ID: 1161397315

View in Genome Browser
Species Human (GRCh38)
Location 19:4051707-4051729
Sequence CCAGATCTGGCACAGGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397304_1161397315 6 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397315 19:4051707-4051729 CCAGATCTGGCACAGGGCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 187
1161397306_1161397315 -9 Left 1161397306 19:4051693-4051715 CCGGGCTGCCTTGCCCAGATCTG 0: 1
1: 0
2: 1
3: 27
4: 340
Right 1161397315 19:4051707-4051729 CCAGATCTGGCACAGGGCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 187
1161397305_1161397315 5 Left 1161397305 19:4051679-4051701 CCACGGCAAGGTCTCCGGGCTGC 0: 1
1: 0
2: 1
3: 14
4: 94
Right 1161397315 19:4051707-4051729 CCAGATCTGGCACAGGGCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 187
1161397300_1161397315 18 Left 1161397300 19:4051666-4051688 CCTTCTGCAAAGCCCACGGCAAG 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1161397315 19:4051707-4051729 CCAGATCTGGCACAGGGCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397315 Original CRISPR CCAGATCTGGCACAGGGCCG GGG Intronic
900088967 1:911013-911035 CCAAATCCTGCCCAGGGCCGAGG - Intergenic
900305367 1:2004027-2004049 CCAGGCCTGGCCCAGGGCCAAGG + Intergenic
900419206 1:2548341-2548363 CCAGAGCTGGGACAGGGCCAAGG - Intergenic
901745482 1:11370276-11370298 CCGCATCTGGCCCAGGGCAGAGG + Intergenic
901845529 1:11980016-11980038 CCAGAGCTGGCAGAGGCCCCAGG + Intergenic
902343697 1:15800647-15800669 TCAGATCTGGCAGAGAGCCCAGG + Intergenic
904328116 1:29740421-29740443 CCAGATCTGGTCCTGGGCTGTGG - Intergenic
904541092 1:31233944-31233966 TGAGATCTGGCACAGGGGCTAGG - Intronic
904875966 1:33654806-33654828 CCTGAGCTGGCAAAGGGACGTGG - Intronic
906227810 1:44136406-44136428 CCAGACTTGGCACATAGCCGGGG + Intergenic
906873723 1:49513095-49513117 CCAGTTCTGCCACATGGCAGAGG - Intronic
913958029 1:143321054-143321076 CCAGATCTAGGACAAGGCTGGGG + Intergenic
914052339 1:144146412-144146434 CCAGATCTAGGACAAGGCTGGGG + Intergenic
914126858 1:144820129-144820151 CCAGATCTAGGACAAGGCTGGGG - Intergenic
914328636 1:146645596-146645618 CCAGAACTGGCACTGTGACGGGG - Intergenic
917926566 1:179794076-179794098 CCAGGACTTGCACAGGGCAGCGG + Intronic
918126561 1:181589100-181589122 CCAGATCTGGGGCAGGGCCCGGG - Intronic
919673694 1:200360983-200361005 CCTGATCTGGGAGAGGGACGGGG - Intergenic
922115221 1:222607037-222607059 CCAGATTTGGCAGAGGCCAGGGG - Intergenic
923129034 1:231058850-231058872 CCAGAGCTGGCCCAGCGCTGGGG + Intergenic
1066461801 10:35619078-35619100 GCAGATCCGGCAGGGGGCCGGGG - Intergenic
1067456251 10:46421265-46421287 CCAGTCCCTGCACAGGGCCGAGG + Intergenic
1067630948 10:47963374-47963396 CCAGTCCCTGCACAGGGCCGAGG - Intergenic
1068404896 10:56575395-56575417 CCAGATTTTGCTCAGGGCCCAGG + Intergenic
1069832430 10:71289469-71289491 CCAGAGCTGACGCAGGGCAGCGG - Intronic
1071490513 10:86133425-86133447 CCAGCTGTGGCACATGGCAGTGG - Intronic
1072443159 10:95475184-95475206 GCAGATCTGGCACATGGTGGTGG + Intronic
1072572045 10:96666905-96666927 CTAGATGTGGCCCAGGGCAGTGG + Intronic
1074422558 10:113322301-113322323 ACAGACCTGGCACAGGGATGAGG - Intergenic
1074821222 10:117180205-117180227 CCAGGTGTGGCACAGGGATGGGG - Intergenic
1075095116 10:119466166-119466188 CCAGACCTGGCTCAGGGGAGGGG + Intergenic
1075312103 10:121423054-121423076 ACAGCTCTGGCCCAGGGCTGTGG + Intergenic
1075348143 10:121699393-121699415 GCAGATCTGGCAGAGGGCAGAGG + Intergenic
1075711760 10:124534463-124534485 CCAGCCCTGGCCTAGGGCCGGGG + Intronic
1076606563 10:131693375-131693397 CCAGACCTAACACAGGGCCGTGG + Intergenic
1076761293 10:132607118-132607140 CCGGAGCTGGCACAGAGCCCAGG + Intronic
1077302013 11:1851819-1851841 CCAGATCAGGCCCAGCGCCATGG - Intergenic
1078602826 11:12748765-12748787 TCAGCTCTGGCAGAGGGCTGAGG + Intronic
1081554984 11:44150553-44150575 CTAGATCTTGCACTGGGCAGTGG + Intronic
1084020418 11:66414000-66414022 CAAGGCCTGGCACAGGGCAGGGG - Intergenic
1084321476 11:68375761-68375783 CCAGAGGTGGCACAGAGACGGGG - Intronic
1085284884 11:75353017-75353039 CCAGATTTGGCAGAGGGGCAGGG + Intergenic
1088539302 11:110896515-110896537 CCAGATCAGGCTGAGGGCTGGGG - Intergenic
1102204829 12:111083259-111083281 CCAGAACTGGGGCAGGGCAGGGG + Intronic
1102440494 12:112960287-112960309 CCACATCTAGCACAGGATCGGGG + Intronic
1104358751 12:128112469-128112491 GCAGAGCTGGCACAGAGCAGAGG - Intergenic
1104535667 12:129615876-129615898 CCAGTTCTGGCTCTGGGACGGGG - Intronic
1108495425 13:51019868-51019890 CCAGATCTGGAACAGCACCCTGG + Intergenic
1112337399 13:98526501-98526523 CCAGAGCTGGCAGAGGGCGGTGG + Intronic
1112388274 13:98960101-98960123 ACAGATCTGGCACACAGCCGTGG + Intronic
1112392290 13:98996586-98996608 CCACATATGGCCCTGGGCCGTGG - Intronic
1113203865 13:107894498-107894520 CCAGATTTGGTTCAGGGCCTAGG + Intergenic
1113910080 13:113837576-113837598 CCAGCTCTGGCCCTGGGCTGAGG + Intronic
1114629609 14:24150733-24150755 AAAGAGCTGGCATAGGGCCGGGG - Exonic
1116326948 14:43541603-43541625 CCAGATCTGGGACACGTCTGTGG - Intergenic
1116863814 14:50015511-50015533 CCAGATGTGGCAGAGGGTGGAGG - Intergenic
1118017711 14:61676629-61676651 GCAGCTGTGGCACAGGGCCATGG - Intergenic
1119482059 14:74964039-74964061 CCAGCTCTGGCTCAGTGCTGGGG + Intergenic
1122374518 14:101249069-101249091 CCTCTTCTGGCACAGGGCGGTGG + Intergenic
1122776904 14:104121249-104121271 GCACATCTGTCACAGGGCTGTGG + Intergenic
1122951952 14:105050120-105050142 CCAGATCTGACTCAGCCCCGAGG + Exonic
1123404895 15:20013579-20013601 CCTGCTCTGGCACAGAGCCTGGG - Intergenic
1123514226 15:21020227-21020249 CCTGCTCTGGCACAGAGCCTGGG - Intergenic
1127293793 15:57592238-57592260 CCAGAGCCGGCACAGGACCGGGG - Intronic
1128648841 15:69396093-69396115 CCAGATCTGGCACCTGCCTGAGG + Intronic
1128787290 15:70407140-70407162 CCAGAGCTGTCCCAGGGCAGCGG - Intergenic
1129233404 15:74209146-74209168 CCAGCTCAGGCACAGAGCAGGGG + Intronic
1129782743 15:78284585-78284607 CTAGGTCTGGCAGAGGGCCTGGG - Intronic
1130354863 15:83120045-83120067 CCAGATCAGGCACAGCTCTGCGG + Intronic
1132311604 15:100861766-100861788 ACAGCTCTTGCACAGGGCAGTGG - Intergenic
1132495966 16:263579-263601 CCACATCTGGACCAGGGCCCAGG - Intronic
1133035871 16:3033966-3033988 CCAGGTCAGGCTCAGGGCAGTGG + Intronic
1133709374 16:8386485-8386507 AAAGATCTGGGACAGGGCCATGG + Intergenic
1136841402 16:33545438-33545460 ACAGGGCTGGGACAGGGCCGGGG + Intergenic
1137576857 16:49605649-49605671 CCAGGGCTGGTGCAGGGCCGGGG - Intronic
1140004928 16:71065347-71065369 CCAGAACTGGCACTGTGACGGGG + Intronic
1140441733 16:74993153-74993175 CCAGCTCTGGCCCAGCGTCGTGG + Intronic
1142408752 16:89905545-89905567 ACAGAACTAGCACAGGGCCAAGG - Intronic
1203124314 16_KI270728v1_random:1561433-1561455 CCAGATCTAGGACAAGGCTGGGG - Intergenic
1203151567 16_KI270728v1_random:1845735-1845757 ACAGGGCTGGGACAGGGCCGGGG + Intergenic
1143151692 17:4810860-4810882 ACTGAGCTGGCACAGGGCCCAGG + Exonic
1143433971 17:6909006-6909028 GCAGTTTTGGCACAGGGCCAGGG + Intronic
1144711482 17:17404274-17404296 CCAGTCCTGGCACAGGGACTGGG - Intergenic
1146277470 17:31524652-31524674 CCAGACCTGGGACAGGGCCAGGG - Intronic
1146906111 17:36618859-36618881 CCAGCTCTGTCACATGGCCTGGG - Intergenic
1148334386 17:46831936-46831958 CCAGCTCTGGCACAGTGTCCTGG - Intronic
1150647143 17:66986060-66986082 CAGGAGCTGGCTCAGGGCCGGGG - Intronic
1151779915 17:76239413-76239435 CCAGCTCTGGGACAGGGCAGAGG - Intronic
1152742655 17:82025108-82025130 CCAGATCAGTCACAAGGGCGCGG + Exonic
1152904256 17:82961681-82961703 GCAGGGCTGGCACAGGCCCGGGG - Intronic
1155914851 18:31546629-31546651 CAAAATCTGGCAGAGGGCCAGGG - Exonic
1157620053 18:49011786-49011808 CCAGGTCTGGAACAGGGTCCAGG - Intergenic
1161159790 19:2755451-2755473 TCCGAGCAGGCACAGGGCCGGGG + Exonic
1161397315 19:4051707-4051729 CCAGATCTGGCACAGGGCCGGGG + Intronic
1161981717 19:7633494-7633516 CCCTCTCTGGCACTGGGCCGGGG - Exonic
1163007501 19:14406052-14406074 CCAGATCCCGGACAGGGGCGGGG - Intronic
1163100866 19:15095643-15095665 CCAGATCTGGCATGTGGCCTTGG - Intergenic
1163404229 19:17112538-17112560 TCAGATCTGGCACATCCCCGCGG - Intronic
1165976719 19:39682383-39682405 CCAGATCTGACCCAGGGTCAAGG + Intergenic
1166821256 19:45581607-45581629 CAAGGCCTGGCACAGGGCAGAGG + Intronic
1167108978 19:47447733-47447755 CCTGATGTGGCTCAGGGGCGGGG - Intronic
1167211955 19:48139134-48139156 CCAGGTCTGGCTCAGAGCCCAGG - Intronic
1167376949 19:49117530-49117552 CCTGAGCTGGCCCAGGGCTGTGG + Intronic
1168368936 19:55814867-55814889 CCAGGACTGGCACACGGCCCAGG + Intronic
1202691736 1_KI270712v1_random:98836-98858 CCAGATCTAGGACAAGGCTGGGG + Intergenic
925377357 2:3397442-3397464 CCAGAGCTCACACAGGGCTGTGG - Intronic
926129850 2:10296069-10296091 ACAGACCAGGCACAGGGCCTGGG + Intergenic
926161560 2:10493670-10493692 GGAGAGGTGGCACAGGGCCGGGG - Intergenic
927207047 2:20617354-20617376 CCAGAGCTGGCTCAGAGCCCTGG + Intronic
929592413 2:43155890-43155912 CCAGGCCTGGCACGGGGCAGTGG - Intergenic
931430936 2:62208595-62208617 CCAGGACTGGCACAGAGCCAGGG + Intronic
933152324 2:78930473-78930495 TCAGATGTGGCACAGGGCCTTGG + Intergenic
933954652 2:87355114-87355136 CCAGATCTAGGACAAGGCTGGGG - Intergenic
934188506 2:89765618-89765640 CCACTTCTGCCACAGGGCCCCGG - Intergenic
934238849 2:90251340-90251362 CCAGATCTAGGACAAGGCTGGGG - Intergenic
934274347 2:91565370-91565392 CCAGATCTAGGACAAGGCTGGGG + Intergenic
935386556 2:102505439-102505461 CCAGATTTGGCAGAAGGCCAGGG - Exonic
937127787 2:119485300-119485322 TCAGACCTGGCCCAGGGCCAGGG - Intronic
938077073 2:128345779-128345801 CCAGAGCGGCCTCAGGGCCGGGG - Intergenic
938163690 2:129008623-129008645 CCACAGCTGGCACAGAGCAGGGG - Intergenic
942678280 2:178451003-178451025 CCAGAGCAGGCACCGCGCCGAGG - Exonic
942812430 2:180014634-180014656 TCAGATCTGCCTCAGGGCCCGGG - Intergenic
943365221 2:186962142-186962164 CCAGAGTGGGCACCGGGCCGAGG - Intergenic
943780656 2:191819996-191820018 CCAGTTCTAGCACAAGGTCGGGG + Intergenic
945253676 2:207785925-207785947 CCAGGTCTGGGACAGGGTCGTGG + Intergenic
946727063 2:222671542-222671564 CCAGAGCTGGCCCAGCGCCCTGG - Intergenic
946851263 2:223909204-223909226 CTAGGTCTGGCATAGAGCCGGGG + Intronic
1170484741 20:16805001-16805023 CCAGAGCTGTGACAGGGCTGGGG - Intergenic
1172244650 20:33437691-33437713 CCAGAACAGGCACAGGGAGGTGG - Intronic
1172704492 20:36872996-36873018 CCAGAGTGGGCACAGGGCCAGGG + Intergenic
1173872678 20:46351703-46351725 CCAACTCTGGCACTGGGCAGTGG - Intronic
1175789574 20:61732917-61732939 GCACATGTGGCACAGGGCGGAGG - Intronic
1175812332 20:61864965-61864987 CCAGGTGTGGCACAGAGCCCTGG - Intronic
1176151790 20:63595257-63595279 CCAGATTTGGGGCTGGGCCGTGG + Intronic
1177081754 21:16648231-16648253 CCAGAGCTCACACAGGGCTGGGG - Intergenic
1181513214 22:23397999-23398021 ATAGATCTGGCAGAGGGCCCTGG + Intergenic
1181859315 22:25805894-25805916 CCAGACCTTGCTCAGGGCCAGGG - Intronic
1183598447 22:38826195-38826217 CCAGCTATGGGACAGGGCTGAGG - Intronic
1184143138 22:42591407-42591429 CCACTTCTAGCACAGGGCCTTGG + Intronic
1184599019 22:45531784-45531806 CCAGCTCTGGCCCTGGGCCTGGG - Intronic
1185199785 22:49494439-49494461 CCAGCTCTTCCACAGGGCCCCGG - Intronic
1185208613 22:49554264-49554286 CCAGGCCTGGCACAGGGACAGGG + Intronic
1185313524 22:50169585-50169607 CCTGAGCTGGCACAGGCCCCGGG + Intergenic
953835470 3:46339260-46339282 CCTGAAGTGGCACAGGGCAGCGG + Intergenic
953850979 3:46465171-46465193 CCAGAGCTGGGACAGGGCTCAGG - Intronic
954578699 3:51691346-51691368 CCTGCTCTGGCACAGGGAGGAGG + Intronic
957220065 3:77370607-77370629 CCAGACCTGGCATGTGGCCGTGG - Intronic
958971035 3:100610561-100610583 CCAGCTCTGGCACACAGCGGGGG - Intronic
959227362 3:103603026-103603048 ACAGAGCTGGCACAGTGCTGAGG + Intergenic
960507262 3:118508917-118508939 ACAGATCTGGCAGGGGGCAGAGG - Intergenic
961122479 3:124384710-124384732 CCTGATCTGGCACTGAGGCGCGG - Intronic
961513816 3:127420548-127420570 CCAGAGCAGGTACAGGGCCTGGG + Intergenic
963047042 3:141110152-141110174 CCAGCCCTGGGACAGGGCTGAGG - Intronic
969176707 4:5404273-5404295 CCAGAGCTGGAAGAGGGCCCTGG - Intronic
971473644 4:27052328-27052350 CCATATCTGGCCCAGGCCCTGGG + Intergenic
976303366 4:83536123-83536145 GCGGAGCTGGCACCGGGCCGCGG - Intronic
989071768 5:37519226-37519248 CCAGATGGGGCACCGGGCAGAGG + Intronic
991480485 5:67073184-67073206 CCTGCTCTGGCACAGTGCCATGG - Intronic
992977065 5:82131384-82131406 CCAGTTCTGCCACATGGCAGAGG + Intronic
994094644 5:95838188-95838210 TCAGCTATGGCACAGGGCCTGGG - Intergenic
997255226 5:132423331-132423353 CCAGGTCTGGCCCTGGGCCCTGG + Intronic
997614352 5:135236357-135236379 GCAGCTCTGGCACAGGGTCCCGG + Intronic
997638473 5:135432925-135432947 CCAGACCTGGCACCTGGTCGGGG - Intergenic
1001490648 5:172152408-172152430 CAAAATCTGGCTCAGGGCTGGGG + Intronic
1001881348 5:175246826-175246848 CAAGAAGTGTCACAGGGCCGGGG - Intergenic
1003242695 6:4358523-4358545 CCAGCTCTGGCACAGGCCAATGG + Intergenic
1005866631 6:29942600-29942622 CCAGGTCTGGGTCAGGGCCAGGG - Exonic
1006066033 6:31463253-31463275 CCAGGTCTGGATCAGGGCCACGG - Intergenic
1006429129 6:33984429-33984451 ACAGATCTGGCCCAGGGAAGAGG + Intergenic
1008019950 6:46565103-46565125 GGAGATCTGGGACAGGGCCCAGG + Intronic
1018140995 6:160837275-160837297 CCAGCTCTGCCACAGGGAAGGGG - Intergenic
1019315418 7:381875-381897 CTAGAGCTGCCACATGGCCGGGG + Intergenic
1019329456 7:455468-455490 CCAGGCCTGGCACAGGGAGGAGG - Intergenic
1019694764 7:2439014-2439036 CCAGATCGGGGGCCGGGCCGGGG + Intergenic
1024957854 7:54944235-54944257 CTAGAGCTTGCACAGGGCAGAGG + Intergenic
1025232117 7:57209573-57209595 CCAGATGTGGCACATGCCTGTGG + Intergenic
1026998243 7:74633573-74633595 CCAGATCAGACCCAGGGCCGGGG + Intergenic
1034275264 7:149821238-149821260 ACAGAGCTGGCCCAGGGCCTGGG - Intergenic
1035606801 8:934723-934745 CGAGAGCCGGCACAGGGCTGGGG - Intergenic
1037620252 8:20557349-20557371 CCAGATCTGTTTCAGGGCAGCGG - Intergenic
1039576574 8:38628527-38628549 CCAGCTGTGGCAAAGGGCCCAGG + Intergenic
1040932591 8:52750468-52750490 GCAGAGCTGGCACAGAGCAGAGG - Intergenic
1041268401 8:56086718-56086740 CAAAATCTGGCCCAGCGCCGTGG + Intergenic
1041419398 8:57649244-57649266 CCAGAGCAGGCACAGGTCCTGGG + Intergenic
1041783450 8:61604270-61604292 CCTGAGATGTCACAGGGCCGAGG + Intronic
1043794534 8:84519911-84519933 TCATATTTGGCAGAGGGCCGAGG - Intronic
1046487621 8:114908471-114908493 TCAGGACTGGCACAGAGCCGGGG + Intergenic
1048062559 8:130935517-130935539 CCAGACCAGGCACAGGGAGGTGG - Intronic
1049305325 8:141899800-141899822 CCAGAGCTGGGACGGGGCCCTGG - Intergenic
1049395714 8:142399343-142399365 CCAGCTGTGGCCCAGGGCCTGGG - Intronic
1049504154 8:142985919-142985941 CCAAATCTGCCCCAGGGCCAAGG + Intergenic
1051604978 9:18909697-18909719 CCAGAGCTGGCCCAGGGACCGGG + Exonic
1053291880 9:36885658-36885680 GCAGAGATGGCACAGGGCAGGGG - Intronic
1055764416 9:79646273-79646295 CCAGATGGGGCAGAGGGCAGAGG + Intronic
1060497501 9:124129359-124129381 CCTTTTCTGGCACAGGGCCTGGG - Intergenic
1061507005 9:131037060-131037082 CCAGAACTGGGGCTGGGCCGGGG + Intronic
1062240296 9:135533997-135534019 CCAGCTCTACCCCAGGGCCGAGG - Intergenic
1186995961 X:15122689-15122711 CTGGATTTGGCACAGGGCAGGGG + Intergenic
1191851230 X:65587822-65587844 CCAGTTCTGGCACAGGCCACAGG + Intergenic
1199383215 X:147194264-147194286 CCAGACATTGCACAGGGCAGTGG - Intergenic