
934460602 2:94212278-94212300 GCCCTGCCCCGATCCTGCACTGG + Intergenic
938478084 2:131634305-131634327 GCCCTGGCCAGATCTTGCAGAGG + Intergenic
944361663 2:198864398-198864420 GCAATGCCCACAGCTGGCACTGG + Intergenic
944636138 2:201677907-201677929 CTCTTGCCCAGATATGGCAGCGG + Intronic
946228543 2:218277748-218277770 GCGTTCCCCAGCTCTGGCAGAGG - Intronic
947414048 2:229874992-229875014 GCCTTTTCCAGTTCTAGCACAGG - Intronic
948107243 2:235424759-235424781 ACCTTGCCCAGATCTAATACAGG - Intergenic
948918515 2:241050757-241050779 GCCCTGCCCAGAGCTGACTCTGG + Intronic
1171393965 20:24819055-24819077 GACAGGCCCAGATCTGGCTCTGG + Intergenic
1171522713 20:25787718-25787740 GCCTTGCCCTGAACTGGGAAGGG + Intronic
1171530458 20:25849687-25849709 GCCTTGCCCTGAACTGGGAAGGG + Intronic
1171554114 20:26068165-26068187 GCCTTGCCCTGAACTGGGAAGGG - Intergenic
1174363149 20:50040899-50040921 TCTTTGCCCAGACCTGGCCCAGG - Intergenic
1175261666 20:57678472-57678494 GCCTGGCCCAGGCCTGGCACTGG + Intronic
1175806333 20:61831192-61831214 GCCCTGACCACATCTGGCACTGG + Intronic
1179710832 21:43212067-43212089 TCCTTGCCCTGATCTGGCTTGGG + Intergenic
1180844499 22:18973796-18973818 GCCCTGCCCGGCCCTGGCACAGG + Intergenic
1180900261 22:19366400-19366422 ACTTTGCCCAGATCTGCCAGAGG - Intronic
1181811436 22:25405633-25405655 TCCTGGCCCAGATCTGCCCCCGG - Intergenic
1182972349 22:34590184-34590206 ACCTTGCCCACTTCTGCCACAGG + Intergenic
1183701704 22:39454726-39454748 GCCCTGCCCAGAGCTGGCCAGGG - Intergenic
1183731107 22:39619091-39619113 CCCTTGCCCACATCTGTCACCGG + Intronic
1183977338 22:41520216-41520238 ACCTTGCCCACTTCTGCCACAGG - Exonic
1184253340 22:43273308-43273330 GCCTTGACCAGTCCTGGCACCGG + Intronic
1185136979 22:49078847-49078869 GCCTGTCCCAGAGCTGGCAAAGG + Intergenic
949353452 3:3151005-3151027 GGCTTGCACAGATCTTACACTGG + Exonic
949431030 3:3976257-3976279 ACCTTTCCCAGATCTCACACAGG - Intronic
950109868 3:10412158-10412180 GCCCTTCCCTGCTCTGGCACTGG + Intronic
950764178 3:15261065-15261087 GGCTTGCCCAGAGCAGGCACAGG + Intronic
951266884 3:20577875-20577897 GCCATGTGCAAATCTGGCACTGG - Intergenic
951929354 3:27946645-27946667 TTCTTGCCCAGATCTTGCCCTGG + Intergenic
953551517 3:43907157-43907179 GCCTTGCCCAGCTCTGGATCTGG - Intergenic
953793791 3:45967635-45967657 GCCTGGCCCAGAACTGCCAGTGG - Exonic
954710218 3:52501792-52501814 GGCTTGCCCAGAGCTGGGGCTGG - Intronic
954716608 3:52529975-52529997 ACCTTGCCCAGAGCTGGGACTGG + Intronic
956171684 3:66438159-66438181 GCAGGGCCCAGATTTGGCACCGG + Intronic
956499412 3:69865965-69865987 GCCTTACCCAGCTCCGGTACTGG - Intronic
960971437 3:123142773-123142795 GCCTTGCTCAGCCCTGGCAGCGG + Intronic
964729852 3:159853170-159853192 GCCTTTCCTTGCTCTGGCACCGG - Intronic
965096697 3:164237830-164237852 GCCTTTTACAGAGCTGGCACAGG - Intergenic
968515772 4:1015068-1015090 GGCTTGCCCAGCCCTGGCTCAGG + Intronic
969413869 4:7046356-7046378 GCCTGGCCCAGAGCGGGCAGAGG - Intronic
969624865 4:8297315-8297337 GCTTTCCCCAGCTCTGGCCCAGG + Intronic
971106698 4:23533625-23533647 GCCTTGTGCAGAGTTGGCACTGG + Intergenic
974542153 4:63250819-63250841 GCCTTGCCCTGCTTTGGCTCAGG + Intergenic
975573921 4:75844320-75844342 CCCTTGCTCAGATCTGAAACTGG + Intergenic
976688052 4:87837730-87837752 GCCTATCTCAGATGTGGCACTGG - Intronic
982586320 4:157244976-157244998 GCCTTGCCCAGTTTTTTCACTGG + Intronic
985188559 4:187345827-187345849 GCCTTTCCCAGCTCTGGCCCAGG + Intergenic
988274532 5:29063969-29063991 ACTTTGCCCAGATCTGTTACAGG - Intergenic
991228713 5:64304352-64304374 GCTTTGCCCAGATCCATCACAGG - Intronic
991456369 5:66808624-66808646 CCCTGGCCCTGATCTGGCAATGG - Intronic
991919276 5:71638465-71638487 ACTTTGCCCAGATCTGTCAGAGG + Intronic
997602458 5:135149911-135149933 GCCTTCCCCAGAGCTGCCTCAGG - Intronic
999288013 5:150405659-150405681 GCCTTGCACAGTGCTGGCATAGG + Intronic
1002044081 5:176532364-176532386 ACCTTCCCCAGAGCTGGCCCGGG + Exonic
1002525487 5:179813371-179813393 GCCCTGCCCAGGTCTGCCCCAGG - Intronic
1002717217 5:181235050-181235072 GCCTAGCCCAGCCCTGGGACTGG + Exonic
1003402694 6:5804001-5804023 GACAGGGCCAGATCTGGCACAGG + Intergenic
1004323492 6:14652109-14652131 GCCGTGCCCATATCTCGCTCAGG - Intergenic
1004512989 6:16297655-16297677 TCCTCCCCCAGCTCTGGCACAGG - Intergenic
1005254261 6:23983178-23983200 GCCTTGCCCTGAACAGACACTGG + Intergenic
1006802351 6:36767284-36767306 GTCTTGCCCAGAGCTGGACCTGG - Intronic
1006929786 6:37680792-37680814 GCCCAGCCCAGATCTGGCACGGG + Intronic
1007820301 6:44555912-44555934 CTCTTGCCCAGATCTGGTCCTGG - Intergenic
1009188301 6:60600000-60600022 GCCTTGCCCTGCTTTGGCTCAGG - Intergenic
1011976825 6:93311736-93311758 ACCTTGCCCAGATCTATCAAAGG + Intronic
1012948785 6:105495702-105495724 GTCTTGCCCGGATCTGGGGCAGG + Intergenic
1014419327 6:121221475-121221497 ACTTTGCCCAGATCTGTCAGAGG - Intronic
1018349767 6:162943968-162943990 GCCCAGCCCACAGCTGGCACCGG + Intronic
1019811502 7:3168530-3168552 CCCTGGCCAAGCTCTGGCACAGG + Intronic
1021375956 7:19906497-19906519 GCCTTGCCCTGCTTTGGCTCAGG + Intergenic
1023921658 7:44634771-44634793 GCCTTGCTCAGACCTTGCCCAGG - Intronic
1025283192 7:57642919-57642941 GCCTTGCCCTGAACTGGGAAGGG + Intergenic
1029687580 7:102159392-102159414 GTCCGGCCCAGATCAGGCACAGG + Intronic
1029858104 7:103539427-103539449 GGCCTGCTCAGAACTGGCACTGG + Intronic
1033707722 7:143905138-143905160 GGCTGGCCCAGAACTCGCACTGG - Intergenic
1034103849 7:148473940-148473962 CCTCTGCCCAGATCTGACACGGG + Intergenic
1035147176 7:156830857-156830879 GCCTAGCACAGTCCTGGCACGGG - Intronic
1036700940 8:11013602-11013624 GCAGTGCCTAGATCTGGCCCCGG + Intronic
1039854876 8:41403445-41403467 ACCTTGCACTGATGTGGCACCGG - Intergenic
1040611533 8:48988616-48988638 TCCTTACCCACATCTGGTACAGG + Intergenic
1047731874 8:127735219-127735241 CCCTAGCCCAGCTCTGGAACAGG + Intergenic
1049352577 8:142171998-142172020 GGCCTGCCCAGATCTGCCCCGGG + Intergenic
1049378971 8:142302602-142302624 GCCTTTCCCAGACCTGGGAGAGG - Intronic
1049592963 8:143470983-143471005 GCGGTGCCCAGAGCTGGCACTGG - Intronic
1055376792 9:75657395-75657417 GCCTTGCCTAGACCAGTCACTGG - Intergenic
1056124556 9:83522413-83522435 GCCTCGCACAGCTCTGGGACAGG - Intronic
1056708959 9:88975071-88975093 GCCAGGCCCAGAACTGGCACTGG - Intergenic
1057207953 9:93184585-93184607 GCCCTGCCCAGCCCTGGCCCAGG - Intergenic
1057824559 9:98362186-98362208 GCCTTGCCCTGAACTCGCACTGG - Intronic
1058942980 9:109831351-109831373 GCCTCTCACAGTTCTGGCACAGG + Intronic
1062286171 9:135773474-135773496 GCCTTGCCCAGGGGTTGCACAGG - Intronic
1189014624 X:37084285-37084307 TCCTTGCCCAGATCTATCAGAGG - Intergenic
1191902001 X:66051293-66051315 GCCTGACCCTGAGCTGGCACTGG + Intergenic
1194167794 X:90541843-90541865 CCTTTGCCCAGATCTGTCAGAGG + Intergenic
1195340629 X:103903081-103903103 GCCTTGCCCTGCTTTGGCTCAGG + Intergenic
1196043834 X:111234904-111234926 CCTCTGCCCAGATCTGGCAGAGG - Intergenic
1200136899 X:153879659-153879681 GCCCTGCCCACTTGTGGCACTGG + Intronic
1200514048 Y:4119633-4119655 CCTTTGCCCAGATCTGTCAGAGG + Intergenic