ID: 1161397311

View in Genome Browser
Species Human (GRCh38)
Location 19:4051705-4051727
Sequence GCCCAGATCTGGCACAGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397300_1161397311 16 Left 1161397300 19:4051666-4051688 CCTTCTGCAAAGCCCACGGCAAG 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1161397311 19:4051705-4051727 GCCCAGATCTGGCACAGGGCCGG 0: 1
1: 0
2: 4
3: 47
4: 381
1161397305_1161397311 3 Left 1161397305 19:4051679-4051701 CCACGGCAAGGTCTCCGGGCTGC 0: 1
1: 0
2: 1
3: 14
4: 94
Right 1161397311 19:4051705-4051727 GCCCAGATCTGGCACAGGGCCGG 0: 1
1: 0
2: 4
3: 47
4: 381
1161397304_1161397311 4 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397311 19:4051705-4051727 GCCCAGATCTGGCACAGGGCCGG 0: 1
1: 0
2: 4
3: 47
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397311 Original CRISPR GCCCAGATCTGGCACAGGGC CGG Intronic
900557953 1:3289512-3289534 CCCCAGCCCTGGCACAGGGTGGG - Intronic
900598626 1:3493676-3493698 GCCCAGGACTGGCACAGGTAGGG + Intronic
900915153 1:5632375-5632397 CCCCAGTGCTGGCACAGGGAGGG - Intergenic
901193419 1:7425956-7425978 CCCCATGCCTGGCACAGGGCAGG - Intronic
901645989 1:10717008-10717030 GCACAGACCTAGCAGAGGGCTGG + Intronic
901713143 1:11131351-11131373 GCCTGGAGCAGGCACAGGGCTGG + Intronic
902256665 1:15193499-15193521 GTCCAGGTCCGGCACAGGACAGG - Intronic
902919116 1:19656164-19656186 CCCCAGAGCTGGCACAGGGTAGG + Intronic
903478151 1:23634628-23634650 GCCCTGAGCTGGGAGAGGGCAGG + Intronic
903678890 1:25083864-25083886 GGCTAAATCTGGCACAGGGTGGG - Intergenic
903685422 1:25128164-25128186 GCCCAGATCTGGCCCTTAGCAGG + Intergenic
903747315 1:25596512-25596534 TCCCAGATCTGGCTTAGGGAAGG + Intergenic
904286366 1:29455328-29455350 GTCCAGACCTGGCACATGGAAGG + Intergenic
904981908 1:34511017-34511039 GCCCAGATCTCATACAGAGCTGG + Intergenic
905207155 1:36349529-36349551 GCCCAGATGTGTCCCTGGGCAGG + Intronic
905454042 1:38075450-38075472 GCCCAGGTGTGGCCCAGGCCAGG - Intergenic
905774358 1:40659040-40659062 GCACAGATGTGGCAGAGGGAGGG + Intronic
905871072 1:41404902-41404924 GCCAGGCTCTGGCACAGAGCAGG - Intergenic
906276838 1:44523179-44523201 CCCCAGATGTGGCAGTGGGCAGG - Intronic
906522255 1:46474569-46474591 GACCAGAGTTGGCACTGGGCGGG - Intergenic
906522695 1:46476809-46476831 GCCCAGACCTGGCAGGGGTCAGG - Intergenic
907248184 1:53121186-53121208 CCCAAGGTCTGGCACAGGCCTGG + Intronic
907274498 1:53309812-53309834 GCCCAGCCCTGGCACGGGGCAGG + Intronic
908059792 1:60335313-60335335 GCCCATACCTGGCACAGCGGTGG - Intergenic
909438651 1:75673195-75673217 GCTCCCCTCTGGCACAGGGCAGG - Intergenic
909667688 1:78153944-78153966 GCCCTGCTCTGGTGCAGGGCAGG + Intergenic
912008690 1:104933519-104933541 GCCCCGTGCTGGCAGAGGGCGGG - Intergenic
912584498 1:110750106-110750128 GCCCAGAACTGGCTCTGGGCAGG + Intergenic
913012452 1:114697718-114697740 GCCCAGGTCTGAAACAGAGCAGG - Intergenic
913958026 1:143321052-143321074 GGCCAGATCTAGGACAAGGCTGG + Intergenic
913958191 1:143321622-143321644 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
914052336 1:144146410-144146432 GGCCAGATCTAGGACAAGGCTGG + Intergenic
914052506 1:144146997-144147019 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
914126691 1:144819544-144819566 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
914126861 1:144820131-144820153 GGCCAGATCTAGGACAAGGCTGG - Intergenic
915460216 1:156066054-156066076 GCTCAGATCTGGGACACAGCTGG + Exonic
915625572 1:157112117-157112139 CCCCAGCCCTGGCACCGGGCAGG + Intergenic
917505208 1:175621139-175621161 GCTCTGTTCTGGCACATGGCAGG + Intronic
918320504 1:183359704-183359726 GCCCAGATCTGGCTCAGCAGTGG + Intronic
918364006 1:183787524-183787546 GCACAGGTCTGGCACATGTCTGG - Intronic
920166887 1:204042343-204042365 GCACAGATCTGGGACACAGCAGG - Intergenic
920192235 1:204201103-204201125 GCCCAGGGCTGACACAGGCCTGG + Intronic
920228221 1:204453261-204453283 GCACAGATGAAGCACAGGGCAGG + Intronic
920396186 1:205647810-205647832 GCCCAGATTTGGCACCGAGGAGG - Intergenic
920572175 1:207025324-207025346 GCCCAGCTCTGGAGCTGGGCAGG + Intronic
923498161 1:234542628-234542650 GCCCAGCTCTGGGCCAGGGCTGG - Intergenic
924546548 1:245033139-245033161 GCACAGAGCTGGCACACGGCGGG + Intronic
924759453 1:246970638-246970660 TCCCAAAGCTGACACAGGGCTGG + Intronic
1063385077 10:5611318-5611340 GCCCAGGCCTGGCACACAGCAGG + Intergenic
1064115912 10:12577262-12577284 GCCTAGAGCTGGAACTGGGCTGG - Intronic
1065965392 10:30766420-30766442 GCACAGAGCTGGCAGAGGGAGGG + Intergenic
1067485968 10:46650249-46650271 GCCCAGAAGTGGCAATGGGCAGG + Intergenic
1067608788 10:47691404-47691426 GCCCAGAAGTGGCAATGGGCAGG - Intergenic
1069551395 10:69366913-69366935 GCCCATGCCTGGCACAGGGATGG - Intronic
1069604862 10:69732695-69732717 CCCCAGGCCTGGCACAGAGCAGG - Intergenic
1069614716 10:69799807-69799829 ACACAGTGCTGGCACAGGGCAGG - Intergenic
1070604734 10:77890801-77890823 GCTCAGAGATGGTACAGGGCTGG - Intronic
1070740922 10:78902715-78902737 GGGCTGGTCTGGCACAGGGCAGG + Intergenic
1071431518 10:85610685-85610707 GCACAGATGTGGCAGAGAGCTGG - Intronic
1071624371 10:87153051-87153073 GCCCAGAAGTGGCAATGGGCAGG - Intronic
1072282618 10:93881735-93881757 GCACAGATGTGGGACAGAGCAGG - Intergenic
1072547391 10:96450070-96450092 CACCAGACCTGGCACATGGCAGG + Intronic
1072696737 10:97609475-97609497 GCCCAGAGCTGGCACAGGAGAGG - Intronic
1073378902 10:103062735-103062757 GCTCAAATTTGGCAAAGGGCTGG - Intronic
1073563654 10:104517643-104517665 TCTAAGGTCTGGCACAGGGCTGG - Intergenic
1074079991 10:110160179-110160201 GCACAGATCTAGAACATGGCTGG - Intergenic
1074105125 10:110383459-110383481 CCCCACATCTGACACAGGTCTGG - Intergenic
1075095113 10:119466164-119466186 GTCCAGACCTGGCTCAGGGGAGG + Intergenic
1075578539 10:123598469-123598491 GTCCAGACCTGGCACAAGGTGGG + Intergenic
1075677078 10:124303297-124303319 GGCCAGATGTGGCACAGTTCTGG - Intergenic
1076481478 10:130787946-130787968 GCCCAGCTCCTGCACATGGCAGG + Intergenic
1076567130 10:131406577-131406599 GCCCAGCCCTGGCACAGAGCAGG - Intergenic
1076753770 10:132557370-132557392 GCGCAGGTGTGGCACAGGCCAGG - Intronic
1076871546 10:133197333-133197355 ACCCAGATCAGGATCAGGGCAGG + Intronic
1076924462 10:133475482-133475504 GCACAGATAGGGCACAGTGCAGG - Intergenic
1077019906 11:412736-412758 GCCCAGCTCTGGCCCACGTCTGG + Intronic
1077219973 11:1411488-1411510 GCCCAGGTCTGGCCCAGCGGTGG + Exonic
1077506724 11:2933000-2933022 GCACAGAACTAGCACGGGGCAGG - Intergenic
1077640198 11:3874364-3874386 GCCCTGATCTGGCAAATGGTGGG - Intronic
1078750984 11:14163546-14163568 CCCCATACCTGGCAAAGGGCTGG + Intronic
1078871804 11:15353554-15353576 GCCCAGACCTGGCACATAGTAGG - Intergenic
1079104879 11:17564157-17564179 GCACAGAGCTGGCACAGGGCTGG - Intronic
1079273989 11:19016478-19016500 GCCCAGTACTGGCACAGTACAGG + Intergenic
1081586232 11:44385892-44385914 GTCCAGATCTCAAACAGGGCTGG + Intergenic
1081921321 11:46779924-46779946 GCCCAGATCAGAAACAGAGCAGG - Intronic
1083304444 11:61755234-61755256 GCCCACCACCGGCACAGGGCAGG - Intronic
1083718180 11:64591063-64591085 CCCAAGACCTGGCACAGAGCAGG + Exonic
1084389472 11:68865661-68865683 GCCCAGAGCTCCCACAGGCCAGG - Intergenic
1084608608 11:70186792-70186814 TCCCAGTTCTGTCACAGGGCAGG + Intronic
1085008159 11:73114334-73114356 GCTCCCATCTGGCCCAGGGCAGG + Intronic
1085896956 11:80651247-80651269 GCACAGTTCTGGCACAAAGCAGG - Intergenic
1086101355 11:83103186-83103208 CCCAAGATCTAGCACAGGCCTGG - Intergenic
1087876966 11:103370060-103370082 GCTCACCTCTGGCCCAGGGCAGG - Intronic
1088573510 11:111247116-111247138 GCCAAGTTGTGGCACATGGCAGG + Intergenic
1089608517 11:119656256-119656278 GCCCAGAGCTAGCACAGAGTGGG - Intronic
1089652396 11:119922807-119922829 GGTCAGATCTGACACAGGCCAGG - Intergenic
1089679075 11:120109483-120109505 GCCCAGAGCTGGGAGAGGGCAGG + Intergenic
1091645193 12:2267806-2267828 TCCCAGATGTGCCACAGGGAAGG - Intronic
1091765494 12:3117572-3117594 GCCCAGCTCTGCCCCGGGGCAGG + Intronic
1092033338 12:5308591-5308613 GCCCAGGTCTTGCACACAGCAGG - Intergenic
1093012736 12:14126057-14126079 GCCCAGGTCAGAAACAGGGCAGG + Intergenic
1095895038 12:47271341-47271363 GCACAGACCTGGCATAGGGTAGG + Intergenic
1097950326 12:65419935-65419957 GCCCAGCTATGGCACCTGGCTGG - Intronic
1099285158 12:80707939-80707961 GCCCAGATCAGACACTGGCCGGG - Exonic
1100366636 12:93927380-93927402 GCTCAGAGCGGGCACAGGGATGG - Intergenic
1100608322 12:96170000-96170022 GCCCAGATGTGGCCAAGGGCTGG + Intergenic
1102204825 12:111083257-111083279 ACCCAGAACTGGGGCAGGGCAGG + Intronic
1102206987 12:111097567-111097589 CCCCAGATCTGGCCCCGGGTAGG - Intronic
1103429708 12:120872707-120872729 TCCCAGAGCTCCCACAGGGCTGG + Intronic
1103939301 12:124493168-124493190 GCCCAGTTGGGGCAAAGGGCAGG + Intronic
1104287424 12:127437126-127437148 GACCACCTCTGGCACAAGGCAGG - Intergenic
1106454611 13:29916271-29916293 GGCAATACCTGGCACAGGGCAGG - Intergenic
1107800926 13:44107429-44107451 GCCCTGAGCTGACACAGTGCAGG + Intergenic
1108015582 13:46072019-46072041 GCCAAAATCCGGCACAGGGCTGG - Intronic
1108532346 13:51339481-51339503 GCCCAGATCGGGAACAGAGCAGG - Intronic
1113011528 13:105772983-105773005 GCCCTGTTCTGAAACAGGGCAGG - Intergenic
1113424925 13:110199952-110199974 GCCCACGCCTGGCTCAGGGCAGG - Intronic
1113781332 13:112979308-112979330 GCCCAGAACTTGCACACAGCAGG + Intronic
1114049717 14:18913186-18913208 GCCCAGAGCTGGCACATAGCAGG - Intergenic
1114242332 14:20880079-20880101 GCCCCGTTCTGGCACAGGGTAGG - Intergenic
1114415482 14:22540198-22540220 GCCCCCAGCTGGCAGAGGGCAGG + Intergenic
1118764006 14:68898072-68898094 GCTCAGATCTGGGGCAGAGCAGG + Intronic
1119740181 14:77008978-77009000 TCCCAGCTCTGGCCCAGGGGTGG - Intergenic
1121005706 14:90489390-90489412 GCCCAGTGCTGGGACAGGGAAGG - Intergenic
1121152977 14:91654350-91654372 GCCCCACTCTGGCCCAGGGCAGG - Intronic
1121245881 14:92460548-92460570 GCCCAGACCTGGCACATAACAGG - Intronic
1121325114 14:93015350-93015372 GCCCAGCCCTGGCACAGGGCAGG + Intronic
1121645782 14:95516490-95516512 GCCCAGCTCTGACACAGCCCCGG - Intronic
1121715076 14:96068006-96068028 GCCCATATCTGGCATATAGCGGG + Intronic
1122203470 14:100136551-100136573 GCACAGGCCTGGCACAGAGCAGG - Intronic
1122306126 14:100767935-100767957 GCCCAGGGATGGCACAGAGCAGG + Intergenic
1122364340 14:101185585-101185607 GCCAAGAGCTGGCCCGGGGCTGG - Intergenic
1122825605 14:104369034-104369056 GCCCAGGCCTCGCCCAGGGCTGG + Intergenic
1122956818 14:105075059-105075081 GCCCAGACCTGGCACCCAGCAGG - Intergenic
1202930206 14_KI270725v1_random:28526-28548 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1123422169 15:20142974-20142996 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
1123442906 15:20303643-20303665 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1123531397 15:21149514-21149536 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
1124034588 15:26043140-26043162 GCCCATATCTGTCAGGGGGCAGG - Intergenic
1124343298 15:28903750-28903772 GCCAGGACCTGGCACAGGGGAGG + Intronic
1125608004 15:40953156-40953178 GCCCAGGGCGGGCACCGGGCGGG - Exonic
1126329962 15:47521479-47521501 TGCCAGAGCTGGCACATGGCAGG + Intronic
1126583575 15:50262408-50262430 GCACAGAGCTGGCACATGGCAGG + Intronic
1126660648 15:51030276-51030298 TCCCACCTCTGGCCCAGGGCAGG + Intergenic
1126733936 15:51712825-51712847 GCCCAATTCTGGCAGGGGGCGGG - Intronic
1127902772 15:63353463-63353485 GCTCAGCCTTGGCACAGGGCAGG - Intronic
1129385253 15:75192677-75192699 GCCCAGAGCTGGTGCAGGGTGGG + Intergenic
1129556275 15:76513163-76513185 CCCCAGTCCTGGCACAGAGCAGG + Intronic
1129559010 15:76545958-76545980 TCCCAGAGCTCACACAGGGCAGG + Intronic
1131110057 15:89759298-89759320 CCCGAGGTCTGGCACTGGGCTGG + Intergenic
1131175541 15:90207090-90207112 GACCATCTCTGCCACAGGGCAGG - Intronic
1132508012 16:322183-322205 TCCCAGGCCTGGCTCAGGGCAGG + Intronic
1132738010 16:1397050-1397072 GCCGAGGGCTGGCACAGGTCGGG - Intronic
1132789963 16:1680220-1680242 GCACACAACTGGGACAGGGCTGG - Intronic
1133162697 16:3922495-3922517 GCCCAGAAGTTGGACAGGGCAGG + Intergenic
1133166166 16:3949263-3949285 ACCCACATCTGGCTCAGGACTGG - Intergenic
1134243522 16:12523192-12523214 GCACAGAGCTGGCCCAAGGCAGG - Intronic
1135247422 16:20869028-20869050 GGCCAGCGCTGGCACAGGGGAGG - Intronic
1135538882 16:23314922-23314944 GCCCAACTCTGGCACAAGGTGGG + Intronic
1137765376 16:50973758-50973780 GCCCAGACTTGGCACAGCACTGG - Intergenic
1137910867 16:52376821-52376843 GCCCAGACCTGAGACAGGGAGGG + Intergenic
1138386609 16:56639640-56639662 CCCCAGACCTGGCAGAAGGCTGG - Intronic
1138533710 16:57648771-57648793 ACCCAGCTCTGCCACAGGGCCGG + Intronic
1140640293 16:76964370-76964392 GCCCACATCAGGCACAGTGCAGG + Intergenic
1141253293 16:82378485-82378507 GCTGAGCTCTGGCAAAGGGCAGG + Intergenic
1141455008 16:84135543-84135565 GCCCAGAACTGGCAGAGAGAAGG - Exonic
1142219918 16:88849018-88849040 GCCCAGACCTGGCCCAGCTCTGG - Intronic
1142254285 16:89006534-89006556 GCTCAGAGCTGCCCCAGGGCTGG + Intergenic
1142312281 16:89321012-89321034 GCCCAGGGAAGGCACAGGGCAGG + Intronic
1203124317 16_KI270728v1_random:1561435-1561457 GGCCAGATCTAGGACAAGGCTGG - Intergenic
1142743479 17:1943407-1943429 GCCCTGCTCAGGCACAGGGAGGG - Intronic
1143175651 17:4953495-4953517 GCCCAGGCCTGGCAGAAGGCAGG - Intronic
1143220334 17:5256106-5256128 GCCCAGATCTGGCAGAGGTTGGG + Intergenic
1143388442 17:6545890-6545912 GCCCTGACCTGGCACAGGATAGG - Intronic
1143837154 17:9701560-9701582 GCCCAGTCCTGCCTCAGGGCTGG - Exonic
1144004418 17:11087322-11087344 TCCCAGATCTCACACAGGCCTGG - Intergenic
1145053084 17:19679382-19679404 CCCCAGCTCTGCCCCAGGGCTGG - Intronic
1145788562 17:27609980-27610002 GCACAGGTCTGCCCCAGGGCCGG - Intronic
1147238454 17:39074765-39074787 GCCCAGCACTGGGCCAGGGCGGG - Intronic
1147643766 17:42021258-42021280 GCCAGTATCTGTCACAGGGCAGG - Intronic
1147995087 17:44355836-44355858 GCCCTCGCCTGGCACAGGGCTGG - Exonic
1148124982 17:45231827-45231849 GACCAGAGCTGGCATACGGCGGG - Intronic
1149792976 17:59495265-59495287 GCAAAGATCAGGCAAAGGGCAGG - Intergenic
1150227285 17:63530952-63530974 GCAAAGGGCTGGCACAGGGCTGG - Intronic
1151277142 17:73043673-73043695 ATCCAGATGTGACACAGGGCAGG + Intronic
1151383766 17:73742963-73742985 GCCCAGACCTGGCCCAGGCGGGG + Intergenic
1151536721 17:74743123-74743145 TCCCAGATCTGGGACACCGCTGG + Exonic
1151639823 17:75383339-75383361 GCTGAGCTCTGGGACAGGGCTGG + Intronic
1151663325 17:75531278-75531300 GCGCAGATCTCCCACAGTGCGGG - Intronic
1152122298 17:78426321-78426343 GCCCTGATCTGACAGAGGACAGG + Intronic
1152790795 17:82278112-82278134 TCCCAGATCTCAGACAGGGCGGG + Intergenic
1153453861 18:5259561-5259583 GCTCCCATCTGGCCCAGGGCAGG - Intergenic
1154040502 18:10850290-10850312 GCCGATGTGTGGCACAGGGCTGG - Intronic
1154386606 18:13898118-13898140 GCTCACCTCTGGCCCAGGGCTGG - Intronic
1156295046 18:35781873-35781895 GCACAGAGCTGGCACATGGCAGG - Intergenic
1156744582 18:40373345-40373367 GCTGACATCTTGCACAGGGCTGG + Intergenic
1157056376 18:44233961-44233983 GCTTGGATCTGGCACAGGACAGG + Intergenic
1157545227 18:48541468-48541490 GCCCAGATCGGGCCCTGGGCAGG - Intronic
1157761025 18:50265951-50265973 CCCCAGATCTGTCTCTGGGCCGG + Intronic
1160932070 19:1575565-1575587 ACCCAGACCTGGCATGGGGCGGG - Intronic
1161397311 19:4051705-4051727 GCCCAGATCTGGCACAGGGCCGG + Intronic
1161662869 19:5557961-5557983 GCCCAGATATGGGAGGGGGCTGG + Intergenic
1162111056 19:8400006-8400028 GCGCAGATCTGGGACACCGCTGG + Exonic
1162531655 19:11239647-11239669 GCCCAGAGCAGGCACAGAGCAGG - Exonic
1162573066 19:11483544-11483566 GCCCAGCTCTGGGGCGGGGCGGG + Exonic
1163491246 19:17618274-17618296 GCCCAGCTCTGGCACAGACAGGG + Intronic
1164670899 19:30071376-30071398 CCCCCGATCTGGCACCGGGGTGG + Intergenic
1164862520 19:31573512-31573534 GCCCAGGAATGGCTCAGGGCTGG + Intergenic
1165144164 19:33720940-33720962 GCCCAGACCTGGCCCAAGCCAGG + Intronic
1165388609 19:35526067-35526089 GCCCAGCTTTGGCAGAGGGCAGG - Intronic
1165749499 19:38251508-38251530 GCCCAGGTCAGGGACTGGGCTGG - Intronic
1167356310 19:49006386-49006408 GCCTGAAACTGGCACAGGGCAGG - Intronic
1167514115 19:49913028-49913050 GCTCAGGGCAGGCACAGGGCCGG + Intronic
1168096806 19:54120523-54120545 GCTCAGATCTGACACCAGGCAGG - Intronic
1168467583 19:56616554-56616576 GACCGGAGCTGACACAGGGCTGG - Intronic
1202691733 1_KI270712v1_random:98834-98856 GGCCAGATCTAGGACAAGGCTGG + Intergenic
1202691904 1_KI270712v1_random:99421-99443 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
925293207 2:2762125-2762147 GCTCAGAACTTGCAGAGGGCAGG + Intergenic
925701954 2:6647770-6647792 ACCCAGAGCTGGCGCAGGGGAGG + Intergenic
926748761 2:16181642-16181664 GCCCAGGACAGCCACAGGGCAGG + Intergenic
927146916 2:20172339-20172361 GCCCAGACCTGGGAGTGGGCAGG - Intergenic
927862075 2:26566282-26566304 GCCCACATCTGTCACTGAGCTGG + Intronic
928209987 2:29316366-29316388 GCCAAGTTCTGGAAAAGGGCAGG + Intronic
930187587 2:48425889-48425911 GCCAAGATCTGGGAAAGGCCAGG + Intergenic
930288828 2:49467875-49467897 GCCCTGCTCTGGCCCAGGGTAGG + Intergenic
933842429 2:86298283-86298305 GGGCAGATGTGGCACAGGGATGG + Intronic
933954489 2:87354535-87354557 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
933954655 2:87355116-87355138 GGCCAGATCTAGGACAAGGCTGG - Intergenic
934238682 2:90250755-90250777 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
934238852 2:90251342-90251364 GGCCAGATCTAGGACAAGGCTGG - Intergenic
934274344 2:91565368-91565390 GGCCAGATCTAGGACAAGGCTGG + Intergenic
934274511 2:91565955-91565977 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
934322795 2:91983290-91983312 GCCCAGAGCAGGGACAGGACAGG - Intergenic
934461104 2:94214086-94214108 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
936511261 2:113149487-113149509 GCTCCCATCTGGCCCAGGGCAGG + Intergenic
936692065 2:114901726-114901748 GCCCAGATCAGCCACAGACCAGG + Intronic
937301732 2:120846881-120846903 GCCCAGGCCTTGCACAGCGCGGG + Intronic
937641813 2:124221008-124221030 GCCCAAATGTGGGACAGGGTGGG - Intronic
938120632 2:128630916-128630938 ACGCACAGCTGGCACAGGGCAGG + Intergenic
938163694 2:129008625-129008647 ACCCACAGCTGGCACAGAGCAGG - Intergenic
938168782 2:129056799-129056821 TTCCACATCTGGCACAGGGCCGG - Intergenic
938727058 2:134118736-134118758 GCCCAGAGCTTGCTCAGTGCAGG + Intergenic
938954877 2:136288212-136288234 GCCCAGATCCGTGAAAGGGCAGG + Intergenic
941820613 2:169840685-169840707 GCAGAGAACTGTCACAGGGCAGG - Intronic
942391763 2:175502460-175502482 GCTCCGCTCTGGCCCAGGGCAGG + Intergenic
943111210 2:183608251-183608273 GCCGCGATCTCGCACAGGGTCGG - Intergenic
944541878 2:200761809-200761831 GCCCAGTTCCCCCACAGGGCAGG - Intergenic
944694134 2:202186021-202186043 AACCAGACCTGGCACAGAGCAGG + Intronic
947321032 2:228919368-228919390 ACCCAGATCTGCTACAGGGAAGG + Intronic
948005369 2:234603822-234603844 GCCCAGGGCTGGCCCAGGCCTGG + Intergenic
948317755 2:237042209-237042231 GGCCAGGTCTGGGACAGGACTGG - Intergenic
948405194 2:237712084-237712106 GCCCAGCTCTGCCACACGGCAGG - Intronic
948478844 2:238238502-238238524 CCCCAGAGCCCGCACAGGGCTGG + Exonic
948534733 2:238637425-238637447 CCACAGATATGGCACAGGGGTGG + Intergenic
948560733 2:238849374-238849396 GGCCAGAGCAGCCACAGGGCCGG + Intronic
948808637 2:240463631-240463653 ACCCAGATCTGGCCCGGGTCAGG - Intronic
948894143 2:240920493-240920515 GCCCAGCACTGGCACAAAGCTGG + Intronic
1168756901 20:324619-324641 GCCCAAGTCGGGCACCGGGCAGG + Intergenic
1169263232 20:4152572-4152594 GTCCAGATCTGGGATGGGGCTGG + Intronic
1170484744 20:16805003-16805025 GACCAGAGCTGTGACAGGGCTGG - Intergenic
1171393968 20:24819060-24819082 GCCCAGATCTGGCTCTGGTGGGG + Intergenic
1172619537 20:36309828-36309850 CCCCAAGCCTGGCACAGGGCTGG - Intronic
1172844364 20:37920966-37920988 GCCCAGATCAGGCACACAGGAGG - Intronic
1172933866 20:38605170-38605192 CTCCAGCACTGGCACAGGGCTGG + Intronic
1173223223 20:41146187-41146209 GCCCAGGCCTGGCACAGAGGAGG + Intronic
1173733170 20:45342368-45342390 GGGCAGATGTGGCACATGGCTGG - Intronic
1174121516 20:48269274-48269296 TCACACAGCTGGCACAGGGCAGG - Intergenic
1175860784 20:62149032-62149054 GCCCAGACCGCGCAAAGGGCCGG - Intronic
1175946610 20:62561997-62562019 GCCCAGACCTGGCAGAGAGGTGG - Intronic
1176149343 20:63581372-63581394 GCCCAGAGCAGCCCCAGGGCAGG - Intergenic
1176187929 20:63791656-63791678 GCCCAGCACTGGGACAGGGCAGG + Intronic
1176592219 21:8657108-8657130 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1177081758 21:16648233-16648255 TCCCAGAGCTCACACAGGGCTGG - Intergenic
1177761460 21:25406867-25406889 GCTCCGCTCTGGCTCAGGGCAGG + Intergenic
1179532269 21:42027983-42028005 CCCCAGACCTGGCGCATGGCTGG + Intergenic
1179578097 21:42320235-42320257 GCCCAGGACTGGCTCAGTGCAGG - Intergenic
1180275070 22:10634237-10634259 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1180623943 22:17181594-17181616 GCCCAGGTCAGCCTCAGGGCAGG + Intronic
1180845090 22:18976425-18976447 GCACAGGCCTGGCACACGGCAGG - Intergenic
1180955713 22:19740329-19740351 CCCCTCATCTGGCACAAGGCTGG + Intergenic
1181028655 22:20139663-20139685 GCAGGGATGTGGCACAGGGCTGG - Intronic
1182045555 22:27271198-27271220 GCACAGCTCAGGCACTGGGCAGG + Intergenic
1183229557 22:36572893-36572915 GCCCAGGTCTAGCACAGCGGTGG - Intronic
1184017903 22:41799976-41799998 CCCCAGAACAGGCGCAGGGCAGG - Intergenic
1184090998 22:42293006-42293028 GCCCAGCTCTGGGGCAAGGCAGG + Intronic
1184106728 22:42371709-42371731 GCCCTGCTCTGGCACCAGGCTGG - Intergenic
1184112885 22:42405560-42405582 GCCCAGGCCGGGCACATGGCAGG + Intronic
1184667551 22:45996803-45996825 GCCCAGGTCTGGCATCGGGGTGG + Intergenic
1184835577 22:47019115-47019137 GCCCACATCCAGCACAGGGAGGG + Intronic
1185161679 22:49233740-49233762 GCCTAGATCGGGGACAGGTCTGG - Intergenic
1185316775 22:50182754-50182776 GGCCAGCTCCAGCACAGGGCAGG - Intergenic
1185419111 22:50725560-50725582 GACCAGATCTGAAACAGGACTGG - Intergenic
949431027 3:3976252-3976274 TCCCAGATCTCACACAGGGCTGG - Intronic
950261483 3:11545618-11545640 GCCCAGAGAGGGGACAGGGCTGG - Intronic
950533800 3:13568181-13568203 GCCCAGACCAGGCTCAGGGCCGG - Intronic
950865379 3:16184423-16184445 GCCCAGAGGTGGGAAAGGGCTGG - Intronic
951508973 3:23480314-23480336 GCCCAGAGCTGGGAGAGGCCAGG + Intronic
952179685 3:30904625-30904647 GTCCAAATCTGGGACAGGGCAGG + Intergenic
952871573 3:37905598-37905620 GCCCAGCTGTGGCACAAGGAGGG - Intronic
953352063 3:42223141-42223163 CCCCAGAGCTGGGACAGGGCCGG + Exonic
953774802 3:45807302-45807324 GCACAGAACTGGCACTGGGTTGG + Intergenic
954219496 3:49144308-49144330 GCCCATTGCAGGCACAGGGCTGG + Intergenic
954331259 3:49891591-49891613 GCGCAAGTCAGGCACAGGGCAGG + Intronic
958971038 3:100610563-100610585 GGCCAGCTCTGGCACACAGCGGG - Intronic
960490773 3:118314282-118314304 GCTCCCATCTGGCCCAGGGCAGG - Intergenic
961303004 3:125934085-125934107 CCACAGATCTGCCACAGGCCTGG + Intronic
961420118 3:126796616-126796638 GCCCAGATATGCCCCAGGGAAGG + Intronic
962238999 3:133734336-133734358 TCCCAGAGCTGGTACAGGGAAGG + Intergenic
962276753 3:134020406-134020428 GCCGAGATGTTGCACAGGGCAGG - Intronic
962740312 3:138358594-138358616 GCACATATCTGGCACAGAGAAGG - Intronic
962779613 3:138699904-138699926 GCCTAGATCTTACACAGGCCAGG + Intronic
965380642 3:167983419-167983441 GCTCCTATCTGGCCCAGGGCAGG - Intergenic
965694116 3:171389411-171389433 GTACAGAACTGGCACAGAGCAGG - Intronic
965773925 3:172209242-172209264 GCCTAGTGCTGGCAGAGGGCGGG + Intronic
965980319 3:174681882-174681904 CCCCACCTCTGGCTCAGGGCAGG - Intronic
967299642 3:188000455-188000477 GCCCTGATCAGGCACGGGGCTGG + Intergenic
968231532 3:197007562-197007584 GCACAGATCTGGGACCAGGCAGG + Intronic
968441725 4:627775-627797 GCCCAGATTTGGGACAGGGTGGG - Intronic
968547136 4:1205178-1205200 GACCAGACTTTGCACAGGGCAGG + Intronic
969221396 4:5761203-5761225 GCCCAGACCTGGCACATGGTAGG + Intronic
969275602 4:6133808-6133830 GCCCAGAAGTGACACAGGTCAGG - Intronic
971198056 4:24488063-24488085 CCCCAGCTCTGGCACAGGAGTGG + Intergenic
971223773 4:24732918-24732940 GCCCAGAATTGGCTCAGGGCTGG + Intergenic
973730228 4:53815949-53815971 GCCCAGCTCTGGCCCAGGTATGG + Intronic
978330472 4:107607784-107607806 GCCCAGTGCTGGTACAGGTCCGG + Intronic
979490564 4:121322217-121322239 GGCTAGATCTGACACAGAGCAGG + Intergenic
979621574 4:122804413-122804435 GACCAGAGGTGGCACAGGGCAGG + Intergenic
979724315 4:123942382-123942404 GCCCAGTGCTGGCAGAGGGTGGG - Intergenic
980442533 4:132867480-132867502 GCTCCCATCTGGCCCAGGGCAGG - Intergenic
981298095 4:143156173-143156195 GCTCACCTCTGGCCCAGGGCAGG + Intergenic
985591403 5:767215-767237 ACCCAGGTCTGCCACAGGCCAGG - Intergenic
986543761 5:8873383-8873405 GCCCTGATCTCTGACAGGGCTGG - Intergenic
987089772 5:14500420-14500442 GTCCAGCTCTGGCTCAAGGCAGG + Intronic
989721612 5:44535364-44535386 GGTTAGATCTGGCACTGGGCAGG - Intergenic
990120681 5:52447275-52447297 GGCCAGACCAGGCATAGGGCAGG + Intergenic
992774889 5:80080448-80080470 GCCCAGAGGTGCCACAGGGGAGG - Intronic
997640826 5:135447900-135447922 GCACAGATCTGGCACAAGGTGGG + Exonic
997816823 5:137027417-137027439 GCACTGCTCTGGGACAGGGCAGG - Intronic
998315415 5:141178697-141178719 GCCCAGATCTGGCACTGCTCAGG + Exonic
998319343 5:141214786-141214808 GCCCAGATCTGGCACTGCTCAGG + Exonic
1001490645 5:172152406-172152428 ACCAAAATCTGGCTCAGGGCTGG + Intronic
1001604556 5:172950694-172950716 GCACAGATCTGCAAGAGGGCAGG - Exonic
1001843135 5:174897478-174897500 TCCCAGATCTTACACATGGCTGG - Intergenic
1002203925 5:177549705-177549727 GCCCAGGCCTGGCACAGAGCTGG + Intronic
1002347999 5:178561374-178561396 ACCCAAATCTGGCACAGGGCTGG - Intronic
1002696093 5:181092181-181092203 CTCCACATCAGGCACAGGGCTGG + Intergenic
1004323489 6:14652104-14652126 GCCCATATCTCGCTCAGGGCAGG - Intergenic
1006460687 6:34155893-34155915 GGACAGACATGGCACAGGGCTGG - Intergenic
1006554214 6:34852024-34852046 GCCCCTCTCTGGCCCAGGGCAGG + Intronic
1009848449 6:69164254-69164276 GCACAGTGCTGGCACATGGCAGG + Intronic
1010489056 6:76452547-76452569 GCCCTGCGCTGGCAGAGGGCAGG + Intergenic
1013923253 6:115435898-115435920 GCACAGACCTGGCACATGGTAGG - Intergenic
1015359853 6:132327361-132327383 GCACAGATCTGGCACATAGTTGG + Intronic
1019495670 7:1339227-1339249 GCCCAGTGCTGACTCAGGGCTGG - Intergenic
1020698393 7:11445804-11445826 GCCCAAATCTTGCAAAGGGTAGG - Intronic
1021641004 7:22735945-22735967 GCCTCTCTCTGGCACAGGGCAGG - Intergenic
1022497781 7:30863965-30863987 GCCCAGGTCTGGTTCAGAGCTGG - Intronic
1022749854 7:33213384-33213406 GCTCCCATCTGGCCCAGGGCAGG + Intronic
1023610190 7:41964902-41964924 CCCCAAAGCTGGCACATGGCTGG + Exonic
1023616888 7:42029133-42029155 GCACAGACCTGGGCCAGGGCAGG + Intronic
1024317492 7:48035347-48035369 GCCCAGAGCCGGACCAGGGCAGG - Intergenic
1024828517 7:53420817-53420839 ACCCAGATCTGGCTCAGAGATGG + Intergenic
1024968009 7:55042363-55042385 TCCCAGAGCTGGCACAAGGCTGG + Intronic
1026115144 7:67489692-67489714 TCCCATGTCTGGCACACGGCAGG - Intergenic
1026910187 7:74087044-74087066 GCCCTGCTCTGGCTCAAGGCAGG - Intronic
1027685327 7:81273582-81273604 GCTCACATCTGGCTCAAGGCAGG + Intergenic
1029253863 7:99255696-99255718 GGGCAGAGCTGGCACAGGACGGG + Intergenic
1033499914 7:141937268-141937290 GCTCCTATCTGGCTCAGGGCAGG - Intronic
1034989365 7:155538440-155538462 CCCCAGATCTGCCACAGTTCAGG - Intergenic
1035044064 7:155952624-155952646 CCCCACACCTGGCCCAGGGCAGG - Intergenic
1035332209 7:158103692-158103714 GCACTGACCTGGCACAGAGCAGG - Intronic
1035606804 8:934725-934747 CCCGAGAGCCGGCACAGGGCTGG - Intergenic
1036692083 8:10950383-10950405 CCCCAGCCCTGGCACAGGGAGGG - Intronic
1038376942 8:27049267-27049289 GCACAGAGCTGGCACATGGCGGG - Intergenic
1038680688 8:29664302-29664324 GCCCAGACCTGACAAAGGGAAGG - Intergenic
1039429133 8:37511904-37511926 GCCCATATCTGTCCCAGGGCTGG + Intergenic
1039866684 8:41511303-41511325 GCCCAGCTATGGCACCTGGCCGG + Intergenic
1040389205 8:46935193-46935215 ACCCTCATCTGGCAGAGGGCTGG - Intergenic
1041292621 8:56321095-56321117 GCCCATATCTGGGACAGGTCTGG + Intergenic
1042616403 8:70654667-70654689 GCCCAGATCGGAAACAGAGCAGG - Intronic
1043432267 8:80206484-80206506 GCCCAGATTTGACACTGGTCAGG + Intronic
1044253776 8:90036001-90036023 TCCCAGAGCTTGCATAGGGCTGG - Intronic
1049252300 8:141595802-141595824 GCCCAGAGCAGGCACAGGGCCGG + Intergenic
1049660174 8:143816236-143816258 GCCCAGGTCTCGCCCACGGCAGG + Intergenic
1049734747 8:144199045-144199067 GCCCAGAATTGTCAGAGGGCGGG + Intronic
1051041582 9:12818741-12818763 GCCCAGAGCTGGGAATGGGCTGG + Intronic
1051840316 9:21389499-21389521 ACCCAAAGCTGGCACAAGGCAGG + Intergenic
1052111262 9:24585599-24585621 GCCCAGATCTGTCAGAGGAATGG + Intergenic
1052337700 9:27337024-27337046 GCCAAGCTCGGGCACGGGGCCGG - Intronic
1053691588 9:40589746-40589768 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
1054273214 9:63047739-63047761 GCCCAGAGCTGGGCCAGGACCGG + Intergenic
1054302844 9:63390712-63390734 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
1054401625 9:64717228-64717250 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
1054435228 9:65201537-65201559 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
1054495162 9:65820144-65820166 GCCCAGAGCTGGGCCAGGACCGG + Intergenic
1057309515 9:93933350-93933372 GCTCAGCTCCGCCACAGGGCAGG - Intergenic
1057477044 9:95411710-95411732 GCACAGGCCTGGCACATGGCAGG - Intergenic
1058747932 9:108009838-108009860 TCCAAGACCTGGCACAGGCCTGG - Intergenic
1058877248 9:109255069-109255091 GAACAGTTCTGGCACAGTGCTGG + Intronic
1059328612 9:113520327-113520349 GGCCAGAGCTGGCACACAGCTGG - Intronic
1059422160 9:114198937-114198959 GCACAGGGCTGGCACACGGCTGG + Intronic
1059900588 9:118921204-118921226 GCTCATCTCTGGCCCAGGGCAGG + Intergenic
1060053345 9:120392515-120392537 GCCCTGAACAGTCACAGGGCAGG - Intronic
1060790195 9:126480721-126480743 GGCCAGCGCTGGCACAGAGCAGG - Intronic
1060897467 9:127226466-127226488 GCCCAGAGCTGGCTCAGGCCTGG + Intronic
1061271393 9:129545521-129545543 GCCCCGGTCTGACACAGGGCTGG + Intergenic
1061318169 9:129810487-129810509 GCTGAGATATGGCACAAGGCAGG - Exonic
1061432359 9:130539194-130539216 GCTCAGTAGTGGCACAGGGCGGG + Intergenic
1061541277 9:131278852-131278874 GCCCACAGCCGGCACAGGGCAGG + Intergenic
1061671518 9:132191145-132191167 ACCCAGCCCGGGCACAGGGCTGG + Intronic
1061907722 9:133707446-133707468 GCCCAGAGTGGTCACAGGGCTGG - Intronic
1062036510 9:134384945-134384967 GCCAAGATGTCACACAGGGCTGG - Intronic
1062174223 9:135152003-135152025 GCCCAGATGTGGCACAAGCAGGG + Intergenic
1062288983 9:135786188-135786210 ACCGAGATCTGGGACTGGGCAGG - Exonic
1062390410 9:136331520-136331542 CCCCAGGCCTGGCCCAGGGCTGG - Intronic
1203622272 Un_KI270749v1:135955-135977 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1187132796 X:16518527-16518549 GCTCCCATCTGGCCCAGGGCAGG - Intergenic
1188911545 X:35854255-35854277 GTCCAGTTCTTCCACAGGGCTGG - Intergenic
1189494814 X:41499505-41499527 ACCAGTATCTGGCACAGGGCAGG - Intergenic
1189988378 X:46573646-46573668 GCCCAGATCTGGCAGAGCCGTGG + Intergenic
1190187109 X:48244914-48244936 GGCCAGAACTGGTAGAGGGCTGG + Intronic
1190656004 X:52612692-52612714 GGCCAGAACTGGTAGAGGGCTGG + Intergenic
1191884343 X:65873792-65873814 AACCAGATCTGGGACATGGCTGG + Intergenic
1192863778 X:75107942-75107964 GCCCCCTTCTGGCCCAGGGCAGG - Intronic
1194692901 X:97009326-97009348 GCTCCCCTCTGGCACAGGGCAGG + Intronic
1195364704 X:104114839-104114861 GCCCTGAAATGCCACAGGGCTGG - Exonic
1197163226 X:123346809-123346831 CCCCAGAATTGGCACAGAGCAGG + Intronic
1199197505 X:145048387-145048409 GCTCCCATCTGGCATAGGGCAGG - Intergenic
1199607276 X:149586716-149586738 GTCCAGGGCTGGCACAGGGGCGG + Intronic
1199631847 X:149782651-149782673 GTCCAGGGCTGGCACAGGGGCGG - Intronic
1201190289 Y:11438466-11438488 GCCCAGAGCAGGGCCAGGGCAGG - Intergenic
1201257697 Y:12125263-12125285 GCTCAGAACTGCCACAGGGATGG - Intergenic
1202583334 Y:26403449-26403471 GCCCAGAGCAGGGCCAGGGCAGG + Intergenic