ID: 1161397313

View in Genome Browser
Species Human (GRCh38)
Location 19:4051706-4051728
Sequence CCCAGATCTGGCACAGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 1, 2: 9, 3: 52, 4: 530}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397304_1161397313 5 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397313 19:4051706-4051728 CCCAGATCTGGCACAGGGCCGGG 0: 1
1: 1
2: 9
3: 52
4: 530
1161397306_1161397313 -10 Left 1161397306 19:4051693-4051715 CCGGGCTGCCTTGCCCAGATCTG 0: 1
1: 0
2: 1
3: 27
4: 340
Right 1161397313 19:4051706-4051728 CCCAGATCTGGCACAGGGCCGGG 0: 1
1: 1
2: 9
3: 52
4: 530
1161397305_1161397313 4 Left 1161397305 19:4051679-4051701 CCACGGCAAGGTCTCCGGGCTGC 0: 1
1: 0
2: 1
3: 14
4: 94
Right 1161397313 19:4051706-4051728 CCCAGATCTGGCACAGGGCCGGG 0: 1
1: 1
2: 9
3: 52
4: 530
1161397300_1161397313 17 Left 1161397300 19:4051666-4051688 CCTTCTGCAAAGCCCACGGCAAG 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1161397313 19:4051706-4051728 CCCAGATCTGGCACAGGGCCGGG 0: 1
1: 1
2: 9
3: 52
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397313 Original CRISPR CCCAGATCTGGCACAGGGCC GGG Intronic
900151757 1:1181985-1182007 CACAGAGCTGGGGCAGGGCCAGG + Intronic
900403419 1:2482276-2482298 CCCAGCTCAGCCACAGGCCCTGG + Intronic
900634335 1:3654656-3654678 CCCAGCTCTGGAACAGCACCTGG - Intronic
900982323 1:6053300-6053322 CCAGGATCTGGCTCAGCGCCTGG - Intronic
901079246 1:6574555-6574577 CCCACACCCAGCACAGGGCCAGG + Intronic
901558500 1:10050618-10050640 CCAAGTTCTGGCACAGGGCTTGG + Intronic
901790305 1:11650349-11650371 CCCAGTGCTGGCACTGAGCCAGG + Intronic
902198285 1:14814638-14814660 GCCTGCTCTGGAACAGGGCCAGG - Intronic
902225917 1:14996436-14996458 ATCAGACCCGGCACAGGGCCTGG + Intronic
902376738 1:16033397-16033419 CCCAGATTGGCCACTGGGCCTGG + Intronic
902381902 1:16056655-16056677 CCCAGATTGGCCACTGGGCCTGG + Intronic
902467006 1:16624549-16624571 CCCAGTCCTGGCAGAAGGCCTGG + Intergenic
902507592 1:16948227-16948249 CCCAGTCCTGGCAGAAGGCCTGG - Intronic
902871669 1:19317480-19317502 CCCTTCTCTGGCTCAGGGCCAGG + Intronic
903052802 1:20614123-20614145 CCCAGAGCTACCTCAGGGCCTGG - Intronic
903066151 1:20700840-20700862 CCCTGAACAGGCCCAGGGCCAGG + Intronic
903665839 1:25006972-25006994 CCCTTTCCTGGCACAGGGCCAGG - Intergenic
904119209 1:28185215-28185237 CCAAGATCTGGAACATTGCCTGG + Intronic
904376128 1:30083667-30083689 CCCAGAGCTGGCACAGGGCCTGG - Intergenic
904768832 1:32870149-32870171 CCCTGATCTGGTACAGTGTCTGG - Intronic
905263705 1:36736748-36736770 CTCAGATCTTCCACAAGGCCTGG - Intergenic
905419644 1:37831952-37831974 CTCAGTACTGGCACAGTGCCTGG + Intronic
905792370 1:40797078-40797100 CCAGAGTCTGGCACAGGGCCTGG - Intronic
907076535 1:51584174-51584196 CCCAGACCTTGCATAGGGACTGG - Intronic
907248186 1:53121187-53121209 CCAAGGTCTGGCACAGGCCTGGG + Intronic
907316204 1:53574326-53574348 CCCAGAACATGCACATGGCCTGG + Intronic
907396725 1:54195788-54195810 CCCAGTGCTTGCACAGAGCCTGG - Intronic
907457613 1:54585536-54585558 CCCAGTCCTGGAACAGTGCCTGG - Intronic
907752080 1:57272335-57272357 GCCACATCTAGCACAGAGCCAGG + Intronic
907786813 1:57620618-57620640 CCAACATGTGGCACAGTGCCAGG + Intronic
909323322 1:74317776-74317798 CCCAGGGCTGACACAGGTCCAGG - Intronic
911123890 1:94322609-94322631 CCAACATCTAGAACAGGGCCTGG - Intergenic
911154404 1:94624344-94624366 CCCTGATCTGATACAGAGCCTGG - Intergenic
912584500 1:110750107-110750129 CCCAGAACTGGCTCTGGGCAGGG + Intergenic
913317847 1:117567496-117567518 CCAAGAACTGGCACAGCCCCTGG + Intergenic
913440980 1:118897339-118897361 CCAAGATCTACTACAGGGCCTGG - Intronic
914916256 1:151821172-151821194 TCCTAAGCTGGCACAGGGCCAGG - Intronic
915022701 1:152796653-152796675 CCCAGCTGTGAGACAGGGCCTGG - Intronic
915625574 1:157112118-157112140 CCCAGCCCTGGCACCGGGCAGGG + Intergenic
916164293 1:161951500-161951522 CCCAAAGCTAGCACAGTGCCTGG - Intronic
916397140 1:164403363-164403385 TCCAGATCTAGCAGAGTGCCTGG + Intergenic
916534065 1:165686531-165686553 CCCAGAACTCACACAGGGCCAGG + Intronic
916568123 1:166000213-166000235 CGCAGACCTAGCACAGGGTCTGG + Intergenic
916786230 1:168089143-168089165 CCAGCATCTGGCACAGGGTCCGG + Intronic
917078806 1:171235767-171235789 CCCAGACATAGCACAGTGCCTGG - Intergenic
917248961 1:173036312-173036334 CCCACATCTGACACAGTGCCTGG - Intergenic
917454308 1:175172738-175172760 TCAGTATCTGGCACAGGGCCTGG + Intronic
918126563 1:181589101-181589123 ACCAGATCTGGGGCAGGGCCCGG - Intronic
918238474 1:182601786-182601808 CCCAGGAGTGGCACTGGGCCTGG + Intronic
919811786 1:201413200-201413222 CCCAGGTCTTGCAAAGGGGCTGG - Intronic
920059280 1:203216545-203216567 GCAAGACCTGCCACAGGGCCTGG + Exonic
920217025 1:204368178-204368200 CCAGGGGCTGGCACAGGGCCTGG - Intronic
920407118 1:205723822-205723844 CCCAGATTTGCAACAGTGCCTGG + Intronic
921885851 1:220304628-220304650 CCCAGATATGGCACAGGTGTTGG + Intergenic
922584779 1:226725394-226725416 GCCAGACCTAGCCCAGGGCCTGG + Intronic
922672600 1:227522405-227522427 CCCAGGTGTGGCACAGAGCTAGG - Intergenic
922959769 1:229636384-229636406 CACAGCTCTGGCTCTGGGCCTGG - Exonic
923070912 1:230563511-230563533 CCCACACCTAGCACAGTGCCTGG + Intergenic
923362665 1:233226832-233226854 CCCATCTGTAGCACAGGGCCTGG - Intronic
923627854 1:235628599-235628621 CCCAGAACTTACACAGGACCAGG - Intronic
924429826 1:243987554-243987576 CCCAGAGCAGGCACTGTGCCTGG + Intergenic
1062860749 10:807492-807514 CACTGATCTGCCCCAGGGCCTGG + Exonic
1063294678 10:4792708-4792730 CCAAGAACTAGCAAAGGGCCTGG + Intronic
1064153668 10:12886194-12886216 GCCAGAGCTAGCACAGTGCCTGG + Intergenic
1064633867 10:17344357-17344379 CCCAGTCCTGGCAGAAGGCCAGG + Intronic
1064736116 10:18383523-18383545 CCAAGACCTAGCACAGGGCTTGG - Intronic
1066472931 10:35716777-35716799 CCCAGTTCAGGCAAAGGGCAAGG + Intergenic
1068922114 10:62495731-62495753 CCCAGAGCTGGGTCAGTGCCTGG - Intronic
1069770783 10:70898518-70898540 TACAGATCTGGTAGAGGGCCAGG - Intergenic
1069842433 10:71348182-71348204 CCCAGCACAGGCACAGGGCCTGG - Intronic
1070148326 10:73790399-73790421 CCCTGAACTGGCACAGTGCCTGG + Intronic
1070491672 10:76982407-76982429 CCCAGATGGAGCACAGGGCCTGG + Intronic
1070668132 10:78359676-78359698 CTCACATCTGGCACGAGGCCTGG + Intergenic
1070805556 10:79268735-79268757 CCCAGAGGCTGCACAGGGCCTGG - Intronic
1070832232 10:79425099-79425121 CACAGATGTGGCACTGCGCCAGG + Intronic
1070842865 10:79499914-79499936 CCTAGAACTGGGACTGGGCCTGG + Intergenic
1072216247 10:93289714-93289736 TCCTAATCTAGCACAGGGCCTGG - Intergenic
1072548403 10:96458001-96458023 CCCAGCTCTGGGACGGTGCCTGG + Intronic
1072891056 10:99325110-99325132 CCAATATCTAGCACAAGGCCTGG + Intergenic
1073301469 10:102473610-102473632 CCCAGCGCCGGCACAGGGACAGG - Exonic
1073482522 10:103795796-103795818 CCCAGAGCTGGCACACCGCCTGG + Intronic
1073575415 10:104618739-104618761 ACCTGATCTGGCAAAGGACCTGG - Intergenic
1074115683 10:110456198-110456220 CCAAGAGCTGGCACAGTGCCTGG + Intergenic
1074534122 10:114316293-114316315 CCCAGATCTAGGACTGAGCCAGG - Intronic
1074535546 10:114326013-114326035 CCGAGATCTGGCCCAAGGTCAGG + Intronic
1074780669 10:116799857-116799879 CCAGCATCTGGAACAGGGCCTGG - Intergenic
1074813706 10:117129140-117129162 CCTGCATCTGGCCCAGGGCCTGG - Intronic
1075620809 10:123926984-123927006 CTCAGACCTGGGACAGGTCCTGG + Intronic
1075893306 10:125972967-125972989 TCCAGATCTGGTACAGAGCCCGG - Intronic
1076086928 10:127640611-127640633 CACAGAATTGGCAGAGGGCCAGG - Intergenic
1076220433 10:128729321-128729343 CCCAGCTCTGCCACATGGGCTGG - Intergenic
1076309432 10:129493690-129493712 CCCAGATCCCACACTGGGCCTGG - Intronic
1076316376 10:129544682-129544704 CCCAGCGCAGACACAGGGCCTGG - Intronic
1076871548 10:133197334-133197356 CCCAGATCAGGATCAGGGCAGGG + Intronic
1077197577 11:1289004-1289026 CCCAGACCTGGCCCTGGCCCTGG - Intronic
1077461324 11:2712237-2712259 CCCACATCTAGTAGAGGGCCGGG - Intronic
1078018061 11:7632379-7632401 TCCAGACCTGGCACAGGGCCTGG + Intronic
1078401965 11:11036704-11036726 CCCACTTCTGGCACATAGCCAGG - Intergenic
1078530868 11:12136000-12136022 CCCAGCACTTGGACAGGGCCTGG - Intronic
1078750986 11:14163547-14163569 CCCATACCTGGCAAAGGGCTGGG + Intronic
1081748657 11:45491177-45491199 CCTGGATCTGGAACAGTGCCTGG - Intergenic
1083339150 11:61947509-61947531 CTCAGCTCTGGGGCAGGGCCAGG + Intergenic
1083617533 11:64034052-64034074 CACAGAGCTGGCACAGAGCGCGG - Intronic
1083626904 11:64076507-64076529 CCCAGTGCCAGCACAGGGCCCGG - Intronic
1083668264 11:64286710-64286732 CCCAGAGCAGACAGAGGGCCAGG - Exonic
1083964544 11:66035309-66035331 CCCAGAGGTGGCCCAGAGCCAGG - Intergenic
1084155205 11:67309402-67309424 CCCACATCTTGAACATGGCCCGG + Exonic
1084321478 11:68375762-68375784 CCCAGAGGTGGCACAGAGACGGG - Intronic
1084459586 11:69289024-69289046 GACAGTGCTGGCACAGGGCCAGG + Intergenic
1084519706 11:69655790-69655812 CCCAGCCCTGACACAGGACCTGG - Intronic
1085052078 11:73385070-73385092 CCCAGTTCTGGCCCTGGCCCTGG - Intronic
1085284882 11:75353016-75353038 TCCAGATTTGGCAGAGGGGCAGG + Intergenic
1085693976 11:78688360-78688382 CACATATCTTGCACAGGACCTGG + Intronic
1086146162 11:83554636-83554658 CCCAGATCTGGCACTGAGGAAGG - Intronic
1087707152 11:101506202-101506224 TGCAGAACTGGAACAGGGCCAGG + Intronic
1088698862 11:112393711-112393733 GCCAAATCTGGCCCAGGGCTTGG + Intergenic
1089122266 11:116145705-116145727 CCCAGGTCTGGCACCTGGCAAGG + Intergenic
1089267533 11:117276312-117276334 CTCAGAACTGGAACAAGGCCGGG + Intronic
1089418857 11:118315997-118316019 CACAGGGCTGGCTCAGGGCCAGG - Exonic
1089740548 11:120579110-120579132 CTCAGTGCTGGGACAGGGCCTGG - Intronic
1090232082 11:125114607-125114629 TTCAGAGCTGGCACAGGCCCAGG + Intergenic
1091189276 11:133676660-133676682 CCAGGATCTAGCACAGTGCCTGG + Intergenic
1093334322 12:17883028-17883050 CTAAGATCTGGAACAGGGCAAGG + Intergenic
1093971709 12:25382115-25382137 CCCATGCCTGGCACAGGGCAAGG - Intergenic
1094228549 12:28075940-28075962 CCAAGATCAGGCACAAGGCTAGG + Intergenic
1094630894 12:32172756-32172778 CCCAGTTCTGGAACTGTGCCTGG - Intronic
1094836553 12:34324841-34324863 CCCGGGTCTTGCACAAGGCCTGG + Intergenic
1095502363 12:42854436-42854458 CCAAAATGTGGCACAGTGCCCGG + Intergenic
1096911432 12:54988574-54988596 CCCAGACCTGGGGCAGAGCCAGG + Intergenic
1098272728 12:68784570-68784592 CCCAGTACTGGCACAATGCCTGG + Intronic
1098582588 12:72118131-72118153 CCCAGATCTGGGACAAGACAAGG - Intronic
1098848400 12:75566013-75566035 CCCAAACCTGGCCCAGTGCCTGG - Intergenic
1100203529 12:92325049-92325071 CCCAGTACCAGCACAGGGCCTGG - Intergenic
1101978829 12:109387717-109387739 CACAGCTCTGGCCAAGGGCCTGG + Intronic
1102012893 12:109629635-109629657 CCCAGCACCGGCACAGGGTCTGG + Intergenic
1102030333 12:109736647-109736669 CCAGCATCTAGCACAGGGCCTGG + Intronic
1102204827 12:111083258-111083280 CCCAGAACTGGGGCAGGGCAGGG + Intronic
1102570544 12:113824660-113824682 CCCAGGGCTAGCACAGTGCCTGG + Intronic
1103016862 12:117501540-117501562 CCCACACCTGGCACAGTGCCTGG - Intronic
1103085075 12:118056516-118056538 CCCAGAGCTGGCAGAGTTCCTGG + Intronic
1103204857 12:119120607-119120629 CCCAGATCTGGCCAAGGAACAGG + Intronic
1103320733 12:120091539-120091561 CTCAGAGCTGGCACTGTGCCAGG - Intronic
1103458952 12:121088862-121088884 CCCATATCTCACACAGTGCCTGG - Intergenic
1103883866 12:124186627-124186649 CCCATATCTTGCACAGGCCTTGG - Intronic
1103909920 12:124346546-124346568 CGCAGGTATGGCCCAGGGCCAGG - Exonic
1103995740 12:124828890-124828912 CCTAGTTCTGGGACAAGGCCAGG + Intronic
1104004445 12:124882283-124882305 CCCAGCACCAGCACAGGGCCCGG + Intronic
1105541057 13:21317777-21317799 CTAAGATCTGGCACAAGGCAAGG - Intergenic
1105948439 13:25209248-25209270 CCCAGTGCTGGCCCAGGGCAAGG - Intergenic
1106511751 13:30419200-30419222 CCCAGGTCTGGCTCTGGGGCAGG - Intergenic
1106690313 13:32108116-32108138 TCCAGATCTGGAAGAGGGTCAGG + Intronic
1107225492 13:38044131-38044153 CCCAGAAGTGGCATAGAGCCGGG + Intergenic
1107555395 13:41513249-41513271 CCAACACCTAGCACAGGGCCTGG - Intergenic
1108532344 13:51339480-51339502 CCCAGATCGGGAACAGAGCAGGG - Intronic
1112098882 13:96165711-96165733 CCCAGAGCTTGCACCTGGCCTGG + Intronic
1113226703 13:108167902-108167924 CCCAGAAGTGACACAGAGCCAGG + Intergenic
1114447128 14:22797458-22797480 CTCAGAGCCTGCACAGGGCCTGG - Intronic
1114629610 14:24150734-24150756 CAAAGAGCTGGCATAGGGCCGGG - Exonic
1116973535 14:51093566-51093588 GCCAGGTCTGGCCCAGAGCCGGG + Intronic
1117253954 14:53959636-53959658 TCCAGATCTGGGGCAGGACCAGG - Intergenic
1118060408 14:62131806-62131828 CCCAGCCCTAGCACAGTGCCTGG - Intergenic
1118819771 14:69337704-69337726 TCCAGATGTGGTTCAGGGCCAGG - Intronic
1119516071 14:75249467-75249489 GCAGCATCTGGCACAGGGCCAGG + Intronic
1119521068 14:75285485-75285507 CCCAGAACTGGCTCAGTGCCTGG + Intergenic
1120235328 14:81883641-81883663 TCCACATCTGTCGCAGGGCCTGG + Intergenic
1120318973 14:82934565-82934587 CCAAGCTGAGGCACAGGGCCTGG - Intergenic
1120677372 14:87436535-87436557 AACAAATCTGGCACAGTGCCTGG - Intergenic
1120949957 14:90031728-90031750 CCCAGAGGTGGCAAAGAGCCTGG - Intronic
1121325116 14:93015351-93015373 CCCAGCCCTGGCACAGGGCAGGG + Intronic
1121442761 14:93959169-93959191 CCCAGCTCTGGCTCAGTCCCAGG + Intronic
1121526733 14:94624383-94624405 ACCACATCTGGCACAGCCCCCGG + Intronic
1121645780 14:95516489-95516511 CCCAGCTCTGACACAGCCCCGGG - Intronic
1121777868 14:96602704-96602726 CCAAGACCTGGCATAGTGCCTGG + Intergenic
1122030027 14:98905368-98905390 CCCAGACCCGGGACTGGGCCAGG + Intergenic
1122890210 14:104728777-104728799 CCCAGCCCTGGCCCAGGGCCTGG - Intronic
1123404897 15:20013580-20013602 CCCTGCTCTGGCACAGAGCCTGG - Intergenic
1123514228 15:21020228-21020250 CCCTGCTCTGGCACAGAGCCTGG - Intergenic
1124243817 15:28053438-28053460 CTAATATCTGGCACAGGGGCTGG - Intronic
1124430099 15:29599701-29599723 GCCAGATCAGGCACAGGGGCAGG + Intergenic
1126351393 15:47748382-47748404 CCAGGATCAGGCACAGGGCCTGG - Intronic
1126583576 15:50262409-50262431 CACAGAGCTGGCACATGGCAGGG + Intronic
1127293795 15:57592239-57592261 GCCAGAGCCGGCACAGGACCGGG - Intronic
1127328881 15:57919907-57919929 CCAACATCTGGCTCAGGGCCTGG - Intergenic
1127963957 15:63910181-63910203 GCCAGAGCCGGCACAGGGCTTGG + Intronic
1128275628 15:66351149-66351171 CCAAGATGTGGCACAGTGCCTGG - Intronic
1128569332 15:68722144-68722166 CTCAGTTCTGGCACTGGGTCTGG + Intronic
1128620127 15:69141705-69141727 CACAGCTCTAGCACAGTGCCTGG + Intergenic
1129291996 15:74575402-74575424 CCCAGTGCTAGCACAGGGCCAGG + Intronic
1129453973 15:75666705-75666727 TCCAGCTCCGGCACAGTGCCTGG + Intergenic
1129546222 15:76398443-76398465 CCCAATCCTAGCACAGGGCCTGG + Intronic
1129559012 15:76545959-76545981 CCCAGAGCTCACACAGGGCAGGG + Intronic
1129681668 15:77661782-77661804 CCCACATCTCACACAGGGACAGG + Intronic
1129782744 15:78284586-78284608 ACTAGGTCTGGCAGAGGGCCTGG - Intronic
1129851602 15:78796925-78796947 CACAGATCTGGGACAGAGCCAGG - Intronic
1130053322 15:80502271-80502293 CCCAGATGTGGCAGTGGGCATGG + Intronic
1130779644 15:87021987-87022009 CCCAGTACTGGCCCAGAGCCTGG + Intronic
1131524186 15:93139594-93139616 CTCAGCTCTGGCACTGGGCTTGG - Intergenic
1132065550 15:98727892-98727914 GCCAGATCTGCAACAGGGACTGG - Intronic
1132176786 15:99722125-99722147 CCCAGAGCTTACCCAGGGCCAGG + Intronic
1132199421 15:99939492-99939514 CTCAAATCTGGTACAGGGCAAGG - Intergenic
1132508014 16:322184-322206 CCCAGGCCTGGCTCAGGGCAGGG + Intronic
1132802892 16:1762950-1762972 CCGAGATCGGGCACATGGCATGG - Exonic
1132930304 16:2455637-2455659 CACAGCGCTCGCACAGGGCCGGG - Intronic
1133854051 16:9533036-9533058 CCCAGACTTAGCACAGTGCCTGG - Intergenic
1134290524 16:12900768-12900790 CCCGGATCTGGCGCAGCGCAAGG - Intergenic
1134464014 16:14457005-14457027 TCCGTACCTGGCACAGGGCCTGG + Intronic
1134487136 16:14667553-14667575 CCCAGAAAAGGCCCAGGGCCCGG + Intronic
1135848952 16:25944767-25944789 CCCAGAGGTAGCACAGGGCTAGG + Intronic
1136013487 16:27380030-27380052 CCCAGAACCGGCACAGTGCCTGG + Intergenic
1136147792 16:28325723-28325745 CCCACGCCTGGGACAGGGCCTGG + Intergenic
1136679244 16:31945929-31945951 CTCCCATCTGGCCCAGGGCCAGG - Intergenic
1136723566 16:32341131-32341153 CTCAGTTCTGGCCCTGGGCCCGG - Intergenic
1137384898 16:48032362-48032384 CACAGAACTGGCACTGAGCCTGG + Intergenic
1138515336 16:57532986-57533008 GCCAGGCCTGGCACAGGGCTTGG + Intronic
1138527737 16:57618831-57618853 CCCATGCCTGGCACAGGACCTGG + Intronic
1138527764 16:57618987-57619009 CCAAGAACCAGCACAGGGCCTGG - Intronic
1138535064 16:57655515-57655537 CCCATACCTGGAACAGGGCTTGG - Exonic
1138597318 16:58035912-58035934 CCCAGCCCTGGCACCCGGCCAGG - Intronic
1138660224 16:58512255-58512277 CTCAGAATTGGGACAGGGCCAGG - Exonic
1139488063 16:67270542-67270564 CCAACACCTAGCACAGGGCCGGG - Intronic
1139509011 16:67415954-67415976 CCCACGCCTGGCACAGAGCCTGG + Intronic
1141280385 16:82625783-82625805 CTAGCATCTGGCACAGGGCCTGG - Intergenic
1141714321 16:85717961-85717983 CCAAGAGCTGGCACAGGGAATGG - Intronic
1141990858 16:87608746-87608768 CCCACATCTGGCACAGGCATAGG - Intronic
1203002866 16_KI270728v1_random:176634-176656 CTCAGTTCTGGCCCTGGGCCCGG + Intergenic
1203134471 16_KI270728v1_random:1713040-1713062 CTCAGTTCTGGCCCTGGGCCCGG + Intergenic
1142551091 17:740155-740177 CTAACATCTAGCACAGGGCCTGG + Intronic
1143078676 17:4366048-4366070 CCCAGCTCCGGCCCAGGGACTGG - Intronic
1143433970 17:6909005-6909027 TGCAGTTTTGGCACAGGGCCAGG + Intronic
1144164273 17:12593139-12593161 CTAAGATCTGGAACAAGGCCAGG - Intergenic
1144164279 17:12593200-12593222 CTAAGATCTGGAACAAGGCCAGG - Intergenic
1144675991 17:17162002-17162024 CCAATACCTGGCACAAGGCCTGG - Intronic
1144711484 17:17404275-17404297 GCCAGTCCTGGCACAGGGACTGG - Intergenic
1145902938 17:28499747-28499769 CCCAGTTCCTCCACAGGGCCTGG + Intronic
1146005902 17:29160530-29160552 CCCAGTGCTAGCACAGTGCCCGG + Intronic
1146270057 17:31479019-31479041 CCCAGATCTGGCCCACGTTCAGG - Intronic
1146277472 17:31524653-31524675 CCCAGACCTGGGACAGGGCCAGG - Intronic
1146301506 17:31693231-31693253 CCCAGCTCTGGGACACAGCCTGG + Intergenic
1146906113 17:36618860-36618882 TCCAGCTCTGTCACATGGCCTGG - Intergenic
1147317519 17:39627839-39627861 ACCAGCTCTGGGACAGAGCCAGG - Intronic
1147555106 17:41473696-41473718 CCCAGATCTGGCATATTGCCTGG - Intergenic
1147611804 17:41806334-41806356 CCCACATCCTGCACAGAGCCTGG - Intronic
1148340998 17:46873342-46873364 CCAGGATCTGGCACAGTGCCTGG - Intronic
1148457446 17:47818586-47818608 CCCAGCTCTGGAATAGGTCCTGG + Exonic
1149043609 17:52219368-52219390 CCAAGGTCTAGCACAGTGCCTGG - Intergenic
1150139537 17:62716535-62716557 CCCAGCTCTGGGATGGGGCCAGG - Intronic
1150534414 17:66021160-66021182 CCCAGGTCTGGGACAATGCCTGG - Intronic
1150576218 17:66433275-66433297 CCCAGCTCTGGCCCCGGCCCTGG + Intronic
1150647144 17:66986061-66986083 CCAGGAGCTGGCTCAGGGCCGGG - Intronic
1151536723 17:74743124-74743146 CCCAGATCTGGGACACCGCTGGG + Exonic
1151716749 17:75834977-75834999 CCCAGATCAGCCACACTGCCCGG - Exonic
1152122404 17:78426830-78426852 CCCAGGCCTAGCACAGGCCCCGG - Intronic
1152790797 17:82278113-82278135 CCCAGATCTCAGACAGGGCGGGG + Intergenic
1155502377 18:26499912-26499934 CCCAAATCTGGGGCAGAGCCAGG + Intronic
1155542138 18:26879661-26879683 CCAGAATCTGGTACAGGGCCTGG + Intergenic
1155914852 18:31546630-31546652 CCAAAATCTGGCAGAGGGCCAGG - Exonic
1156474515 18:37397319-37397341 CCCAGGCCTACCACAGGGCCTGG - Intronic
1156489333 18:37487026-37487048 ACGAGGTCTGGCACAGAGCCTGG - Intronic
1156491606 18:37499647-37499669 CCTACTCCTGGCACAGGGCCTGG + Intronic
1157553970 18:48600538-48600560 CCAAGGTCTAGCACAGTGCCTGG + Intronic
1157761027 18:50265952-50265974 CCCAGATCTGTCTCTGGGCCGGG + Intronic
1160079736 18:75714185-75714207 CCCAGTTCTTCCACTGGGCCTGG + Intergenic
1160248708 18:77182547-77182569 CACAGAGCTGGCACACGCCCAGG - Intergenic
1160716198 19:577909-577931 CCCAGCTCTGGGACGGCGCCCGG + Exonic
1160848700 19:1179083-1179105 TCCAGCTCTGGCCCAGGCCCAGG + Intronic
1160932068 19:1575564-1575586 CCCAGACCTGGCATGGGGCGGGG - Intronic
1161397313 19:4051706-4051728 CCCAGATCTGGCACAGGGCCGGG + Intronic
1161760451 19:6167348-6167370 CCCAATTCTGGCAGAGGGCCTGG + Intronic
1161931846 19:7345818-7345840 CCCACACCTGCCACAGTGCCTGG + Intergenic
1161994911 19:7706147-7706169 CCCACACCTGGGACAGGGCCTGG + Intergenic
1162578600 19:11513963-11513985 CCCGCATCTTGCGCAGGGCCAGG + Exonic
1162873252 19:13601509-13601531 CCAGGACCTAGCACAGGGCCAGG - Intronic
1162910823 19:13847167-13847189 CCCAGTTCTGGCCTGGGGCCAGG - Intergenic
1163598338 19:18233266-18233288 CCCGGGTCCGGCCCAGGGCCGGG + Exonic
1164670901 19:30071377-30071399 CCCCGATCTGGCACCGGGGTGGG + Intergenic
1165394248 19:35555622-35555644 CCCACATCTGGCACAGACCGAGG - Intronic
1165714534 19:38035933-38035955 CCCTGAGCTGGCACAGGCCTAGG + Intronic
1166327264 19:42058926-42058948 GCCAGATCTGACTCGGGGCCAGG + Intronic
1166868055 19:45853058-45853080 CAAAGAGCTGGCACAGGACCTGG + Intronic
1166895970 19:46022139-46022161 GCCACATCTGGCACACTGCCTGG + Intronic
1167514116 19:49913029-49913051 CTCAGGGCAGGCACAGGGCCGGG + Intronic
1167646936 19:50711003-50711025 CCCACATCTGGGACTGGGCTTGG - Intronic
1167792067 19:51689230-51689252 CCCGGAGCTGGCCCAGGTCCAGG - Intergenic
1168275096 19:55273604-55273626 ACCAGGTCGGGCACAGGGACGGG - Intronic
925905260 2:8536318-8536340 CCCAGGCCTGGCACTGGGCTAGG - Intergenic
926129849 2:10296068-10296090 TACAGACCAGGCACAGGGCCTGG + Intergenic
926146803 2:10401244-10401266 ACCACACCAGGCACAGGGCCTGG + Intronic
926790844 2:16569861-16569883 CTAGGATCTGGCACAGGGCCTGG + Intronic
926867325 2:17374348-17374370 AACAGATCTGGCTCAGGTCCTGG - Intergenic
927647352 2:24886460-24886482 CCCGGACCTTGCAAAGGGCCAGG + Intronic
927849520 2:26490025-26490047 CTCAGAAGAGGCACAGGGCCAGG + Intronic
928134163 2:28675628-28675650 CCCTGGCCTAGCACAGGGCCTGG + Intergenic
928651250 2:33405848-33405870 CCCAGGGCTGGCACAACGCCTGG - Intergenic
929918860 2:46158084-46158106 CCCAAACCTGGCTCAGTGCCTGG - Intronic
929968433 2:46552726-46552748 ACCAGATCTGGGCCAGGGGCAGG + Intronic
930024114 2:47020101-47020123 GCCAGGCCTAGCACAGGGCCTGG + Intronic
931430934 2:62208594-62208616 GCCAGGACTGGCACAGAGCCAGG + Intronic
933664844 2:84956565-84956587 GCCAGATTTGGCCCATGGCCTGG + Intergenic
933943580 2:87265558-87265580 CTCAGGCCTAGCACAGGGCCTGG - Intergenic
934710380 2:96510260-96510282 CCCAGAACTGGGACAGTGCTTGG - Intergenic
934734947 2:96685462-96685484 CCCAGATCTGGCTCAGCTCCAGG - Intergenic
935386558 2:102505440-102505462 TCCAGATTTGGCAGAAGGCCAGG - Exonic
936336641 2:111596019-111596041 CTCAGGCCTAGCACAGGGCCTGG + Intergenic
936488995 2:112953971-112953993 CCCAGTACTCACACAGGGCCAGG - Intergenic
937126937 2:119481045-119481067 CCCAGAGCAGGCACTGGGACTGG + Intronic
937127788 2:119485301-119485323 TTCAGACCTGGCCCAGGGCCAGG - Intronic
938077075 2:128345780-128345802 CCCAGAGCGGCCTCAGGGCCGGG - Intergenic
938163692 2:129008624-129008646 CCCACAGCTGGCACAGAGCAGGG - Intergenic
938168781 2:129056798-129056820 TCCACATCTGGCACAGGGCCGGG - Intergenic
938293459 2:130162461-130162483 CCCAGGTCTGGCACAGAGGAAGG - Intronic
938463094 2:131510500-131510522 CCCAGGTCTGGCACAGAGGAAGG + Intergenic
942299621 2:174548862-174548884 CCCGGAACTGGCACTGGCCCTGG + Intergenic
942812431 2:180014635-180014657 TTCAGATCTGCCTCAGGGCCCGG - Intergenic
945007254 2:205421959-205421981 CCAATATCTAGCACAGTGCCTGG - Intronic
946152399 2:217785369-217785391 CCCAGGGCTGGTCCAGGGCCTGG + Intergenic
947214323 2:227736321-227736343 CCCAGATCTGCCTCAGCTCCAGG - Intergenic
947665502 2:231902982-231903004 CCCACATCTTGCTGAGGGCCTGG + Intergenic
947958136 2:234212708-234212730 CCCACATCTGCCACGGGCCCTGG - Intergenic
948461921 2:238133982-238134004 CCCAGGGCTGGCAGAGGGCAAGG + Intergenic
948560734 2:238849375-238849397 GCCAGAGCAGCCACAGGGCCGGG + Intronic
948681806 2:239640220-239640242 TCCAGAGCTCGCACAGGACCAGG - Intergenic
948808635 2:240463630-240463652 CCCAGATCTGGCCCGGGTCAGGG - Intronic
1169219806 20:3815440-3815462 CCCAGCTCTGCCACAAGCCCTGG + Intergenic
1169317096 20:4601832-4601854 CCCTGCACTGGCACGGGGCCAGG - Intergenic
1171849657 20:30299521-30299543 CCCAGCTCCTCCACAGGGCCAGG + Intergenic
1172049956 20:32109833-32109855 CCCGGAGGTGGCTCAGGGCCAGG - Intronic
1172206234 20:33164743-33164765 CCCAGAGCTGGCACAGGGTCTGG - Intronic
1172311501 20:33921812-33921834 CCCATGCCTGGCCCAGGGCCTGG + Intergenic
1172591718 20:36122511-36122533 CTCAGCTCTGGCACAGAGACTGG + Intronic
1172680398 20:36709791-36709813 TCCAAATATAGCACAGGGCCTGG + Intronic
1172704490 20:36872995-36873017 ACCAGAGTGGGCACAGGGCCAGG + Intergenic
1173030944 20:39359004-39359026 CCCAAATCTAGCACAGTGCCTGG - Intergenic
1173849155 20:46207073-46207095 CCCAGGCCTGGCTCAGGGCCTGG + Intronic
1173965036 20:47106273-47106295 CCCGGACCTAGCACAGGGCCTGG + Intronic
1175056370 20:56202387-56202409 CCCTGATCTAGCCCAGGGGCTGG - Intergenic
1175553295 20:59830845-59830867 CCCAGCACTGGCACAGAGCTAGG - Intronic
1175760828 20:61561286-61561308 GCCAGATGTGCCACAGGGCTTGG + Intronic
1175916815 20:62429831-62429853 CCCAGAGCCTGGACAGGGCCTGG - Intergenic
1177081756 21:16648232-16648254 CCCAGAGCTCACACAGGGCTGGG - Intergenic
1179789851 21:43749997-43750019 TCAAGACCTGGCTCAGGGCCAGG - Intronic
1180087792 21:45515846-45515868 CCCATACCTGGCCCAGGCCCCGG - Exonic
1180500177 22:15923268-15923290 CCCAGGTCAGGAACAAGGCCCGG - Intergenic
1180635039 22:17257367-17257389 CTGCGATCTGGCACTGGGCCTGG - Intergenic
1180920061 22:19517013-19517035 TCCAGATCTGGCCCTGGGACAGG + Intronic
1181316747 22:21975452-21975474 CCCAGCTTTGGCACATTGCCAGG + Intronic
1181570411 22:23765151-23765173 CACAGATGTGGCATAGGGGCTGG + Intronic
1181582320 22:23835119-23835141 CCAAGAGCTGGCACCAGGCCGGG - Intronic
1181629463 22:24142998-24143020 CACACAGCTGGCCCAGGGCCTGG - Intronic
1181859317 22:25805895-25805917 ACCAGACCTTGCTCAGGGCCAGG - Intronic
1182050150 22:27306480-27306502 CCAATATCTGGCACAGTGCTTGG - Intergenic
1182106479 22:27693441-27693463 CCAGGTCCTGGCACAGGGCCTGG + Intergenic
1182362747 22:29756558-29756580 GGCAGGTCTGGGACAGGGCCAGG + Intronic
1182727670 22:32460862-32460884 CCTAGGTCTGGCTCAGTGCCTGG + Intronic
1183581479 22:38729093-38729115 CCCAGAGCCTGCACAGAGCCTGG - Intronic
1184248277 22:43246498-43246520 CCCAGGCTTTGCACAGGGCCTGG - Intronic
1184278973 22:43426481-43426503 CCCAGAGGCGGCCCAGGGCCTGG - Intronic
1184427756 22:44423212-44423234 CCCAGGCCTGGTGCAGGGCCTGG + Intergenic
1184598389 22:45527882-45527904 CGCAGCTCTGGCCCTGGGCCTGG - Exonic
1184599021 22:45531785-45531807 ACCAGCTCTGGCCCTGGGCCTGG - Intronic
1184849343 22:47111061-47111083 CGGAGATCAGGCACTGGGCCTGG - Intronic
1184889647 22:47371939-47371961 CTAAGATCTGGGCCAGGGCCAGG - Intergenic
1184893977 22:47396494-47396516 CCCAGCTCCAGCCCAGGGCCTGG + Intergenic
1185130499 22:49036002-49036024 CCCAGTCCTCACACAGGGCCAGG + Intergenic
1185208611 22:49554263-49554285 GCCAGGCCTGGCACAGGGACAGG + Intronic
1185248295 22:49785223-49785245 CCCACAGCTGGGGCAGGGCCCGG + Intronic
1185277972 22:49957914-49957936 CCCAGCTCTGGCCCATGGGCTGG + Intergenic
1185313522 22:50169584-50169606 CCCTGAGCTGGCACAGGCCCCGG + Intergenic
949431025 3:3976251-3976273 CCCAGATCTCACACAGGGCTGGG - Intronic
949441846 3:4090074-4090096 CCCAGCACTAGCACAGTGCCTGG + Intronic
949941225 3:9156394-9156416 CCCGGAGCTGCCACAGGGTCTGG - Intronic
950098248 3:10342552-10342574 GCCAGAGCTGGGACAGGGCCAGG + Intronic
950387335 3:12670519-12670541 CCCAGCTCTAACACAGGGCCTGG - Intergenic
950876345 3:16278147-16278169 CCAGGATCTGGCCCAGGGTCTGG - Intronic
950933257 3:16811959-16811981 CCCCAGTCTTGCACAGGGCCTGG - Intronic
951925242 3:27902119-27902141 CCCATATCTTGCACAGTACCTGG + Intergenic
952285336 3:31962871-31962893 CTAAGTTCTGGCACAGTGCCTGG - Intronic
952584133 3:34870994-34871016 TCCAGATCTAGCACAGTTCCTGG - Intergenic
952899490 3:38100032-38100054 CTCAGATCTGGGCCAGGGCATGG + Intronic
953983204 3:47423085-47423107 TCCATATCCAGCACAGGGCCTGG + Intronic
954099207 3:48356423-48356445 CACAGACCTGGCCCAGTGCCTGG - Intergenic
954201676 3:49026931-49026953 CCTAGAGCTGGGAAAGGGCCTGG - Intronic
954288785 3:49638044-49638066 TCCTGATCTGGCACATGGGCAGG - Intronic
954292072 3:49655047-49655069 CCTGGCTCTGGCACTGGGCCTGG - Exonic
954381444 3:50221157-50221179 CCCAGCTCTGGGCCTGGGCCAGG + Intergenic
954577425 3:51684326-51684348 GCCTGATCTGGCACAGTCCCAGG + Intronic
954625965 3:52022085-52022107 CTCAGCTCTGGCCCAGTGCCAGG + Intergenic
955891703 3:63657120-63657142 CCCAGAACTATCACAGGGCCTGG + Intronic
956025140 3:64975346-64975368 CCAACATCTGGCACAGAGCCTGG + Intergenic
956796489 3:72722954-72722976 CCCAGTTCTGGCCAAGAGCCTGG + Intergenic
960041929 3:113158775-113158797 CCCAAATCTAGCACAGTGCCTGG - Intergenic
961303005 3:125934086-125934108 CACAGATCTGCCACAGGCCTGGG + Intronic
961445497 3:126979115-126979137 CCCAGAGCTGCCCCAGGGGCAGG + Intergenic
961453716 3:127014198-127014220 CGCAGCTCTCGCGCAGGGCCGGG - Exonic
961513814 3:127420547-127420569 GCCAGAGCAGGTACAGGGCCTGG + Intergenic
961563814 3:127749163-127749185 TCTAGGGCTGGCACAGGGCCTGG + Intronic
962738272 3:138344958-138344980 CCAAGGTCAGACACAGGGCCAGG - Intergenic
962753357 3:138450765-138450787 CCCAAAGCTGGCTCAGGACCTGG + Intronic
962944115 3:140152006-140152028 CCCAGCTCTGGCCCAGCCCCTGG + Intronic
967194657 3:187016035-187016057 TCCAGACCTGGCACAGTGCCTGG + Intronic
968441723 4:627774-627796 CCCAGATTTGGGACAGGGTGGGG - Intronic
968480163 4:829773-829795 CCCAGCTCTGGCAAACGGCAAGG - Intergenic
968662338 4:1803963-1803985 CCCACACTGGGCACAGGGCCAGG - Intronic
968744610 4:2353196-2353218 CCCAGCCCTGGCTCTGGGCCTGG - Intronic
968787996 4:2638297-2638319 CTCGTACCTGGCACAGGGCCTGG + Intronic
968930546 4:3576446-3576468 CTCAGATCTGGAAGGGGGCCTGG - Intergenic
968968889 4:3783387-3783409 CCCAGCCCTGGCACAGGGCCTGG - Intergenic
969104493 4:4795148-4795170 CCAAGATTTGGCACAATGCCTGG - Intergenic
970169374 4:13274582-13274604 CCAGGATGTGGCACAGGGACGGG - Intergenic
971181988 4:24337369-24337391 CTCAGCACTGGCACAGGGCCTGG - Intergenic
971198058 4:24488064-24488086 CCCAGCTCTGGCACAGGAGTGGG + Intergenic
971473642 4:27052327-27052349 TCCATATCTGGCCCAGGCCCTGG + Intergenic
972411225 4:38796960-38796982 CCCAGACCCGGCGCAGGGCCAGG - Exonic
972414756 4:38827587-38827609 CCCAGACTCGGCGCAGGGCCAGG - Exonic
976327784 4:83792662-83792684 CCCAGATCCAGCTCAGGGACTGG + Intergenic
977002401 4:91519727-91519749 CCCAGGAGTGGCACAGAGCCAGG - Intronic
977150781 4:93508690-93508712 TCCAGATCTAGCCCAGGGTCTGG - Intronic
978153899 4:105468057-105468079 GCCAAATCTGTCACATGGCCTGG + Intronic
978330474 4:107607785-107607807 CCCAGTGCTGGTACAGGTCCGGG + Intronic
980879047 4:138690847-138690869 CCCGAATCTAGCACAGGGCCTGG + Intergenic
982730125 4:158946871-158946893 CCCAGGCCTAGCACAGTGCCTGG + Intronic
985671744 5:1210342-1210364 CCCAGGGCTGGCACAGGGTGTGG - Intronic
985904021 5:2819027-2819049 CCAAGCTCTGGCAGTGGGCCTGG + Intergenic
985947086 5:3194210-3194232 CCCAGCGCTGCCACAGGACCAGG - Intergenic
987148800 5:15018003-15018025 CCTAAAGCTGGCCCAGGGCCTGG + Intergenic
987410653 5:17611457-17611479 CCCACATCTCGCACACGTCCAGG - Intergenic
987411511 5:17619766-17619788 CCCACATCTCACACATGGCCAGG + Intergenic
987874031 5:23656346-23656368 CTCACAGCTGGCACAGTGCCTGG - Intergenic
988918532 5:35920077-35920099 CCCAGCTCTGTCAGAAGGCCAGG - Intronic
991464284 5:66893856-66893878 ACCAGATCTTACACAGGGCTTGG - Intronic
994094645 5:95838189-95838211 GTCAGCTATGGCACAGGGCCTGG - Intergenic
996031624 5:118711807-118711829 CCCAGACCTGTCCCAGTGCCAGG + Intergenic
996492564 5:124115297-124115319 CCAGCATCTGGCACAAGGCCAGG - Intergenic
997151500 5:131500830-131500852 CCCAGATCTCACACAGGGCCTGG + Intronic
997294749 5:132762408-132762430 CACAGATCTGACACAGCCCCAGG - Intronic
997349684 5:133221625-133221647 TCCAGCTCTGGCACAGAGACGGG - Intronic
997358272 5:133278331-133278353 CCGAGGTGTGGCAGAGGGCCTGG - Intronic
997425921 5:133802544-133802566 ACCAGAGCTGGGAAAGGGCCTGG + Intergenic
997660488 5:135585568-135585590 CCCAGCTTGAGCACAGGGCCGGG + Intergenic
998469773 5:142374708-142374730 CCAAGGTCTTGCAAAGGGCCCGG - Intergenic
998819191 5:146042884-146042906 CCCCGATCTGGCTCAGGACTCGG + Intronic
999113301 5:149140916-149140938 CCAATACCTAGCACAGGGCCCGG - Intergenic
999434285 5:151550953-151550975 CCCAGGCCTAGCACAGTGCCTGG + Intronic
1001490647 5:172152407-172152429 CCAAAATCTGGCTCAGGGCTGGG + Intronic
1002130824 5:177080519-177080541 CCCAGATCTGTCACTGGGCAAGG + Intronic
1002203927 5:177549706-177549728 CCCAGGCCTGGCACAGAGCTGGG + Intronic
1002347997 5:178561373-178561395 CCCAAATCTGGCACAGGGCTGGG - Intronic
1002484331 5:179524140-179524162 CCCAGATCAGCCCCAGGCCCTGG - Intergenic
1002500243 5:179643348-179643370 CCCAGATCAGCCCCAGGCCCTGG + Intronic
1002946568 6:1766847-1766869 ACCAGATCTGGCCCATTGCCAGG - Intronic
1003939082 6:11006244-11006266 CCCAGATCTGGCCATGGGACTGG + Intronic
1003948258 6:11094309-11094331 CCAAGATGTGGCACAGCGTCGGG + Exonic
1003964267 6:11238135-11238157 TAAACATCTGGCACAGGGCCTGG - Intronic
1004183069 6:13397473-13397495 CCCAGAGATGCCAGAGGGCCTGG - Intronic
1004323487 6:14652103-14652125 CCCATATCTCGCTCAGGGCAGGG - Intergenic
1005847340 6:29792280-29792302 CCCAGGTCTGGGTCAGGACCAGG - Intergenic
1005859080 6:29887805-29887827 CCCAGGTCTGGGTCAGGGTCAGG - Intergenic
1005864236 6:29926505-29926527 CCCAGGTCTCGGTCAGGGCCAGG - Intergenic
1005866633 6:29942601-29942623 CCCAGGTCTGGGTCAGGGCCAGG - Exonic
1005875303 6:30006644-30006666 CCCAGGTCTCGGCCAGGGCCAGG - Intergenic
1005905541 6:30259672-30259694 CCCAGGTCTCGGTCAGGGCCAGG - Intergenic
1005931665 6:30489570-30489592 CCCAGGTCTGGGTAAGGGCCAGG - Exonic
1005972546 6:30772645-30772667 CCCAGGGCTAGCACAGTGCCTGG + Intergenic
1005972785 6:30774627-30774649 CCCAGGCCTGGTACAGGGCAAGG - Intergenic
1006043304 6:31272002-31272024 CCCAGGTCTCGGTCAGGGCCAGG + Exonic
1006052892 6:31357089-31357111 CCCAGGTCTCGGTCAGGGCCAGG + Exonic
1006116211 6:31777365-31777387 CTCAGGCCTGGCACAGTGCCAGG + Intergenic
1006402250 6:33824738-33824760 GCCAGATCAGCCACAGGGCATGG + Intergenic
1006406770 6:33850039-33850061 CCCAGCTCTGGCCCTGGGCGCGG - Intergenic
1007075396 6:39063002-39063024 CCCACAGCTGGCACAGGGCCTGG - Intronic
1007438672 6:41838462-41838484 CCCAGAACCAGCCCAGGGCCTGG + Intronic
1007693972 6:43719973-43719995 CCTACACCTGGCACAGTGCCTGG - Intergenic
1010089289 6:71961048-71961070 CCCACCTCTGGCACAGGTACAGG + Intronic
1011548968 6:88511723-88511745 CCACGATCTGGCACAGTGCTAGG - Intergenic
1013144488 6:107374467-107374489 CCAAGGTCTAGCACAGTGCCTGG - Intronic
1014812579 6:125903296-125903318 CCCAGGTGTGGCAGAGGGCATGG - Intronic
1015782515 6:136883650-136883672 GCCAGACCTGACACAGGGGCTGG - Intronic
1015886563 6:137924086-137924108 CCCAGGTCTAGCATAGAGCCTGG + Intergenic
1016673374 6:146734204-146734226 CCCAGGATTGGCACAGTGCCTGG + Intronic
1019315417 7:381874-381896 CCTAGAGCTGCCACATGGCCGGG + Intergenic
1019449763 7:1091343-1091365 CCCAGCTTTGGGACAAGGCCTGG - Intronic
1019660953 7:2223757-2223779 GCCAGATGCGGCACCGGGCCTGG + Intronic
1022024382 7:26432506-26432528 CACACATCTGGCACAGTGCCTGG + Intergenic
1022237188 7:28473545-28473567 CCCATATCTGACACACTGCCTGG + Intronic
1022294312 7:29035650-29035672 CCCAGGCCTTGCACAGTGCCTGG + Intronic
1022792404 7:33702089-33702111 CCCAGAACTGGCAGAATGCCTGG - Intergenic
1022826740 7:34022322-34022344 CCCAAAGCTGGCACAGGACGAGG - Intronic
1023730648 7:43188742-43188764 GCCAGATATGGCACGGGGGCAGG - Intronic
1024534174 7:50416483-50416505 CCAAGGTCTAGCACAGTGCCTGG + Intergenic
1024707205 7:51973213-51973235 CCCAGCACTGGCATAGTGCCTGG - Intergenic
1024968011 7:55042364-55042386 CCCAGAGCTGGCACAAGGCTGGG + Intronic
1025093142 7:56079348-56079370 CCCAGGACTGGCACAGGCTCAGG + Intronic
1026640550 7:72120848-72120870 CCCACATGCAGCACAGGGCCTGG + Intronic
1026998241 7:74633572-74633594 ACCAGATCAGACCCAGGGCCGGG + Intergenic
1027528605 7:79301787-79301809 CCCAGTGCTGGAATAGGGCCTGG + Intronic
1027578668 7:79964305-79964327 CCAAAATCTAGCACAGTGCCTGG - Intergenic
1029606557 7:101602678-101602700 GCCATATCTGGTGCAGGGCCTGG - Intergenic
1033707720 7:143905132-143905154 CCCAGAACTCGCACTGGCCCAGG - Intergenic
1034078072 7:148251538-148251560 CCCAGATAAGGCAGAGGGACTGG - Intronic
1034275265 7:149821239-149821261 GACAGAGCTGGCCCAGGGCCTGG - Intergenic
1034276534 7:149826327-149826349 CCCACAGCTGGGGCAGGGCCTGG - Intergenic
1034438901 7:151076742-151076764 CCCAGCGCAGGCCCAGGGCCTGG + Exonic
1034517946 7:151595872-151595894 TCAAGATCTGGAACAAGGCCAGG + Intronic
1034989363 7:155538439-155538461 CCCAGATCTGCCACAGTTCAGGG - Intergenic
1035606802 8:934724-934746 CCGAGAGCCGGCACAGGGCTGGG - Intergenic
1036503643 8:9335827-9335849 CCCTGAACTGGCTCAGGTCCTGG - Intergenic
1037634708 8:20691428-20691450 CCCTGATTTGTCACATGGCCAGG - Intergenic
1037734282 8:21554523-21554545 CCAAAACCTAGCACAGGGCCTGG + Intergenic
1038412540 8:27369294-27369316 CCCAGGCCCAGCACAGGGCCTGG - Intronic
1038627912 8:29211696-29211718 CCCAGAGCTTGCACGGGGCTTGG + Intronic
1039540639 8:38365342-38365364 CCAAGATCTAGAACAGGGTCTGG - Intronic
1040389203 8:46935192-46935214 CCCTCATCTGGCAGAGGGCTGGG - Intergenic
1041419396 8:57649243-57649265 GCCAGAGCAGGCACAGGTCCTGG + Intergenic
1042494597 8:69441935-69441957 CTCAGAGCTGGCACTGGGCTTGG + Intergenic
1043315241 8:78912694-78912716 CCAAGATCAGGAACAGGGCAAGG + Intergenic
1044110810 8:88270978-88271000 CCCAGACCTGGCATAGTGCCTGG + Intronic
1044253774 8:90036000-90036022 CCCAGAGCTTGCATAGGGCTGGG - Intronic
1045035197 8:98170981-98171003 CCAGCACCTGGCACAGGGCCAGG + Intergenic
1045175859 8:99724200-99724222 CCCAGAGCAAGCCCAGGGCCTGG - Intronic
1046487620 8:114908470-114908492 CTCAGGACTGGCACAGAGCCGGG + Intergenic
1046519465 8:115305764-115305786 CCCAGTTCTGACTCAGAGCCTGG + Intergenic
1047457539 8:125029659-125029681 CCCAGCTCTGGAACAGTGCTTGG - Intronic
1047510473 8:125511872-125511894 CCCAGCACTGGCTCAGTGCCTGG - Intergenic
1048140559 8:131790173-131790195 CCCAGAGCAGGTGCAGGGCCTGG + Intergenic
1048229801 8:132627638-132627660 CCCCAATCTGGAACAGGGCCAGG - Intronic
1048547685 8:135402914-135402936 CCCAGAGCTGGCAGAGGATCTGG - Intergenic
1049168833 8:141145054-141145076 CCTAGATCTGGCAAAGGCCTAGG - Intronic
1049215276 8:141405023-141405045 CCAGGATCAGGCACAGGGTCAGG - Intronic
1049252302 8:141595803-141595825 CCCAGAGCAGGCACAGGGCCGGG + Intergenic
1049395716 8:142399344-142399366 TCCAGCTGTGGCCCAGGGCCTGG - Intronic
1049479519 8:142814674-142814696 CCCTGATCTGACACTGAGCCTGG + Intergenic
1050240391 9:3628416-3628438 TCCAGAGCTTGCACAGGGCTTGG - Intergenic
1051371632 9:16364160-16364182 GCCAGACTTGGGACAGGGCCTGG - Intergenic
1051604976 9:18909696-18909718 TCCAGAGCTGGCCCAGGGACCGG + Exonic
1051855412 9:21559602-21559624 CCCAGCTCTGGCCCGGGACCAGG + Intergenic
1052112265 9:24601081-24601103 CCATGATCTAGCACAGTGCCAGG + Intergenic
1052589540 9:30473482-30473504 CCAAGATCAGGCACAGTGCTAGG - Intergenic
1053285913 9:36849462-36849484 CCAACCTCTAGCACAGGGCCTGG + Intronic
1053559204 9:39171933-39171955 CTCAGGGCTAGCACAGGGCCTGG - Intronic
1053578365 9:39376619-39376641 CCCAATTCTAGCACAGCGCCTGG - Intergenic
1053823322 9:41992174-41992196 CTCAGGGCTAGCACAGGGCCTGG - Intronic
1053842893 9:42204691-42204713 CCCAATTCTAGCACAGTGCCTGG - Intergenic
1054099949 9:60935430-60935452 CCCAATTCTAGCACAGCGCCTGG - Intergenic
1054121348 9:61211053-61211075 CCCAATTCTAGCACAGCGCCTGG - Intergenic
1054137907 9:61447013-61447035 CTCAGGGCTAGCACAGGGCCTGG + Intergenic
1054459563 9:65455468-65455490 CTCAGATCTGGGAGGGGGCCTGG + Intergenic
1054586394 9:66971455-66971477 CCCAATTCTAGCACAGCGCCTGG + Intergenic
1054607251 9:67195191-67195213 CTCAGGGCTAGCACAGGGCCTGG + Intergenic
1054708031 9:68482823-68482845 CCAAGAGTTGGCACAGTGCCAGG - Intronic
1055417867 9:76103734-76103756 CTTTGATCTGGCTCAGGGCCTGG + Intronic
1057176992 9:93007706-93007728 GGCAGATTGGGCACAGGGCCAGG + Intronic
1057716770 9:97501862-97501884 CCCAGATATGGCTGAGGCCCCGG - Intronic
1059350029 9:113658052-113658074 CCAGGATCTGGCACAGAGACTGG + Intergenic
1059420708 9:114190195-114190217 TCAGTATCTGGCACAGGGCCTGG - Intronic
1059441292 9:114308518-114308540 CCCCGTCCTGGCTCAGGGCCTGG - Intronic
1059497653 9:114722818-114722840 CCCAGTCCTGGCACAGAGGCTGG + Intergenic
1059757307 9:117305450-117305472 CCCCAATATAGCACAGGGCCAGG + Intronic
1060098963 9:120820748-120820770 CCCAGAGATGGCACAGGCTCTGG + Intronic
1060294209 9:122332288-122332310 CCAGGTTCTGGCACAGGGCGTGG + Intergenic
1060400208 9:123344234-123344256 CCAGCATCTAGCACAGGGCCTGG + Intergenic
1060497503 9:124129360-124129382 ACCTTTTCTGGCACAGGGCCTGG - Intergenic
1060557750 9:124517786-124517808 CCCAGGTCTGCCATAGGGGCTGG - Exonic
1060810484 9:126609279-126609301 CCCAGATCTGGTTCAGGATCTGG - Intergenic
1060815565 9:126633334-126633356 TCCAAGCCTGGCACAGGGCCTGG + Intronic
1060973585 9:127752744-127752766 CTCAGCCCTGGCACAGGACCAGG - Intronic
1061011957 9:127961168-127961190 CCCAGCTGTGACACAGGGTCTGG - Intronic
1061271395 9:129545522-129545544 CCCCGGTCTGACACAGGGCTGGG + Intergenic
1061272655 9:129552184-129552206 CCAGCATCTGGCACAGTGCCTGG - Intergenic
1061629146 9:131860621-131860643 CGCAGCGCTGGCACGGGGCCTGG + Exonic
1061895879 9:133647292-133647314 CCCAGCTTTGACGCAGGGCCAGG + Intronic
1062109462 9:134774015-134774037 ACCAGAGCTCGCACAGTGCCCGG + Intronic
1062288981 9:135786187-135786209 CCGAGATCTGGGACTGGGCAGGG - Exonic
1062390408 9:136331519-136331541 CCCAGGCCTGGCCCAGGGCTGGG - Intronic
1062453134 9:136623833-136623855 CCCAGCTCCAGGACAGGGCCAGG + Intergenic
1185523187 X:757068-757090 CCCAGAGCCTGCACAGGACCAGG + Intergenic
1187393157 X:18898774-18898796 CCCAGATCTCGTGCAGGGCTCGG - Intronic
1188297741 X:28470562-28470584 ACTAGATCTGGGACAAGGCCAGG + Intergenic
1188688025 X:33094257-33094279 CCCAGAACTCACTCAGGGCCTGG - Intronic
1190059617 X:47202447-47202469 CACAGAACTGGTGCAGGGCCTGG - Exonic
1191627280 X:63283003-63283025 CCCAAGTTTGGCACAGAGCCAGG + Intergenic
1193023693 X:76821367-76821389 TCCAGGTCTGCCTCAGGGCCAGG - Intergenic
1195697982 X:107680824-107680846 CCCACATCTGGAACAGATCCTGG - Intergenic
1195965011 X:110422103-110422125 CCCAGACTTGGCATAGTGCCTGG + Intronic
1196785578 X:119418914-119418936 CCCACACCTAGCCCAGGGCCTGG + Intronic
1196947510 X:120842394-120842416 CCAGCATCTAGCACAGGGCCTGG + Intergenic
1198230866 X:134687952-134687974 CCCAGAGCTAGCACAGCTCCAGG - Intronic
1198560217 X:137841631-137841653 CCAACATTTGGCACAGTGCCTGG + Intergenic
1198750734 X:139933824-139933846 TCCAGCCCTGGCACAGTGCCTGG - Intronic
1199708246 X:150449737-150449759 TCAAGATCGAGCACAGGGCCAGG - Intronic
1199852249 X:151733562-151733584 CCCAGCTCTCACACAGGGCCTGG - Intergenic
1200091861 X:153639779-153639801 CTCACAGCTGGCACAGGGGCAGG - Intergenic
1200093698 X:153647546-153647568 CCTAGATCTCCCCCAGGGCCAGG - Intronic
1200211605 X:154349106-154349128 CCCAGAACTGGCTTAGGGACAGG - Intronic
1200372083 X:155738601-155738623 CCCAGAAGTGGTACAGAGCCAGG + Intergenic