ID: 1161397310

View in Genome Browser
Species Human (GRCh38)
Location 19:4051701-4051723
Sequence CCTTGCCCAGATCTGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397298_1161397310 30 Left 1161397298 19:4051648-4051670 CCTCTGGTTTACTGATCACCTTC 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1161397310 19:4051701-4051723 CCTTGCCCAGATCTGGCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 262
1161397305_1161397310 -1 Left 1161397305 19:4051679-4051701 CCACGGCAAGGTCTCCGGGCTGC 0: 1
1: 0
2: 1
3: 14
4: 94
Right 1161397310 19:4051701-4051723 CCTTGCCCAGATCTGGCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 262
1161397304_1161397310 0 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397310 19:4051701-4051723 CCTTGCCCAGATCTGGCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 262
1161397300_1161397310 12 Left 1161397300 19:4051666-4051688 CCTTCTGCAAAGCCCACGGCAAG 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1161397310 19:4051701-4051723 CCTTGCCCAGATCTGGCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397310 Original CRISPR CCTTGCCCAGATCTGGCACA GGG Intronic
900681226 1:3917876-3917898 TCTTGCCCCGATCTGGAACTTGG - Intergenic
900820275 1:4881300-4881322 CCTTCCCCATAGATGGCACAGGG + Intergenic
901670296 1:10852041-10852063 CCTGGCACAGACCTGGCTCAGGG - Intergenic
901928036 1:12579287-12579309 CCTTACCCAGAACTGGCCCAGGG + Exonic
902690036 1:18105342-18105364 CCTTGCACAAGTCTGGCACTTGG - Intergenic
902946853 1:19847078-19847100 CCTTGCACATACCTGACACATGG - Intergenic
903161305 1:21491065-21491087 CCTTGCCCTGCTCTGGCCCAGGG - Intergenic
903228001 1:21904657-21904679 CCTTGGCCACACCTGGCACATGG - Intronic
903281875 1:22254802-22254824 TCTTGCCCAGATGGGGCACTCGG - Intergenic
904286365 1:29455324-29455346 CTCTGTCCAGACCTGGCACATGG + Intergenic
904376130 1:30083672-30083694 GGTGGCCCAGAGCTGGCACAGGG - Intergenic
904506513 1:30960080-30960102 CCCTGCCAAGATCAGGAACAAGG + Intronic
904541094 1:31233950-31233972 CTTCGCTGAGATCTGGCACAGGG - Intronic
905004091 1:34696401-34696423 TCATGCCAAGATCTGGCAGAGGG - Intergenic
905023214 1:34832082-34832104 CCAGGCCCGGATCTGCCACATGG + Intronic
905774356 1:40659036-40659058 CTTTGCACAGATGTGGCAGAGGG + Intronic
906658407 1:47565490-47565512 CAGTGGCCAGATCTGGCCCAGGG + Intergenic
907239212 1:53071368-53071390 CCTGGCCCAGAGCTGGCACCGGG + Intronic
911729887 1:101281901-101281923 TGTTCCCCAGATGTGGCACATGG - Intergenic
911769486 1:101721949-101721971 CCTGTCCCAGCTCTGGCAAAAGG + Intergenic
912451171 1:109768610-109768632 CTTTCCCCAGCCCTGGCACAGGG + Intronic
912595841 1:110874898-110874920 CCATGGCCAGATATGGCACTTGG + Intronic
913169735 1:116221511-116221533 CCTTGGCCAGGTGTGGTACAAGG + Intergenic
913446050 1:118951839-118951861 CCTTGCCCAGGGATGGCACAGGG - Intronic
913958025 1:143321048-143321070 CCATGGCCAGATCTAGGACAAGG + Intergenic
914052335 1:144146406-144146428 CCATGGCCAGATCTAGGACAAGG + Intergenic
914126862 1:144820135-144820157 CCATGGCCAGATCTAGGACAAGG - Intergenic
916933009 1:169599172-169599194 CCTAACCCAGATCCGGCATATGG + Intronic
917023961 1:170621326-170621348 CCTTGGCCAGATCTGACAAGTGG + Intergenic
917293179 1:173492585-173492607 CCTAGGCCAGAACTGTCACATGG - Intergenic
917699200 1:177563105-177563127 ACTTGCACAGAACTGGCCCAGGG + Intergenic
918301690 1:183210002-183210024 CCTGGCCCAGGGTTGGCACATGG - Intronic
919207643 1:194437622-194437644 CCTTGCCCAGTGTTAGCACAAGG - Intergenic
919305982 1:195838429-195838451 CCATGGCCAGCTCAGGCACAGGG - Intergenic
919412757 1:197266578-197266600 ACTAGCCCAAATCTGACACATGG + Intergenic
919744944 1:201002917-201002939 CATGGCCCAAATCTGGCACATGG - Intronic
920303807 1:205006116-205006138 CAGTGCCCAGTTCTAGCACACGG + Intronic
920580298 1:207100418-207100440 TCTTGCCCACATCTGGCTTACGG + Intergenic
920692251 1:208155728-208155750 CCCTGCCCAGCTCTGGCTCATGG + Intronic
921065842 1:211621371-211621393 TCTTGCCAAGAGCTGCCACAGGG + Intergenic
921261498 1:213388684-213388706 CCTTGCCTGGAACTAGCACAGGG - Intergenic
921621122 1:217327457-217327479 CCTTGCCCAGAAGTTTCACAGGG + Intergenic
923498162 1:234542632-234542654 ACTTGCCCAGCTCTGGGCCAGGG - Intergenic
923623401 1:235595414-235595436 CCTTGCCCAGGCCTGTCACACGG - Exonic
923679933 1:236111109-236111131 CCTTGCCCACTTCTGCCACAGGG - Intergenic
1063251877 10:4282611-4282633 CCGTGACCACATCTGGCTCAGGG + Intergenic
1065976411 10:30846523-30846545 CCTGGCCCAGCTCTGCCTCAGGG - Intronic
1067960066 10:50838270-50838292 CCTGTCACAGATCTGACACACGG - Intronic
1067987986 10:51172935-51172957 CCTAGCCCTGAGCTGACACATGG + Intronic
1068319311 10:55390596-55390618 CTTTACCCAGATCTGTCAGAGGG + Intronic
1069551396 10:69366917-69366939 CCTAGCCCATGCCTGGCACAGGG - Intronic
1070337108 10:75465732-75465754 CCTTCCCCCAATCTGGCATATGG + Intronic
1071563134 10:86658348-86658370 CCTTGGCCAGATGTGGCAGGTGG + Intronic
1072628830 10:97131920-97131942 CCAAGCCCAGCTCTGCCACATGG - Intronic
1072756280 10:98023292-98023314 TCCTTCCCAGAGCTGGCACAAGG - Intronic
1073867937 10:107826355-107826377 GGCTGCCAAGATCTGGCACAGGG - Intergenic
1076347291 10:129788247-129788269 CCTTGCCCAGAGCTGGCTGGAGG - Intergenic
1076899159 10:133328651-133328673 GTTTGCCCAGCTCTGGCATATGG + Intronic
1077640200 11:3874368-3874390 ACTAGCCCTGATCTGGCAAATGG - Intronic
1077981393 11:7304193-7304215 GCTTGCACAGGTCTGGCACCTGG + Intronic
1079104881 11:17564161-17564183 CCCAGCACAGAGCTGGCACAGGG - Intronic
1079135441 11:17773882-17773904 CCATGCCCAGGTCTGGCAGGAGG + Intronic
1080676308 11:34430857-34430879 CTTTCCCCAGCTCTGGCTCAAGG + Intergenic
1081618207 11:44603014-44603036 CCTTGTTCAGGGCTGGCACACGG + Intronic
1084297726 11:68224042-68224064 CCTTACCCAGTCATGGCACATGG - Intergenic
1084470575 11:69356854-69356876 GCTGGGCCAGGTCTGGCACAGGG - Intronic
1084591908 11:70095510-70095532 CATTGCACAGCTCTGCCACAGGG + Intronic
1085368904 11:75979853-75979875 CCTTGCCCTGCTTTGGCTCACGG + Intronic
1085457223 11:76671907-76671929 CCTTACCCTGATTTGCCACAAGG - Intergenic
1085740026 11:79070364-79070386 CCTGACCCAGCTCTGGCCCAGGG + Intronic
1089151855 11:116370557-116370579 CCCAGCCCAGAGCTGGCACATGG - Intergenic
1092880277 12:12882577-12882599 ACTGGCCCATATCTGGGACAAGG + Intergenic
1094690208 12:32761346-32761368 CCTTGCCCAGGTTTGGGGCAGGG - Intergenic
1096493807 12:52027516-52027538 CCTTGCCCAGAGCAAGCACTTGG + Intronic
1099943343 12:89216720-89216742 CCTTGTACTGATCTAGCACATGG + Intergenic
1100108209 12:91204424-91204446 CCTTACTCAGAACAGGCACATGG - Intergenic
1101399586 12:104375874-104375896 ACTTGCCCTGAGCTGCCACAAGG + Intergenic
1101727225 12:107398138-107398160 CCTTGCACAGCTCTGGCATTGGG + Intronic
1101969199 12:109300992-109301014 CCTTGCCCAGAGCTACCACAGGG - Intronic
1102763856 12:115413994-115414016 CCTTGACCAGAAATGGCAAATGG - Intergenic
1103010803 12:117456785-117456807 CCATGCCCAAATCAGTCACACGG + Exonic
1103335282 12:120184710-120184732 CATAGCCCAGATTTGGCACCAGG + Intronic
1104348917 12:128027874-128027896 CCTGGCCCGGCTCTGGCACGGGG - Intergenic
1104376936 12:128271611-128271633 CCCTGCTCAGCTTTGGCACAAGG - Intronic
1104820762 12:131676004-131676026 CCTTTCCCACATCTGTCCCACGG + Intergenic
1107761272 13:43681966-43681988 CTTTGCCCAGATCAGGTATACGG + Intronic
1108259859 13:48645778-48645800 CCTAGCACAGAACTGGCACCTGG + Intergenic
1109223062 13:59660049-59660071 CCTGGCCCAGATACAGCACAAGG - Intergenic
1110253441 13:73406036-73406058 CCTGGGCCACATGTGGCACACGG + Intergenic
1112325966 13:98443038-98443060 CCTTGACCTGATCATGCACACGG - Intronic
1113368968 13:109705550-109705572 CCTTGGGCAGAGCTGGCACCTGG - Intergenic
1114242334 14:20880083-20880105 CCCAGCCCCGTTCTGGCACAGGG - Intergenic
1115243312 14:31270429-31270451 CCTTGCCCAGCTCTGGCCCTTGG - Intergenic
1115464312 14:33698062-33698084 GCCTGCCCAGCTCTGGCACAGGG - Intronic
1119380731 14:74226436-74226458 CCTTGCCAAACTCTGGCACTGGG - Intergenic
1120459395 14:84774812-84774834 CCTTGCCCATCTTTGGCATAAGG - Intergenic
1120822988 14:88930236-88930258 CACTGCCCAGTTCTGCCACAAGG - Intergenic
1122825609 14:104369041-104369063 CCTCGCCCAGGGCTGGCACCTGG + Intergenic
1126189186 15:45861967-45861989 CCTTGTTCAGAGCTGGGACATGG + Intergenic
1126280117 15:46937905-46937927 CCTCGCCTACATCTGGCCCAAGG - Intergenic
1126329961 15:47521475-47521497 CCTATGCCAGAGCTGGCACATGG + Intronic
1126526786 15:49664996-49665018 TCTTGCCAAGATCTGGCAATTGG + Intergenic
1127905578 15:63373647-63373669 CCTTTCCCAGGTCTAGCCCAAGG + Intronic
1128197326 15:65771460-65771482 TCTATCCCAGATCTGGAACAGGG - Intronic
1129247176 15:74286689-74286711 CCTTGCCCAGATAGGGCACCAGG + Intronic
1129600829 15:76997041-76997063 CCTTGCCCAGCTCTGCCCTAGGG - Intronic
1130214241 15:81953303-81953325 CCTTTCCCAGAGCTGCCCCACGG + Intergenic
1132802895 16:1762955-1762977 GCCTGCCGAGATCGGGCACATGG - Exonic
1133131485 16:3678801-3678823 CTTTGCCCAGAGCTGGAAAAGGG + Intronic
1133469504 16:6060910-6060932 TCTTTCCCACATATGGCACATGG + Intronic
1135673136 16:24391784-24391806 CCTTTCCCAGAGCTGGCAAGGGG - Intergenic
1136751690 16:32642197-32642219 CATTGCCCAGATCAGTCTCATGG + Intergenic
1138543047 16:57699958-57699980 TGATGCCCAGATCTGGCACATGG - Intronic
1141226784 16:82124167-82124189 CTTTCCTCAGATCTGGAACAAGG + Intergenic
1141669591 16:85484905-85484927 CCATGCCCAGGGCAGGCACAGGG - Intergenic
1142276045 16:89119398-89119420 CCCTCCCCAGACCTGGCACCAGG - Intronic
1203053826 16_KI270728v1_random:901451-901473 CATTGCCCAGATCAGTCTCATGG + Intergenic
1203124318 16_KI270728v1_random:1561439-1561461 CCATGGCCAGATCTAGGACAAGG - Intergenic
1143472522 17:7184875-7184897 CCTTGCCCTCATCTGGAAAATGG + Intergenic
1144563746 17:16343193-16343215 CCTTGGCCAAACCTGGCTCAGGG - Intronic
1147014488 17:37480431-37480453 CCTTTCCCACATCTGCCAGAAGG + Intergenic
1147350923 17:39842549-39842571 CATTGGCCAAATCTGGGACAAGG + Intronic
1147919028 17:43905412-43905434 CTTAGCTCAGAGCTGGCACAAGG + Intronic
1148124984 17:45231831-45231853 CCTGGACCAGAGCTGGCATACGG - Intronic
1149169604 17:53793083-53793105 CCTTGCACAAAGCTGGCACCTGG + Intergenic
1149434304 17:56620068-56620090 CCCTGCCCAGATCTGGGGCCTGG - Intergenic
1150847356 17:68673120-68673142 CCTTGCCCAGATCAAGGGCAGGG + Intergenic
1152594985 17:81233598-81233620 CCGTGTCCAGCTCTGGCACCTGG - Intronic
1152718174 17:81909806-81909828 CCCTTTCTAGATCTGGCACAGGG - Intronic
1153290818 18:3499733-3499755 CCTGGCCCATCTCTGGCACCAGG - Intronic
1156945324 18:42822547-42822569 CACTGCCCCAATCTGGCACACGG + Intronic
1157257322 18:46150835-46150857 CTTAGCCCAAATCTGGCATATGG + Intergenic
1159807433 18:72973399-72973421 ACTATCCCAGATCTGACACATGG + Intergenic
1161397310 19:4051701-4051723 CCTTGCCCAGATCTGGCACAGGG + Intronic
1161866165 19:6833604-6833626 CCTTGCCCATGTCGGCCACATGG - Exonic
1162958602 19:14113383-14113405 CCCTGCCCACATCTCCCACACGG + Intronic
1163740236 19:19007281-19007303 CCTTGCCCAGGTCTGACAGCAGG - Intronic
1164433497 19:28208337-28208359 CCTTCCCCAGGTCTGTCCCAGGG + Intergenic
1164735094 19:30535455-30535477 ACATGCCCAGACCTGGGACAGGG + Intronic
1165116315 19:33531109-33531131 CCTTGCCCAGCCCAGGCACCTGG + Intergenic
1166252084 19:41578094-41578116 CCTTGCCCAGATGGGGCTCTGGG - Intronic
1166255614 19:41602070-41602092 CCTTGCCCAGATGAGGCTCTGGG - Intronic
1166266229 19:41686310-41686332 CCTTGCCCAGATGAGGCCCTGGG + Intronic
1166415573 19:42592969-42592991 CCTTGCCCAGATGAGGCTCTGGG + Intronic
1166696901 19:44856989-44857011 CCTTCCCTGGAACTGGCACAAGG + Intronic
1202691732 1_KI270712v1_random:98830-98852 CCATGGCCAGATCTAGGACAAGG + Intergenic
925905263 2:8536323-8536345 CCTTCCCCAGGCCTGGCACTGGG - Intergenic
926305018 2:11631718-11631740 CTATGCCCAGGACTGGCACAAGG + Intronic
927156242 2:20223440-20223462 ACTTCCCCAGCTCTGGCAAAGGG - Intronic
927722869 2:25397987-25398009 CCTGGCCCAGATCATGCAGAGGG - Intronic
929609916 2:43263341-43263363 CCTTGGCCAGGTCAGGTACATGG - Intronic
929712112 2:44275900-44275922 CCTTGGGTAGATCTGGTACATGG - Exonic
930919534 2:56735359-56735381 CATTGCCCAGATCTGTCAGAGGG - Intergenic
933798062 2:85937013-85937035 TCTTGCCCAGCCCTGGCCCACGG + Intergenic
933954656 2:87355120-87355142 CCATGGCCAGATCTAGGACAAGG - Intergenic
934238853 2:90251346-90251368 CCATGGCCAGATCTAGGACAAGG - Intergenic
934274343 2:91565364-91565386 CCATGGCCAGATCTAGGACAAGG + Intergenic
934522938 2:95031283-95031305 CCTTGCCCAGAGCTGCCAGGTGG - Intronic
934918554 2:98321496-98321518 CCTTGGGCAGCTCTGCCACAAGG - Intergenic
935182841 2:100705764-100705786 CCTTGCCCAGCACCGGCAGATGG + Intergenic
937994688 2:127684170-127684192 CGTTGCCCACGTCTGGCAGAAGG - Intergenic
938981287 2:136529677-136529699 TCTGGCACAGAGCTGGCACACGG + Intergenic
939689406 2:145239066-145239088 TTTGGCCCACATCTGGCACATGG + Intergenic
942503104 2:176612862-176612884 CCTGGCCCAGTGCTGGCACACGG - Intergenic
946662351 2:222015039-222015061 CCCTGCCCTGTTCTGGCCCATGG - Intergenic
946861876 2:224007931-224007953 GCGTGGCCAGATCTGGCCCATGG - Intronic
947019511 2:225659388-225659410 CCGAGCCCAGTCCTGGCACATGG - Intergenic
947867348 2:233408397-233408419 GCTGGCCCAGGTCTGGGACAGGG + Intronic
948405195 2:237712088-237712110 CCAAGCCCAGCTCTGCCACACGG - Intronic
948445302 2:238027922-238027944 CCTTCGCCTGCTCTGGCACAAGG + Intronic
1169068166 20:2706114-2706136 CCCTCCCCAGCCCTGGCACAGGG - Intronic
1170227748 20:14010867-14010889 CTTTGTCCAGATGTTGCACATGG - Intronic
1171395355 20:24829495-24829517 CCTGGCCCAGTACTGACACACGG + Intergenic
1171489578 20:25507545-25507567 CCTAGCCCAGAGCAGGGACATGG + Intronic
1175261668 20:57678473-57678495 CCTGGCCCAGGCCTGGCACTGGG + Intronic
1175806335 20:61831193-61831215 CCCTGACCACATCTGGCACTGGG + Intronic
1176100696 20:63363147-63363169 CCTGGCACAGAACTGGCCCATGG - Intronic
1176187927 20:63791652-63791674 CCCTGCCCAGCACTGGGACAGGG + Intronic
1176268940 20:64225425-64225447 CCTTGACCACATCAGACACATGG - Intronic
1178617998 21:34150674-34150696 CCTTTCCTAAAACTGGCACATGG + Intergenic
1179225544 21:39449866-39449888 CCTAGAGCAGATCTGGCACATGG + Intronic
1179781466 21:43703534-43703556 TCTGGCCCAGACCTGCCACATGG + Intergenic
1180195396 21:46190805-46190827 CCGTGCCCAGAGGTGGCAGAAGG + Exonic
1180844501 22:18973797-18973819 CCCTGCCCGGCCCTGGCACAGGG + Intergenic
1181811434 22:25405632-25405654 CCTGGCCCAGATCTGCCCCCGGG - Intergenic
1182062292 22:27406871-27406893 CCTTGCTCACATCTGGAGCAGGG - Intergenic
1182972351 22:34590185-34590207 CCTTGCCCACTTCTGCCACAGGG + Intergenic
1183977336 22:41520215-41520237 CCTTGCCCACTTCTGCCACAGGG - Exonic
1184248810 22:43248929-43248951 CCTTGCCCAGAGCGGGAGCATGG - Intronic
1184253342 22:43273309-43273331 CCTTGACCAGTCCTGGCACCGGG + Intronic
1184417051 22:44358436-44358458 CCTGGCTCAGAACAGGCACACGG - Intergenic
1185199789 22:49494445-49494467 CCCTGCCCAGCTCTTCCACAGGG - Intronic
949431028 3:3976256-3976278 CCTTTCCCAGATCTCACACAGGG - Intronic
950533801 3:13568185-13568207 CCATGCCCAGACCAGGCTCAGGG - Intronic
951063971 3:18242678-18242700 CCCTGCCCAGGTCAAGCACATGG - Intronic
952871575 3:37905602-37905624 CAGTGCCCAGCTGTGGCACAAGG - Intronic
953551515 3:43907156-43907178 CCTTGCCCAGCTCTGGATCTGGG - Intergenic
953796568 3:45990606-45990628 CCTAGCACAGTTCTGGCACATGG + Intronic
954427448 3:50450891-50450913 CCATGTCCAGGACTGGCACAGGG - Intronic
954716610 3:52529976-52529998 CCTTGCCCAGAGCTGGGACTGGG + Intronic
956389396 3:68755442-68755464 CCTTTCCTAGAACTGACACATGG - Intronic
957380467 3:79421525-79421547 CTTTGCTCATATCTGGCACCTGG - Intronic
960174282 3:114498619-114498641 CCTGGCCCAGGGATGGCACAAGG + Intronic
960945258 3:122961998-122962020 CCTTGCCCAGCTGTGGTCCACGG - Intronic
961403612 3:126663997-126664019 CCAATCCCAGAACTGGCACATGG - Intergenic
961420117 3:126796612-126796634 CCTGGCCCAGATATGCCCCAGGG + Intronic
962875502 3:139533158-139533180 CCCTGCCCAGATCAGGCACCCGG - Intronic
965117809 3:164514764-164514786 CCTTGCACAGAGCCAGCACATGG - Intergenic
967596997 3:191337740-191337762 CCTTACTCAGAGCTGGCATACGG - Intronic
967664996 3:192160437-192160459 CCATGCAAAGATGTGGCACAAGG - Intronic
968231531 3:197007558-197007580 CCATGCACAGATCTGGGACCAGG + Intronic
968480166 4:829778-829800 CCTGCCCCAGCTCTGGCAAACGG - Intergenic
968946017 4:3664702-3664724 CCGTGCTCAGAGCTGGGACATGG + Intergenic
969221395 4:5761199-5761221 CAAGGCCCAGACCTGGCACATGG + Intronic
969624866 4:8297316-8297338 CTTTCCCCAGCTCTGGCCCAGGG + Intronic
970479133 4:16455680-16455702 CCTTGCCAAGATCCAGCAAAGGG + Intergenic
970645506 4:18115843-18115865 CCTTGCCCAGAGCGAGCACATGG + Intergenic
974856462 4:67466683-67466705 CCTTGCCCATATCTATCCCAAGG - Intergenic
974948648 4:68560536-68560558 CCTTGCCCAGATCCCACAAAAGG - Exonic
974957675 4:68663007-68663029 CCTTGCCCAGATCCCACAAAAGG - Exonic
974967824 4:68784728-68784750 CCTTGCCCAGATCCCACAGAAGG + Intergenic
974979175 4:68932627-68932649 CCTTGCCCAGATCCCACAGAAGG - Exonic
975002962 4:69248073-69248095 CCTTGCCCAGATCCCACAGAAGG + Intergenic
975011241 4:69355428-69355450 CCTTGCCCAGATCCCACAGAAGG + Intronic
975254459 4:72216752-72216774 CCAGGCCCAGATCTGCCCCAGGG + Intergenic
975573923 4:75844321-75844343 CCTTGCTCAGATCTGAAACTGGG + Intergenic
977647487 4:99430242-99430264 CCTAGCCCAGTTCTTGCACCTGG + Intronic
980308627 4:131099258-131099280 CCTCACACAGAGCTGGCACAAGG - Intergenic
980707077 4:136512566-136512588 CCTTGCGCAGCTGTGACACATGG + Intergenic
991456367 5:66808623-66808645 CCTGGCCCTGATCTGGCAATGGG - Intronic
997439513 5:133899376-133899398 ACTTGCCCAGAGGTGGCACCAGG + Intergenic
997640824 5:135447896-135447918 CTTTGCACAGATCTGGCACAAGG + Exonic
998213930 5:140223288-140223310 CCTTCTCCTGCTCTGGCACATGG + Intronic
999777312 5:154821523-154821545 CCTTCTCCAGATCTGGGTCAAGG - Intronic
1001414903 5:171538629-171538651 TCTTGTCCAGCTTTGGCACAGGG - Intergenic
1001927252 5:175647319-175647341 CATTGCCCAGACCTACCACATGG - Intergenic
1002044083 5:176532365-176532387 CCTTCCCCAGAGCTGGCCCGGGG + Exonic
1002348000 5:178561378-178561400 TCTCACCCAAATCTGGCACAGGG - Intronic
1002525485 5:179813370-179813392 CCCTGCCCAGGTCTGCCCCAGGG - Intronic
1002535239 5:179872270-179872292 CCTTCCACAGAGCTGGCACCAGG - Intronic
1002607307 5:180390812-180390834 CCGTGCCCTGATCCTGCACAAGG - Intergenic
1004323490 6:14652108-14652130 CCGTGCCCATATCTCGCTCAGGG - Intergenic
1005416514 6:25605704-25605726 TCTTTCTCAGATCTGGCACAAGG - Intronic
1005842361 6:29752174-29752196 CCTTTGCTAGAGCTGGCACAGGG - Intergenic
1008566007 6:52769036-52769058 CCTTCCCCAGATCTCGCCCTAGG - Intergenic
1008570196 6:52809371-52809393 CCTTCCCCAGATCTCGCCCTAGG - Intergenic
1009848448 6:69164250-69164272 CCTAGCACAGTGCTGGCACATGG + Intronic
1012113396 6:95262988-95263010 ACTTGCCCAGATCTGTCACAAGG - Intergenic
1013630134 6:111978639-111978661 CCTAGCCCATGCCTGGCACACGG + Intergenic
1018825527 6:167405692-167405714 CCTAGCCCATGCCTGGCACATGG - Intergenic
1019811504 7:3168531-3168553 CCTGGCCAAGCTCTGGCACAGGG + Intronic
1022132409 7:27416626-27416648 CCTTGTCCTGCCCTGGCACACGG - Intergenic
1022807923 7:33841790-33841812 CCTAGCCCAGACCTGACACTCGG + Intergenic
1023521977 7:41058442-41058464 CCCTGAGCAGCTCTGGCACATGG - Intergenic
1024472919 7:49782161-49782183 CCCTGCCCAGCTCTGACAGATGG - Intronic
1024968007 7:55042359-55042381 ACCTTCCCAGAGCTGGCACAAGG + Intronic
1028149663 7:87357222-87357244 GCTTTCCCATATCTGGCAAAGGG + Intronic
1030982830 7:116206904-116206926 ACTTGCCAACATCTGGAACAAGG - Intergenic
1031859205 7:126958469-126958491 CCTTGCACAGAGCTGGCGCCTGG + Intronic
1035647400 8:1235819-1235841 CCGTGTCCAGTTCTGTCACATGG + Intergenic
1035647533 8:1237979-1238001 CCGTGTCCAGTTCTGTCACATGG + Intergenic
1035690160 8:1554726-1554748 GCTTGCCAAGTTCTGGAACATGG - Intronic
1035795594 8:2353920-2353942 CCTTGCCAAGATCTACCGCAGGG + Intergenic
1038182676 8:25243772-25243794 CCTTGCCCTCATCTGGCAGAAGG - Intronic
1038376944 8:27049271-27049293 TCTCGCACAGAGCTGGCACATGG - Intergenic
1038476816 8:27874446-27874468 CATTGGCCAGACCTGGCTCACGG - Intronic
1039854874 8:41403444-41403466 CCTTGCACTGATGTGGCACCGGG - Intergenic
1040106901 8:43546580-43546602 CTCTGCCAAGATCTGGCGCAGGG + Intergenic
1045615166 8:103900563-103900585 CCTGGCCCAAGTCTGGCCCATGG - Intronic
1047309808 8:123682691-123682713 CCTTGCCCCGTGCTGGGACACGG + Intronic
1047536518 8:125725095-125725117 CATTTCCCAGAAATGGCACAAGG + Intergenic
1047635607 8:126758907-126758929 CCAAGCACAGACCTGGCACATGG - Intergenic
1048534341 8:135278350-135278372 CCTTGAACAGGGCTGGCACATGG + Intergenic
1049207773 8:141371401-141371423 CCCTGGCCACAGCTGGCACAAGG + Intergenic
1049251113 8:141589496-141589518 ACTTGCCTGGATCTGGCACCAGG - Intergenic
1049592962 8:143470982-143471004 CGGTGCCCAGAGCTGGCACTGGG - Intronic
1049660172 8:143816232-143816254 CCCTGCCCAGGTCTCGCCCACGG + Intergenic
1049747243 8:144268219-144268241 CCTTGCCCAGCTCAGGTCCAAGG - Exonic
1049826730 8:144673889-144673911 CCTCGCACAGAGCTGGCACCTGG - Intergenic
1050452228 9:5795313-5795335 GCTTGCCTAGATCAGGAACAAGG + Intronic
1054767500 9:69054383-69054405 CCTTGCCCAAATCTGCCACCTGG - Intronic
1056708957 9:88975070-88975092 CCAGGCCCAGAACTGGCACTGGG - Intergenic
1058942982 9:109831352-109831374 CCTCTCACAGTTCTGGCACAGGG + Intronic
1061164396 9:128913912-128913934 CCATGCCCAGCCCAGGCACAGGG - Intronic
1061489288 9:130936376-130936398 ACAAGCCCAGAGCTGGCACAGGG + Intronic
1061713480 9:132503628-132503650 TCCTGCCCACCTCTGGCACAAGG - Intronic
1062286169 9:135773473-135773495 CCTTGCCCAGGGGTTGCACAGGG - Intronic
1185986983 X:4845684-4845706 CCTTGTCCATATCTGGCTCCAGG - Intergenic
1186510368 X:10125721-10125743 CCTGCCCCAAGTCTGGCACATGG - Intronic
1187177586 X:16910617-16910639 CCTGGCCCAGAACTGGCCCACGG - Intergenic
1191915120 X:66192819-66192841 TCTTGCCCATATCTGGGTCATGG - Intronic
1196043833 X:111234903-111234925 CTCTGCCCAGATCTGGCAGAGGG - Intergenic
1196906317 X:120439945-120439967 CTTGGACCAGATCTGGCCCATGG - Intronic
1199070572 X:143470396-143470418 CCTTGCCCATATATGGCCAATGG - Intergenic
1199771150 X:150976163-150976185 TCTTGCCCAGGGCTGGGACAAGG - Intergenic
1202018098 Y:20433795-20433817 CCTTGCAGAGACCTGGCAGATGG - Intergenic