ID: 1161397319

View in Genome Browser
Species Human (GRCh38)
Location 19:4051722-4051744
Sequence GGCCGGGGTCACAGAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 479}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397306_1161397319 6 Left 1161397306 19:4051693-4051715 CCGGGCTGCCTTGCCCAGATCTG 0: 1
1: 0
2: 1
3: 27
4: 340
Right 1161397319 19:4051722-4051744 GGCCGGGGTCACAGAGGGGATGG 0: 1
1: 0
2: 4
3: 50
4: 479
1161397312_1161397319 -7 Left 1161397312 19:4051706-4051728 CCCAGATCTGGCACAGGGCCGGG 0: 1
1: 0
2: 3
3: 31
4: 247
Right 1161397319 19:4051722-4051744 GGCCGGGGTCACAGAGGGGATGG 0: 1
1: 0
2: 4
3: 50
4: 479
1161397304_1161397319 21 Left 1161397304 19:4051678-4051700 CCCACGGCAAGGTCTCCGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1161397319 19:4051722-4051744 GGCCGGGGTCACAGAGGGGATGG 0: 1
1: 0
2: 4
3: 50
4: 479
1161397309_1161397319 -2 Left 1161397309 19:4051701-4051723 CCTTGCCCAGATCTGGCACAGGG 0: 1
1: 0
2: 0
3: 40
4: 341
Right 1161397319 19:4051722-4051744 GGCCGGGGTCACAGAGGGGATGG 0: 1
1: 0
2: 4
3: 50
4: 479
1161397305_1161397319 20 Left 1161397305 19:4051679-4051701 CCACGGCAAGGTCTCCGGGCTGC 0: 1
1: 0
2: 1
3: 14
4: 94
Right 1161397319 19:4051722-4051744 GGCCGGGGTCACAGAGGGGATGG 0: 1
1: 0
2: 4
3: 50
4: 479
1161397314_1161397319 -8 Left 1161397314 19:4051707-4051729 CCAGATCTGGCACAGGGCCGGGG 0: 1
1: 0
2: 1
3: 17
4: 186
Right 1161397319 19:4051722-4051744 GGCCGGGGTCACAGAGGGGATGG 0: 1
1: 0
2: 4
3: 50
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397319 Original CRISPR GGCCGGGGTCACAGAGGGGA TGG Intronic
900103167 1:971411-971433 GGGCGGGCCCACAGTGGGGAGGG - Intronic
900177978 1:1299088-1299110 GGCCAGGGAAGCAGAGGGGAGGG + Intronic
900188062 1:1342228-1342250 GGCTGGGGTCCCACAGGCGAGGG - Intronic
900242864 1:1625227-1625249 GGCTGAAGTCCCAGAGGGGAGGG + Intronic
900409656 1:2506918-2506940 GGCTGGGGTCACAGAGGCTGGGG + Intergenic
900626712 1:3611731-3611753 GGCCGGGACCGGAGAGGGGAGGG - Intergenic
900996938 1:6127914-6127936 GGGCGGGGTCACAGCTTGGAGGG + Intronic
901199254 1:7457487-7457509 GCCCGGGGACACTGAGGGGCAGG - Intronic
901225862 1:7612658-7612680 GGCAGGGGTCACAGTGTGCATGG + Intronic
901272986 1:7967890-7967912 AGCCTGGGTGACAGAGGTGAGGG + Intronic
901551265 1:9997585-9997607 GGCCGGGGGAACAGAGGGCGTGG - Intronic
901842143 1:11960526-11960548 GGCCGGGGTGCCAGAGATGAAGG + Intronic
901868808 1:12125587-12125609 GGCCGGAGTCAGGGTGGGGAGGG - Intronic
901877556 1:12175521-12175543 GGCTGGGGTCAGCGAGAGGAGGG - Intronic
902264431 1:15251901-15251923 GGAAGGGGTCAGGGAGGGGACGG - Intronic
902388113 1:16087767-16087789 GGGCGGTGTCACTGTGGGGAGGG + Intergenic
903061337 1:20670785-20670807 GGCTGGGGTCTCAGCAGGGATGG + Intronic
903137250 1:21317650-21317672 TGCCTAGCTCACAGAGGGGAGGG - Intronic
903137610 1:21319609-21319631 TGCCCAGTTCACAGAGGGGAGGG - Intronic
903301080 1:22379244-22379266 GGCCGGGCAGCCAGAGGGGATGG - Intergenic
903381887 1:22902890-22902912 GGCAGTCTTCACAGAGGGGATGG + Intronic
903535390 1:24063233-24063255 GGCTGGGGAGACAGAGGAGAAGG + Exonic
903830066 1:26169390-26169412 GGTTGGGGTCAGAGAGAGGATGG + Intergenic
904104695 1:28069430-28069452 GGCTGGGGTCAAAGTGGGAAGGG + Intronic
904458298 1:30660449-30660471 GGCCGGGGTCACACAGAAGCCGG - Intergenic
904769369 1:32872315-32872337 GTCTGGGGGCACTGAGGGGATGG - Intronic
905448921 1:38045090-38045112 GGCGGGGGTCGTCGAGGGGATGG + Exonic
905643628 1:39609599-39609621 GGCCACGGTCGCAGAAGGGAGGG + Intergenic
905659401 1:39709838-39709860 GGCCAGGGTCGCAGAAGGGAGGG - Intronic
906069618 1:43007532-43007554 GGCCGGGGCCCCAAAGGGGAGGG - Intergenic
906101642 1:43267662-43267684 GGCCGTGGGCACAAAGCGGAAGG - Intronic
906513383 1:46424105-46424127 GGCTGGGGTCATGGACGGGAGGG - Intergenic
906669288 1:47643108-47643130 GGGTGGGGTCACAAGGGGGATGG - Intergenic
907437646 1:54459763-54459785 AGCCGGGGTCACATGGGGGAGGG - Intergenic
907866256 1:58402241-58402263 GGCCTGGGTCCCACAGTGGAGGG - Intronic
908031182 1:60001462-60001484 GGCCGGGGTAACAGTGGTGGGGG + Intronic
908792661 1:67798363-67798385 GCCAGTGGTCACAGAGGGGTTGG - Intronic
910657394 1:89632942-89632964 GGCCTGCGTCACAGCGGGGCTGG + Intergenic
911063079 1:93764446-93764468 GGCTGGGGTGGGAGAGGGGAGGG - Intronic
912416068 1:109509192-109509214 GGCTGGGGTCACAGGGGTGCAGG + Intronic
912633598 1:111270810-111270832 GGCCGGGGGCGCAGCGGGGGCGG - Intergenic
913250577 1:116909747-116909769 GGGTGGGGGCCCAGAGGGGATGG + Intergenic
914913407 1:151803868-151803890 GGCTGAGGTGACAGAGGAGAAGG + Intronic
915515685 1:156411159-156411181 GGCAGGGGTACCAGAGGGAAGGG + Intronic
915555737 1:156659824-156659846 GGCTGGGGTCCCAGAGAGGAAGG + Intergenic
916024507 1:160822230-160822252 GGAAGGGGTCTCAGAGGGGTGGG + Intronic
916548492 1:165828212-165828234 GGCCGGGGTCCTATGGGGGAAGG + Intronic
918116422 1:181502078-181502100 TGCCGTGGTTAGAGAGGGGATGG + Intronic
919977625 1:202623150-202623172 GGCTGGGGTGGCAGAGCGGAGGG - Intronic
919987676 1:202687217-202687239 GGGAGGGGACTCAGAGGGGAGGG - Intronic
920002065 1:202807451-202807473 GGCCGGGGTCAAGAAGGGGGCGG - Intronic
920180482 1:204129308-204129330 GGCCGGGGGCCGAGAGGGGCGGG - Intergenic
920200371 1:204256584-204256606 GGGCTGTGTCACAGAGGAGAAGG + Intronic
921816739 1:219572522-219572544 AGCCTGGGTGACAGAGAGGAAGG + Intergenic
922420946 1:225460924-225460946 GGTGTGGGTGACAGAGGGGAGGG - Intergenic
924584989 1:245354345-245354367 GGCCTGGGTTTCAGAGGGGACGG - Intronic
924707879 1:246513170-246513192 TGGTGGGGTCACAGATGGGAGGG - Intergenic
1062788535 10:285467-285489 GGCCGGGGTAACCGGAGGGAGGG + Intronic
1062823309 10:550829-550851 GCCTGGGGTCCCAGAGGGAATGG - Intronic
1065260060 10:23914694-23914716 GGCTGGAGTGAAAGAGGGGAGGG - Intronic
1067153041 10:43752077-43752099 GCCTGAGGTCACAGATGGGAAGG + Intergenic
1070593229 10:77815158-77815180 GGCCCTGGCCACAGAGAGGACGG - Intronic
1070930349 10:80256613-80256635 GGACAGGGTCACAGAGAGAAAGG + Intergenic
1071290608 10:84186073-84186095 GGCCTGGCGCACAGAGGGGCTGG - Intergenic
1071507291 10:86240460-86240482 GGCCAGGGGCACTGAGAGGAAGG + Intronic
1071663718 10:87532092-87532114 GGCAGGGGTGGTAGAGGGGAAGG - Intronic
1073146417 10:101284655-101284677 GGCGGGGCCCATAGAGGGGAAGG - Intergenic
1074756317 10:116627028-116627050 GGTAGGGGTCAGAGAGGGGCAGG + Intronic
1075259992 10:120955045-120955067 GACAGGGCTCATAGAGGGGAGGG + Intergenic
1075736510 10:124667664-124667686 GCCCGGGGTCACAGGGCAGAGGG + Intronic
1075871211 10:125773775-125773797 CGCCGGGGTCCCCGAGGGGCTGG + Intronic
1076406061 10:130213266-130213288 GGCCCAGGTCACAGACGGGGTGG - Intergenic
1076524976 10:131106711-131106733 GGGCAGGGTCAGGGAGGGGAAGG + Intronic
1076702268 10:132279992-132280014 GGGCGTGGTCACAGAGTGCAGGG - Intronic
1076746407 10:132517028-132517050 GGCCAGGGCCACAGTGGGGCGGG + Intergenic
1076793538 10:132788398-132788420 GGCGGGGGCCGGAGAGGGGACGG - Intergenic
1076931970 10:133537351-133537373 GGCAGGGGTCACTGAGGGGAAGG + Intronic
1077048155 11:555213-555235 GGACGAGGAGACAGAGGGGAGGG + Intronic
1077181856 11:1220428-1220450 GGCCGTGGTCAGGGAGGGCAGGG + Intergenic
1077211380 11:1372328-1372350 GGCCCGGTTCCCACAGGGGAGGG - Intergenic
1077311770 11:1891957-1891979 GGCGGTGGTCAGAGAGTGGAAGG - Exonic
1077320165 11:1937433-1937455 GCCCAGCGTCACAGAGGGGCTGG - Intronic
1077330483 11:1981975-1981997 GGCCGGGGCCCCCAAGGGGAAGG + Intronic
1077367322 11:2166436-2166458 AGCCGGGGTCACCCAGGGGCTGG - Intronic
1077953649 11:6989729-6989751 GGCCTGGGTCACAGAAGAGTTGG + Intergenic
1078099041 11:8318810-8318832 GGCCTGTGGCACAGAGGGCAAGG - Intergenic
1078262461 11:9723091-9723113 GGCAGGGCTTAAAGAGGGGAGGG + Intronic
1078450557 11:11437678-11437700 TGCTGAGGTCAAAGAGGGGAGGG - Intronic
1080099648 11:28445002-28445024 GGATGGGGTTAGAGAGGGGAAGG + Intergenic
1082170534 11:48999149-48999171 AGCCAGGGTCACAGAGTGGAGGG + Intergenic
1083703654 11:64498347-64498369 GGCGAGGGTCACAGTGGGGCGGG - Intergenic
1083757824 11:64801036-64801058 AGGTGGGGTCACAGATGGGATGG + Intronic
1084095836 11:66910665-66910687 GGCAGGGGTCACAGGGGCTAAGG + Intronic
1084213406 11:67634162-67634184 GGCCGGGGCCACGGTGGGGACGG - Intronic
1084238831 11:67805395-67805417 GGGCGGGGGCAGAGAGGGGGCGG + Intergenic
1084644775 11:70449585-70449607 GGCCAGGGTCACTCAGAGGAAGG + Intergenic
1085349218 11:75787866-75787888 GGCTGTGGACACATAGGGGAGGG + Intronic
1085816467 11:79742395-79742417 GTCTGGCTTCACAGAGGGGAAGG - Intergenic
1086695279 11:89837204-89837226 AGCCAGGGTCACAGAGTGGAGGG - Intergenic
1086710873 11:90007280-90007302 AGCCAGGGTCACAGAGTGGAGGG + Intergenic
1087159112 11:94931806-94931828 GCCCGGAGTCACACAGGTGAGGG - Intergenic
1087813248 11:102631145-102631167 TGCCGGGGGCACCAAGGGGAGGG + Intergenic
1087936163 11:104036784-104036806 GGCCGGGCTAGCAGAGGGCATGG - Exonic
1089785662 11:120905199-120905221 GGCCAGGGGCACAGAGGGTCGGG - Intronic
1202813461 11_KI270721v1_random:37154-37176 GGCCGGGGCCCCCAAGGGGAAGG + Intergenic
1091568003 12:1662252-1662274 GGCCGCGGCCACAGAGGGCTGGG - Intergenic
1091588708 12:1830417-1830439 GGGGTGGGCCACAGAGGGGAGGG + Intronic
1091715230 12:2772062-2772084 GGCAGGGGACAGAGAAGGGAAGG - Intergenic
1096680445 12:53252188-53252210 AGCCGGAGCCACAGCGGGGAGGG + Intronic
1100643054 12:96501190-96501212 GGCCGGGTTAACAGAGGGTGTGG + Intronic
1102030899 12:109739601-109739623 GGCTGGGATCACAGAAGGAAGGG - Intronic
1103362449 12:120362033-120362055 GGCCCGGGCCCCAGAGGGTAGGG - Intronic
1103506070 12:121442958-121442980 GGCCTGGGGCACAGGAGGGAGGG + Intronic
1103993996 12:124817478-124817500 GGGAGGGGTCTCAGAGTGGACGG - Intronic
1104845605 12:131845276-131845298 GCCTGGGGGCACAGAGGGGAGGG - Exonic
1105071273 12:133235702-133235724 GGCGGGGGTCCCAGAGGGTGAGG - Exonic
1105447821 13:20472868-20472890 GGCTGGGGCCAGGGAGGGGAGGG + Intronic
1105898945 13:24740716-24740738 GCCCAAGGTCACAGAGGCGAGGG - Intergenic
1105920509 13:24958946-24958968 AGCCGGGGGCAGAGTGGGGAGGG + Intergenic
1106249463 13:27972539-27972561 GGCAGGGGCCACAAAGGGGGTGG + Intergenic
1106404245 13:29459964-29459986 GGAGGGTGTGACAGAGGGGATGG - Intronic
1106574738 13:30964007-30964029 GGCCTGGCTCACAGAAGGGTGGG - Intronic
1107634754 13:42380999-42381021 CGCAGGGTGCACAGAGGGGAGGG + Intergenic
1107643569 13:42470441-42470463 GGGTGGGGGCACAGTGGGGATGG + Intergenic
1108502877 13:51084366-51084388 GGCCGGCCACACAGAGGGAAGGG + Intergenic
1111974552 13:94951901-94951923 GGCCAGAGTCAGAGTGGGGAGGG + Intergenic
1112429368 13:99336971-99336993 AGGAGGGGTCACAGAAGGGAGGG - Intronic
1112629041 13:101140251-101140273 GGGCGGGCGCACAGAGGGGCGGG + Intronic
1113657063 13:112073560-112073582 GTCCGGCGTGAGAGAGGGGAGGG + Intergenic
1113707609 13:112444593-112444615 GGCCGAGGGCTCAGAGGGAAGGG - Intergenic
1113984054 13:114299754-114299776 GGCAGGAGTCCCGGAGGGGAAGG - Intronic
1114522166 14:23346680-23346702 GGACGTGGTCACAGCGGGTAGGG + Exonic
1118443366 14:65831260-65831282 AGCCTGGGTCACTGAGGGCAGGG - Intergenic
1118604348 14:67491963-67491985 AGCAAGGGGCACAGAGGGGAAGG - Intronic
1121235239 14:92387139-92387161 GGCAGGGGGTACAGAGGGGGTGG + Intronic
1121330983 14:93049726-93049748 GACCGGGGTCACAGAACAGAAGG + Intronic
1121417134 14:93787544-93787566 GGCCAGGGTCTCAGGAGGGAAGG + Intronic
1121720568 14:96105884-96105906 TGCCCAGGTCTCAGAGGGGAGGG - Intergenic
1122543141 14:102508937-102508959 GGCTGGGGACTCAGAGGGCAGGG - Intronic
1122690851 14:103531598-103531620 GGCTGGGGGCACCCAGGGGAGGG + Intronic
1122865813 14:104603536-104603558 GGGTGGGCTCACAGAGGGGGTGG + Intronic
1122865821 14:104603557-104603579 GGGTGGGCTCACAGAGGGGGTGG + Intronic
1122865829 14:104603578-104603600 GGGTGGGTTCACAGAGGGGGTGG + Intronic
1122961234 14:105094408-105094430 GGCCTGGGGGACAGAGGGGTCGG - Intergenic
1123007402 14:105330442-105330464 AGACGAGGTCACACAGGGGAAGG + Intronic
1123434986 15:20248030-20248052 GGGGAGGGTAACAGAGGGGAGGG + Intergenic
1124493276 15:30171516-30171538 GGCTGGGGTGGCAGAGCGGAGGG - Intergenic
1124750258 15:32366809-32366831 GGCTGGGGTGGCAGAGCGGAGGG + Intergenic
1125600190 15:40911352-40911374 GGCCGGGTTCAAAGAGGGTCTGG - Intergenic
1125697514 15:41651698-41651720 GGAAGGGGTAAGAGAGGGGAAGG - Intronic
1126849816 15:52790110-52790132 AGCCGAGGACGCAGAGGGGAAGG - Intronic
1127349281 15:58134353-58134375 GGCCTGGGTTCCAGAGGGGCTGG + Intronic
1127498641 15:59535722-59535744 GGCAGCTGTCACATAGGGGAAGG + Intergenic
1128158030 15:65404027-65404049 GGCCAAGGTCAGAGAGGGAAGGG + Intronic
1128223196 15:65982902-65982924 GGGTAGGGTCACAGAGGAGAGGG - Intronic
1128578415 15:68791734-68791756 GGGTGAGATCACAGAGGGGAAGG + Intronic
1128783559 15:70378706-70378728 GGCCGGGGGCAGAGAGGGTGAGG + Intergenic
1128892313 15:71342463-71342485 GGTGGGGGTCAGAGAAGGGAGGG - Intronic
1128978703 15:72170897-72170919 GGCCTCAGTCACAGAGCGGAGGG - Intronic
1129144415 15:73633759-73633781 GGACGGGGACAAAGAGAGGAAGG - Intronic
1129362663 15:75034036-75034058 GGTCAGGGTCACAGAAGGGCTGG + Intronic
1129763724 15:78147895-78147917 GGCAGGGGTGACATTGGGGATGG + Intronic
1129909305 15:79212906-79212928 AGCCTGGAGCACAGAGGGGAAGG - Intergenic
1130995198 15:88899574-88899596 GGCCTGGGGCTCTGAGGGGAGGG - Intronic
1131229507 15:90649560-90649582 GGCCGGGGGTGCACAGGGGAGGG - Intergenic
1131277465 15:90994253-90994275 GGCCGGGGGCGCTGAGGGGCAGG - Intronic
1132087224 15:98918288-98918310 GGTCGGGGGCAGTGAGGGGAAGG - Intronic
1132491623 16:234915-234937 GGCCGGGGTCCCAGAGCGAAGGG - Intronic
1132502929 16:292609-292631 GGCTGTGGTCACAGAGGCCATGG - Intronic
1132676058 16:1121725-1121747 GGCCTGGGTCCCCGAGGGGCTGG + Intergenic
1132749690 16:1451862-1451884 GGCCACGGTCACAGAGGGCAAGG + Intronic
1132825731 16:1904271-1904293 GGCCGGGGCTACAGAGGGAATGG + Intergenic
1133771011 16:8867276-8867298 GGCAGGGGTCACAGAGGGAGTGG - Intronic
1134449331 16:14354043-14354065 GGTGGGGGGCAGAGAGGGGAGGG + Intergenic
1135323132 16:21510066-21510088 GGCAGGGGTCAGGTAGGGGAGGG - Intergenic
1136291473 16:29275008-29275030 GCCGAGGGACACAGAGGGGAGGG - Intergenic
1136334615 16:29603252-29603274 GGCAGGGGTCAGGTAGGGGAGGG - Intergenic
1136849633 16:33602954-33602976 GGGGAGGGTAACAGAGGGGAGGG - Intergenic
1136849650 16:33603004-33603026 GGGGAGGGTAACAGAGGGGAGGG - Intergenic
1137036675 16:35574671-35574693 GGTCGGGACCACAGATGGGAAGG - Intergenic
1138370033 16:56519649-56519671 GGGCGGGGTCGGAGAGGGGACGG + Intronic
1138539649 16:57680232-57680254 GGCCAGGGGAACAGAGGGAAAGG - Intronic
1140700318 16:77575303-77575325 GGCCAGGGCCAGAGAGGGGCAGG + Intergenic
1141230528 16:82162979-82163001 GGGCAGGGTCACAGGGAGGAAGG - Intronic
1141438475 16:84014326-84014348 GGCCGGGCTTTCAGAGGTGAGGG - Intronic
1141577931 16:84976672-84976694 GGCTGGGCTCACAGAGGCCACGG - Intronic
1141838104 16:86555863-86555885 GGCTGGGGCCAGAGAGGGAATGG - Intergenic
1141894973 16:86953593-86953615 TGCCGGGGTGCCAAAGGGGAGGG + Intergenic
1141990260 16:87605185-87605207 GGCCGGGCTCACGCAGGGCATGG + Intronic
1142035329 16:87859088-87859110 GGCAGGGGTCAGGTAGGGGAGGG - Intronic
1142090377 16:88206806-88206828 GGCCGTGGGGACGGAGGGGAGGG + Intergenic
1142090389 16:88206831-88206853 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090427 16:88206908-88206930 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090438 16:88206932-88206954 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090450 16:88206957-88206979 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090462 16:88206982-88207004 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090474 16:88207007-88207029 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090499 16:88207058-88207080 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090536 16:88207135-88207157 GGCCGCGGGGACAGAGGGGAGGG + Intergenic
1142090547 16:88207159-88207181 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090559 16:88207184-88207206 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090584 16:88207235-88207257 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090609 16:88207286-88207308 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090621 16:88207311-88207333 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090646 16:88207362-88207384 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090658 16:88207387-88207409 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142176224 16:88646681-88646703 GGCCGGTGGGACAGTGGGGAGGG + Intronic
1142378034 16:89716966-89716988 GCCCAGGGTCAGTGAGGGGATGG - Intronic
1142393087 16:89815748-89815770 GGCCTGGCCCGCAGAGGGGAGGG - Intronic
1142427159 16:90007284-90007306 GGCAGGAGTCACAGTGGGGCTGG + Intronic
1142477906 17:200532-200554 GGACAGGGACACAGTGGGGAGGG + Intergenic
1142836999 17:2594284-2594306 GGCGGGGGTCGCAGAGGCGCCGG - Intronic
1143617744 17:8064016-8064038 GGGAGGGGTGGCAGAGGGGAGGG - Intergenic
1143722002 17:8819006-8819028 GGCTGGGAGCCCAGAGGGGAGGG - Intronic
1143762836 17:9117262-9117284 GGCAGGGGCCACAGACTGGAGGG + Intronic
1143817014 17:9525135-9525157 GGCCCTGCTCACAGAGGGAAAGG - Intronic
1144274855 17:13656461-13656483 GGGTGGGGACACAGAGGGAAGGG + Intergenic
1144654201 17:17025069-17025091 GGCCATGGTCACCGAAGGGAGGG - Intergenic
1145207400 17:20991897-20991919 GGCCAGTGTCACAGGGGTGAAGG + Intergenic
1145259937 17:21348770-21348792 GGCTGGGGCCCCAGAGGGGAAGG - Intergenic
1145316679 17:21739168-21739190 GGCTGGGGCCCCAGATGGGAAGG + Intergenic
1146680800 17:34806506-34806528 GGCATGGGCAACAGAGGGGATGG + Intergenic
1147153846 17:38533449-38533471 GTCAGGGGTCAGAGAGCGGAAGG + Intronic
1147374441 17:40015567-40015589 GGCTGGTGTGACAGAGGGGCTGG + Intronic
1147389785 17:40102061-40102083 GGCTTGGGTCATGGAGGGGATGG + Intergenic
1147448406 17:40488884-40488906 GGGCGGGGTGACAGAGGGGCTGG + Exonic
1147483293 17:40787601-40787623 GGAGAGGGTCACAGAGAGGAAGG + Intergenic
1147661648 17:42120132-42120154 GGAAGGGGGCATAGAGGGGAGGG + Intronic
1147944159 17:44070851-44070873 GGCCTGGGGCTCAGAGGGGTGGG + Exonic
1148233550 17:45952282-45952304 AGCAGGGGTCAGAGATGGGAGGG + Intronic
1148748662 17:49932193-49932215 GGCCAGGGTGTCACAGGGGAGGG - Intergenic
1149004148 17:51787516-51787538 AGCCTGGGTGACAGAGAGGAGGG - Intronic
1149533211 17:57412063-57412085 AGCCTGGGTGACAGAGAGGAAGG - Intronic
1151392605 17:73797744-73797766 GGCCAGGGGCCCAGAGGGGTGGG + Intergenic
1151819796 17:76491302-76491324 GGCAGGGGTCTCAGCTGGGATGG - Intronic
1152625467 17:81386284-81386306 AGCCTGGGACACAGAGGGCATGG - Intergenic
1152629563 17:81404443-81404465 GGCCTGGGCCAGAGTGGGGAGGG + Intronic
1153019150 18:611113-611135 AGCCAGGGCCACAGAGGGAAGGG - Intronic
1154145297 18:11861643-11861665 GGCCGTGGTCACTCAGGAGAGGG + Intronic
1154241424 18:12657451-12657473 GGCCGGGGACGCTGAGGGTAAGG + Intronic
1155639769 18:27999274-27999296 GGCCAAGGTCACAGAGGGTCTGG + Intronic
1156339868 18:36201153-36201175 GGCCTGGGGCATAGACGGGAAGG + Intronic
1156438420 18:37158513-37158535 GGCCATAGTCACAGAGGGGATGG + Intronic
1157110489 18:44816092-44816114 GGCCTGGGAGACAGAGGGGGAGG + Intronic
1160164288 18:76496132-76496154 GGCCGGGGTGGGGGAGGGGAGGG + Intronic
1160378124 18:78429449-78429471 GGCCTGGGTCACAGAGCAGATGG - Intergenic
1160668421 19:344487-344509 GGCCGGGGTGGGGGAGGGGAGGG - Intronic
1160682397 19:417834-417856 GGCCGCGGCCGCATAGGGGAGGG + Intronic
1160710959 19:550761-550783 TGCTGGGGTGACAGTGGGGACGG - Intergenic
1160934065 19:1584916-1584938 GGCGGAGGGCACAGAGCGGAAGG - Intronic
1161257973 19:3320344-3320366 CGCCGGGCACACAGAGGGGGAGG - Intergenic
1161353454 19:3806177-3806199 TGCTGGGGACACAGAGGGGCTGG + Intronic
1161397319 19:4051722-4051744 GGCCGGGGTCACAGAGGGGATGG + Intronic
1161966364 19:7551182-7551204 GGCGGGGCTTACAGAGGGGCGGG + Intronic
1162034804 19:7933041-7933063 GGGTGGGGTCAGGGAGGGGACGG + Intronic
1162315493 19:9936159-9936181 GGCGGGGGTCGCAGCGGGGGAGG - Intronic
1162513218 19:11132253-11132275 TGCCGGGGACAGAGAGGGGCAGG + Intronic
1162529739 19:11229047-11229069 GGCAGGGGTCACAGAGTGCGAGG + Intronic
1162643758 19:12033944-12033966 GGCCAGGGTCACAGGGTGGAGGG + Intronic
1162651689 19:12093326-12093348 GGCTGGGGTCATAGCGGGGAGGG - Intronic
1162720006 19:12656695-12656717 GGCGGGGGTCAGAGAGGGCATGG + Intronic
1162754858 19:12851907-12851929 GGCAGGGGACACAGAGGGACAGG - Intronic
1162777858 19:12990467-12990489 GGGTGGGGGCGCAGAGGGGAAGG - Intergenic
1162845275 19:13387546-13387568 GGCTGAGGTCCCAGTGGGGAAGG - Intronic
1162984763 19:14262588-14262610 GGCCTGGGTCACATAGAAGAGGG - Intergenic
1163358403 19:16829713-16829735 GGCCGGGGTCCCTGAGGGGAAGG - Intronic
1163414154 19:17175639-17175661 TGCCGGAGACACAGAGTGGATGG - Intronic
1163439007 19:17312227-17312249 GGCCGGGCTCACACAGGGCCCGG - Intronic
1163478341 19:17539868-17539890 GGGCGTGGTCAGAGAGGGGCGGG + Intronic
1163492814 19:17626784-17626806 AGCTGGGGACACAGAAGGGAAGG + Exonic
1163496180 19:17647787-17647809 GGGCGGGGACTCAGAGGGGTGGG - Intronic
1164052833 19:21597716-21597738 GTCCCTGATCACAGAGGGGATGG + Intergenic
1164219052 19:23177172-23177194 GGCGGGGGTCACAGGGTGCAGGG - Intergenic
1164507338 19:28870690-28870712 TGCAGGGGTCACAGAAGGGGTGG + Intergenic
1164572203 19:29382654-29382676 GGCCGGGCTCTCACAGGGGCAGG - Intergenic
1164572213 19:29382676-29382698 GCCCCAGGTCACAGAGGGCAAGG - Intergenic
1166109642 19:40614204-40614226 GGCCGGGGAAGCAGAGGAGAGGG - Intronic
1166298733 19:41902490-41902512 GGCAGGTGTCTCAGTGGGGATGG - Intronic
1166338375 19:42122466-42122488 GGCAGGGGTCACCGTGGGCAGGG - Intronic
1166685634 19:44794406-44794428 GGAAGAGGTCACAGAGGGGATGG - Intronic
1166811143 19:45515322-45515344 GCCCAAGGTCACACAGGGGAAGG - Intronic
1166856520 19:45785078-45785100 GTCCAGGGTCACAGAGGGAGTGG + Intronic
1167152180 19:47716662-47716684 GGCCGAGGTCACCGTGCGGATGG - Exonic
1167244459 19:48365144-48365166 GCCAGGGGTCACAGAGGTGGAGG - Intronic
1167533066 19:50031021-50031043 AGCCGGGAACACGGAGGGGAAGG + Exonic
1167565320 19:50252433-50252455 GGCAGGGGGCATAGAGGGGAAGG + Intronic
1168345894 19:55650058-55650080 CCCTGGTGTCACAGAGGGGAGGG - Intronic
1168685446 19:58346913-58346935 GGCCGGGGTCTCTGGGGGGCTGG - Exonic
925405488 2:3603235-3603257 GGCCCGGGAAACAGAGGGAAAGG - Intronic
926121099 2:10241496-10241518 GGCAGGGCTCACAGAGGGGCTGG + Intergenic
926195460 2:10761191-10761213 GCCTGGGGTGTCAGAGGGGACGG + Intronic
926635084 2:15170116-15170138 TGTCGGGCTCCCAGAGGGGAGGG - Intronic
927783423 2:25956443-25956465 GCCTGGGGACACAGAGGGGTTGG + Exonic
927904599 2:26847890-26847912 GGCCGGGGTCCGAGAGCGGACGG - Intronic
928549524 2:32357308-32357330 GGCCGGGGTCTCAGAGTGGCTGG + Exonic
930258698 2:49120185-49120207 CGCCGGGGCCAGAGAGGCGAAGG + Intronic
931517641 2:63059262-63059284 AGGCAGGGTCACTGAGGGGAGGG - Intergenic
932556056 2:72825765-72825787 TGCCGGGACCACAGAGGGGCGGG - Intronic
933713654 2:85345041-85345063 GGTCAGGGTCACAGAGAGAAAGG + Intronic
934577888 2:95414509-95414531 GGATGGGGGCACACAGGGGACGG - Exonic
934601551 2:95662193-95662215 GGATGGGGGCACACAGGGGACGG + Intergenic
934865248 2:97803740-97803762 TGCTGGGGACACAGAGAGGAGGG + Intronic
935765083 2:106359052-106359074 GGCCAGGGGAACAGATGGGATGG - Intergenic
935802034 2:106707453-106707475 GGACCAAGTCACAGAGGGGAGGG - Intergenic
936534910 2:113304359-113304381 GGATGGGGGCACACAGGGGATGG + Intergenic
937045773 2:118850707-118850729 GGCCGGGGTGGCAGAGAGGTGGG + Intergenic
937518929 2:122687129-122687151 TGCCAGGGTCAGAGTGGGGAGGG + Intergenic
937933020 2:127220100-127220122 GGCCGGGGTCGCCGCCGGGAGGG - Intergenic
938317510 2:130340286-130340308 GGGCGGGGACACAGAGCAGAGGG - Intronic
941625744 2:167828437-167828459 GGCAGAGGTCATAGAGTGGATGG + Intergenic
942596403 2:177595273-177595295 GGAGGGAGGCACAGAGGGGAGGG + Intergenic
943704476 2:191020600-191020622 GGACGGGGTCCCAGAGAGGCCGG + Intronic
944351853 2:198737376-198737398 GGCTGGGGGCACTGAGGGAAGGG + Intergenic
947838094 2:233189506-233189528 GGCCAGGGTCATAGAGGAGAAGG - Intronic
948889557 2:240900331-240900353 GGGCGGTGTGAGAGAGGGGAAGG + Intergenic
948939773 2:241190010-241190032 GATGGGGGTCAGAGAGGGGATGG - Intronic
948948352 2:241233263-241233285 GGCAGGGCCCAGAGAGGGGATGG + Intronic
949046076 2:241873294-241873316 AGGCGGGGTCCCAGAGGCGAGGG - Exonic
1168857015 20:1015672-1015694 GGCCAGGCTTCCAGAGGGGATGG - Intergenic
1168961203 20:1871263-1871285 GGCCGGGGTCAGCCAGGGCAGGG + Intergenic
1170765083 20:19282998-19283020 GGCAGGGGCCACACAGGGAAAGG + Intronic
1172169594 20:32920973-32920995 GTCCAGGGTCAGAAAGGGGAAGG - Intronic
1172275095 20:33674893-33674915 GGCCAGAGTCACGGAGGGGAGGG - Intergenic
1173551235 20:43934439-43934461 GGCCGGGGTCACAGTGGGATTGG + Intronic
1173595616 20:44257123-44257145 CGCCAGGGTCAGAGCGGGGAAGG - Intronic
1173786991 20:45801286-45801308 GGCCTGGGTCAGAGCGGGGCTGG + Intronic
1173997073 20:47346508-47346530 GGCAGGGGTCACAGAAGGGGAGG - Intronic
1174053853 20:47785247-47785269 GGCCGGGCTCACGCCGGGGAAGG + Intronic
1174064514 20:47854822-47854844 AGCCGGGGGCACAGTGGGAAGGG + Intergenic
1175371524 20:58495963-58495985 GGCCTGAGTTACAGAGGGGGCGG + Intronic
1175387841 20:58608611-58608633 GCCCGGGGTCACTGTCGGGATGG + Intergenic
1175543343 20:59762048-59762070 GGGCGGTGTCAGAGAGGAGAGGG + Intronic
1175922170 20:62455397-62455419 GGCCAGGGTCACCGAAGGGACGG + Intergenic
1175981488 20:62741011-62741033 GGCCAGGCTCAGCGAGGGGAGGG + Intronic
1176242383 20:64081073-64081095 GGCCTGGGTGAGAGGGGGGAGGG + Intronic
1176363737 21:6020004-6020026 GGCAGGGGTCCCCGAGGAGAAGG - Intergenic
1178678748 21:34653790-34653812 GACAGAGGTCAGAGAGGGGAGGG + Intergenic
1179149108 21:38795232-38795254 GGACCAGGTCACAGAGGGCATGG + Intergenic
1179732742 21:43376550-43376572 GGACTGGGTGACAGAGCGGAGGG - Intergenic
1179759781 21:43518541-43518563 GGCAGGGGTCCCCGAGGAGAAGG + Intergenic
1180027933 21:45179075-45179097 GGCCAGGGTGCCAGAGGGAAAGG - Intronic
1180027943 21:45179114-45179136 GGCCAGGGTGCCAGAGGGAAGGG - Intronic
1180182671 21:46124875-46124897 GGCCGGGCTCACCCTGGGGAAGG - Exonic
1180189208 21:46154655-46154677 GGCGCAGGTCACAGAGGGGCCGG + Intronic
1180958851 22:19753671-19753693 TGCTGGGGCCACAGAAGGGAAGG + Intergenic
1181085169 22:20436493-20436515 GGCGGGGCTCGCAGCGGGGAGGG + Intronic
1181169474 22:21000187-21000209 GGCCGTGGTTCGAGAGGGGAGGG + Exonic
1181350383 22:22250862-22250884 TGACGGGGTCACAGTGGAGAGGG + Intergenic
1181442685 22:22944856-22944878 GCTCTGGGGCACAGAGGGGAGGG - Intergenic
1181696465 22:24595160-24595182 GGCCAGGGACACAGAGGGTGGGG - Intronic
1182059730 22:27388365-27388387 GGAGGGGGTCACAAAGGGGCTGG + Intergenic
1183063736 22:35350100-35350122 GGCCGGGGGCATGGAGGGGAGGG + Intergenic
1183102464 22:35592427-35592449 GGCCAGGGTCACAGAGCAGTTGG - Intergenic
1183409517 22:37646776-37646798 GGCAAGGGTCACAGAGGGGTGGG - Intronic
1183479033 22:38052819-38052841 GGCAAGGGCCTCAGAGGGGAGGG - Intergenic
1183622497 22:38982578-38982600 GGCAGGGGAGCCAGAGGGGAGGG - Intronic
1183632378 22:39041087-39041109 GGCAGGGGAGCCAGAGGGGAGGG - Intronic
1184146511 22:42614632-42614654 GGTCGGGGCCACGGCGGGGACGG + Intronic
1184412067 22:44331415-44331437 GGCCGGGGTCCGAGAGCGGCGGG - Intergenic
1184753649 22:46503457-46503479 TCCCGTGGTCACAGTGGGGACGG - Intronic
1184889104 22:47368679-47368701 GGCAGGGGTCTCAAAGGGCATGG - Intergenic
950479689 3:13236719-13236741 GGGCTGGGACACAGAGGGAAGGG + Intergenic
952188860 3:31000811-31000833 GGCCTGGGCCAGAGAGGAGATGG - Intergenic
953982869 3:47421367-47421389 GGGCGGGGGCTCAGTGGGGAAGG - Intronic
954247011 3:49340021-49340043 GGCCGGGGCCGCGGAGGAGATGG - Exonic
954430797 3:50470021-50470043 GGCCATGGGCACAGAGGGGCAGG - Intronic
954619913 3:51989613-51989635 AGCAGGGGCCACAGAGGGGCAGG + Intergenic
954681274 3:52347319-52347341 GGCTGGAGTCAGGGAGGGGAGGG + Intronic
954708350 3:52493119-52493141 GGGCGTGGTCACATGGGGGAGGG + Intergenic
955031915 3:55230282-55230304 CTCTGGGGTCAAAGAGGGGAAGG + Intergenic
955215675 3:56983359-56983381 GGCAGGGGTCACAGTGGGGAGGG - Intronic
956177102 3:66483438-66483460 GGCTGGGTCCACAGAGGGCAGGG + Intronic
961384926 3:126517932-126517954 GGCAGGCTTCACAGTGGGGAGGG + Intergenic
961472063 3:127121576-127121598 GGCCCTGGCCTCAGAGGGGATGG + Intergenic
961673255 3:128549697-128549719 GGCCGTGGACAAAGAGGGGAGGG + Intergenic
961746969 3:129070189-129070211 GGCAGAGCTCACAGCGGGGAGGG - Intergenic
963299609 3:143584111-143584133 AGCCAGAGCCACAGAGGGGAGGG - Intronic
964430245 3:156598152-156598174 GCCCAAGGTCACAGAGGTGATGG + Intergenic
964643680 3:158935825-158935847 GACCTAGGTCACAGAGGTGAAGG + Intergenic
966948580 3:184795707-184795729 AGACGCGGTCACAGAGGGCAGGG - Intergenic
967895908 3:194396380-194396402 GGCGGGGGACACAGAGAGGAGGG + Exonic
968512901 4:1003193-1003215 GGCCGGGGTCCCGGGGGGGTGGG + Intronic
968606343 4:1537503-1537525 GGCCAGGGTCACAGCAGGGTGGG + Intergenic
968647953 4:1749334-1749356 GGGAGGGGGCACAGTGGGGAGGG - Intergenic
968648532 4:1751443-1751465 GGCCCGGGACAGAGAGGGCATGG - Intergenic
968681973 4:1927331-1927353 GGCAGGGCTCACAGAGGGGTTGG + Intronic
968711973 4:2125977-2125999 GGACAGGGTCACAGAGGGTAAGG + Intronic
968864173 4:3197224-3197246 AGCCAAGGTCACAAAGGGGATGG - Intronic
968909011 4:3467188-3467210 GGCCGGGGACGCAGTGGGGGGGG - Intronic
968944164 4:3654878-3654900 TGGTGGGGTCACAGAGAGGAAGG - Intergenic
969115024 4:4866000-4866022 GGCCGGGGTCCCAGGGAGGCCGG - Intergenic
969428618 4:7140026-7140048 GGAAGGGGACACCGAGGGGAAGG + Intergenic
969602804 4:8187024-8187046 GGCAGGTGTCAGAGAGGGCAAGG - Intronic
969622379 4:8285115-8285137 GTCCAGTCTCACAGAGGGGAAGG - Intronic
970109134 4:12617896-12617918 GGCCATGGTGACAGAGAGGAAGG + Intergenic
971062428 4:22987590-22987612 GGCAGGGGAGACAGAGAGGAAGG - Intergenic
976215428 4:82711272-82711294 GTAGGGGGTCACAGTGGGGAGGG - Intronic
984155512 4:176191472-176191494 GTCCGAGGACACAAAGGGGAAGG + Intronic
984844927 4:184100882-184100904 GGTCGGGGCCACAGAGGTGGAGG + Intronic
985588943 5:754976-754998 GGTGAGGGGCACAGAGGGGATGG - Exonic
985603623 5:847492-847514 GGTGAGGGGCACAGAGGGGATGG - Exonic
985746570 5:1651786-1651808 GGGGGGGGCCACAGAGGGCAGGG + Intergenic
985776850 5:1848819-1848841 GGAGGGGGTCACAGATGGAAAGG - Intergenic
985952136 5:3230332-3230354 GGCCAGGGAGACAGAGGGGCAGG - Intergenic
986430238 5:7674046-7674068 GGCAGGGGCCTCAGAGGGTAGGG + Intronic
988595357 5:32585758-32585780 GGCCGGGGACGCCGAGGGGAAGG - Intronic
989335094 5:40306657-40306679 TGCCGTGGTTACAGAGGGCATGG - Intergenic
990527439 5:56641836-56641858 GGGCGGGGTCACGGAGTAGATGG - Intergenic
992533848 5:77678486-77678508 GCCAGGGGTTGCAGAGGGGATGG + Intergenic
992739256 5:79756536-79756558 GGCTGAGATAACAGAGGGGATGG + Intronic
993034914 5:82746180-82746202 GGTAGGGGTAAGAGAGGGGAAGG + Intergenic
993504386 5:88692711-88692733 GGCTCGGGTCACAGGAGGGAGGG + Intergenic
994671105 5:102762810-102762832 GGCAGGGGCCACAGAGGAAATGG - Intronic
997473070 5:134127516-134127538 GCCCGGGATCACACAGAGGAGGG - Intronic
997509918 5:134447009-134447031 CCCTGGGGACACAGAGGGGAGGG + Intergenic
998446090 5:142199557-142199579 GGCCGGAGTCAGATAGAGGAAGG + Intergenic
999141998 5:149368441-149368463 GGCGGGAGCCATAGAGGGGATGG - Exonic
1000295814 5:159912498-159912520 GGCAGAGGTCAGGGAGGGGAGGG - Intergenic
1000582760 5:163054198-163054220 GGCCTGGGACAAAGAGGGGATGG + Intergenic
1001951484 5:175819786-175819808 GGCCAGGCTCAGAGAGGTGAAGG + Intronic
1002082596 5:176746301-176746323 GACAGCGGTCACAGAGGGAAGGG + Intergenic
1003545059 6:7052029-7052051 GGCCGGGGCCGCAGGGGCGAGGG - Intergenic
1003551757 6:7107485-7107507 GGCCGGGCTGCCCGAGGGGAAGG - Intergenic
1004916026 6:20332830-20332852 AGCTGGGATCACAGTGGGGAGGG - Intergenic
1005196216 6:23287260-23287282 AGCTTGGGTCACAAAGGGGAGGG - Intergenic
1006814197 6:36839638-36839660 GAGCGGGGGCACAGCGGGGAAGG + Exonic
1006914409 6:37585225-37585247 GGCCAGGATCCCAGAGAGGAAGG - Intergenic
1006987960 6:38189299-38189321 GGACGGGGTCACATCAGGGAAGG - Intronic
1007380911 6:41489592-41489614 TGCTGGGGTGACAGAGGAGATGG - Intergenic
1007397014 6:41583656-41583678 GCATGGGGTCACAGAGTGGAGGG + Intronic
1008641094 6:53463443-53463465 GTCTGGGATTACAGAGGGGAGGG + Intergenic
1010179294 6:73066288-73066310 GGGTGGAGTCACAGAGGGGCGGG - Intronic
1012137483 6:95577457-95577479 GGGCGGGGTCACGGAGCGGGCGG - Intergenic
1013412996 6:109898168-109898190 GGCAGAGGACATAGAGGGGAGGG + Intergenic
1013565424 6:111354920-111354942 GGCAAGGGGCACGGAGGGGAAGG + Intronic
1014323288 6:119958925-119958947 GGCTGGGGAAAGAGAGGGGATGG + Intergenic
1017769191 6:157631935-157631957 GGCCGTGGGCACAGAGGGAAAGG + Intronic
1017989968 6:159478092-159478114 GGCCAGGGTCCCAGAGAGAAGGG + Intergenic
1018764889 6:166925441-166925463 GGCCTGGGTGGCAGAGGTGAGGG - Intronic
1018855067 6:167669220-167669242 GGCAGGGGCCACAGAGAGCAGGG + Intergenic
1019452476 7:1106924-1106946 GGCCGTGGTCACGGTGGGCAGGG - Intronic
1019547023 7:1583110-1583132 GCCGGGGGTCACAGGGGGGATGG - Intergenic
1019558347 7:1643574-1643596 GGCTGGGGACTCAGAGGGAATGG + Intergenic
1019810106 7:3158916-3158938 AGCCAGGATCACAGAGGGGAAGG + Intronic
1020118167 7:5487874-5487896 GGGTGGGGTCACAGAGGGACTGG + Intronic
1020690844 7:11353018-11353040 GGCTGAAGTCACAGAGGTGAGGG + Intergenic
1022729268 7:33007340-33007362 GAATGGGGGCACAGAGGGGATGG - Intergenic
1023830109 7:44034313-44034335 TGCAGGGGACACAGAGGGGGAGG + Intergenic
1024230475 7:47359939-47359961 GGCTAGGGCCACAGAGGAGAAGG - Intronic
1024283737 7:47739473-47739495 GACCTGGGCCACAGTGGGGACGG + Intronic
1024863148 7:53869864-53869886 GCCCAGGGTCAGAGATGGGATGG + Intergenic
1024889833 7:54187042-54187064 GGCCGGGGTTTCAGATGGAAGGG + Intergenic
1025044387 7:55680640-55680662 GAATGGGGGCACAGAGGGGATGG + Intergenic
1026942537 7:74295590-74295612 GCCAGGGGCCACAGAGGAGAGGG + Intronic
1029273993 7:99393444-99393466 GGGCGGGGTCACAGCTGGGGCGG + Intronic
1029708043 7:102285910-102285932 GGAAGGGGTCTGAGAGGGGAGGG - Intronic
1030619757 7:111775929-111775951 GGGGAGGATCACAGAGGGGAGGG + Intronic
1031144441 7:117981902-117981924 GGCAGGGTTCACAGTGGCGATGG - Intergenic
1032437326 7:131910850-131910872 GGCCGGGGCTAAGGAGGGGAAGG - Intergenic
1032805251 7:135347864-135347886 GGTGGGGGTGGCAGAGGGGATGG - Intergenic
1034263815 7:149772282-149772304 GGCGGGGGCCTCGGAGGGGAAGG - Intronic
1035314603 7:157990311-157990333 GACCTGGAGCACAGAGGGGAGGG + Intronic
1035580033 8:733852-733874 GGACGGGGTCACAGAGTCCATGG - Intronic
1035640792 8:1183586-1183608 GCCCGGGGCCACAGAGGCGGAGG + Intergenic
1035676528 8:1460495-1460517 GGCAGCCGTGACAGAGGGGAAGG - Intergenic
1036617551 8:10400261-10400283 GGCCTGGGTTACAGTGGAGAGGG + Intronic
1036749800 8:11436462-11436484 GGCCGAGCTCACAGAGGTGAGGG - Intronic
1036766944 8:11555362-11555384 GGCCGGGCGCACACAGGGCAGGG - Exonic
1037771683 8:21804802-21804824 GGCCGGGGTGAAAGAGGGTCGGG - Intronic
1038046818 8:23772499-23772521 GGCCAAGGTCAAAGAGGAGAGGG + Intergenic
1041636778 8:60153689-60153711 GGCCAGAGTACCAGAGGGGAGGG - Intergenic
1043515395 8:80990599-80990621 GGCCTGGGTCAGAGAGGACAAGG + Intronic
1044932154 8:97260755-97260777 GGCTGTGGTGACAGAGGAGATGG - Intergenic
1044994663 8:97827862-97827884 GGAAGGGGTCACAGGCGGGAAGG + Intronic
1045553429 8:103192951-103192973 GGCTGGGGGTGCAGAGGGGAGGG - Intronic
1048329215 8:133460892-133460914 GGGTGGGGACAAAGAGGGGACGG + Intronic
1048381637 8:133870588-133870610 GGCCGAGGTGACAGGGGTGATGG - Intergenic
1048799211 8:138180882-138180904 GGCAGGGGTCAAACAGGGAATGG + Intronic
1049082948 8:140457283-140457305 GCTCGGAGGCACAGAGGGGAAGG + Intronic
1049320327 8:141992739-141992761 GGATGGGGACTCAGAGGGGAAGG + Intergenic
1049372683 8:142275212-142275234 GGCCGTGGCCACAGAGTGGAGGG - Intronic
1049574200 8:143382939-143382961 GCCCGGGGGTACAGATGGGATGG - Exonic
1049641208 8:143716779-143716801 CGCCCGGGTCACTGAGAGGAAGG + Intronic
1052018491 9:23498142-23498164 AGCCAGGGTCACACAGGGGGTGG + Intergenic
1053090072 9:35267147-35267169 AGCAGGAGTCAAAGAGGGGATGG + Intronic
1053141332 9:35684684-35684706 GGATGGGGTCCCACAGGGGAGGG - Intronic
1053399029 9:37801137-37801159 GGCCGCCGGCACGGAGGGGAGGG - Exonic
1053884112 9:42627875-42627897 AGTCTCGGTCACAGAGGGGAGGG - Intergenic
1053888556 9:42666419-42666441 AGTCTCGGTCACAGAGGGGAGGG + Intergenic
1054223132 9:62435321-62435343 AGTCTCGGTCACAGAGGGGAGGG - Intergenic
1054227578 9:62473866-62473888 AGTCTCGGTCACAGAGGGGAGGG + Intergenic
1057198247 9:93126965-93126987 GGCCGGGGGCACAGACCGGTAGG - Intronic
1057204065 9:93160184-93160206 GACCAGGGGCCCAGAGGGGAGGG + Intergenic
1057544827 9:96010534-96010556 GACCTGGTTCACAGAGGGGCAGG - Intronic
1058538592 9:105989275-105989297 GGCCTGGGGCACAGAGGCCAGGG - Intergenic
1059235263 9:112755402-112755424 GGCTGGGGGCAGAGAAGGGAGGG + Intronic
1059423208 9:114205590-114205612 GACCGGTTTCACAGAGGGGTGGG + Intronic
1060263130 9:122093040-122093062 GGCCGAGGCCACAGCGGAGACGG - Exonic
1060281107 9:122216315-122216337 GGACAGGGTCACAGATGGGATGG - Intronic
1060285941 9:122252630-122252652 GGCCGGTTTCACAAAGGGCAGGG + Intronic
1060513522 9:124251170-124251192 GCCCGGGGTCACACAGGGAGTGG - Intergenic
1060513853 9:124253631-124253653 GCCCGGGGTCACACAGGGAGTGG + Intergenic
1060524946 9:124315220-124315242 GGCAGGCCTCACAGAGGGCAGGG + Intronic
1060946192 9:127570409-127570431 GTCCAGGGTCACAGAGGGGAGGG - Intronic
1061398127 9:130354513-130354535 TGCCGGGGTAGCAGCGGGGATGG + Intronic
1061450897 9:130666526-130666548 AGCCGGGGTCCCGGCGGGGAAGG + Intronic
1061587902 9:131580176-131580198 AGCCCGGGACACCGAGGGGAGGG - Intronic
1061628357 9:131855797-131855819 GGCTGGGGGCACAGATGAGAAGG + Intergenic
1061878789 9:133558096-133558118 GGCGGGGGGCTAAGAGGGGAGGG - Intronic
1062035140 9:134379633-134379655 GGGTGGGGTCAGAGAGGGGCTGG - Intronic
1062066999 9:134533949-134533971 GGGCGGGGTGACAGGAGGGAAGG + Intergenic
1062554540 9:137107990-137108012 GGCCTGGTCCACAGTGGGGATGG - Intronic
1062599738 9:137314505-137314527 GGCGGGGGTCACTGAGCGGGTGG - Intronic
1062696110 9:137877372-137877394 GGCCGGGGACCCGGCGGGGACGG + Intergenic
1062718739 9:138023826-138023848 GGGCGGGGTCAGGGAGGGAAGGG + Intronic
1185534060 X:845870-845892 TGACGGGGTCACAGTGGAGAGGG - Intergenic
1185687160 X:1938817-1938839 GGGTGGGGACACAGAGAGGAAGG - Intergenic
1185891410 X:3825434-3825456 GGTCGGGGCCACAGAGGGCACGG + Intronic
1185896517 X:3863848-3863870 GGTCGGGGCCACAGAGGGCACGG + Intergenic
1185901635 X:3902274-3902296 GGTCGGGGCCACAGAGGGCACGG + Intergenic
1186393627 X:9185846-9185868 GGGCAGGGGCACAGAGGAGAAGG - Intergenic
1187121150 X:16407645-16407667 GGCAGAGGTCACAGGGTGGAGGG - Intergenic
1187899551 X:24014747-24014769 GGCCAGGATCACAGAGTGGGAGG - Intronic
1189332287 X:40151587-40151609 GGCCAGGGTCAGCGGGGGGACGG + Intronic
1190301040 X:49057765-49057787 GCCCTGGGTCACAGAGCAGATGG + Intronic
1192252859 X:69427786-69427808 GGGCGAGGTCACAGAGGAAATGG + Intergenic
1192491045 X:71577940-71577962 GGACGGGAACACCGAGGGGAGGG - Intergenic
1192781019 X:74293730-74293752 GGCCAGTGTGACCGAGGGGAGGG - Intergenic
1194062099 X:89216391-89216413 GGCTGGGGGAAGAGAGGGGAAGG - Intergenic
1195305093 X:103574183-103574205 GGCCAGGATCAAAGAGGAGATGG - Intergenic
1198215242 X:134549515-134549537 AGCCGGGGTCGCAGCGTGGAGGG + Intergenic
1198566630 X:137911998-137912020 GGCAGAGGTAACAGAGAGGAGGG - Intergenic
1200716023 Y:6545684-6545706 GGCTGGGGGAAGAGAGGGGAAGG - Intergenic
1200953170 Y:8920029-8920051 GGAAGGGATCAAAGAGGGGATGG - Intergenic