ID: 1161397374

View in Genome Browser
Species Human (GRCh38)
Location 19:4051950-4051972
Sequence AACGCCCTGCTGTGACTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 80}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397370_1161397374 -4 Left 1161397370 19:4051931-4051953 CCACAGGCCCCACTTACTCAACG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 80
1161397367_1161397374 4 Left 1161397367 19:4051923-4051945 CCCGGCCACCACAGGCCCCACTT 0: 1
1: 0
2: 0
3: 29
4: 453
Right 1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 80
1161397366_1161397374 5 Left 1161397366 19:4051922-4051944 CCCCGGCCACCACAGGCCCCACT 0: 1
1: 0
2: 2
3: 73
4: 630
Right 1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 80
1161397364_1161397374 20 Left 1161397364 19:4051907-4051929 CCTGGGTAATTATAGCCCCGGCC 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 80
1161397361_1161397374 25 Left 1161397361 19:4051902-4051924 CCCAGCCTGGGTAATTATAGCCC 0: 1
1: 0
2: 2
3: 4
4: 72
Right 1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 80
1161397369_1161397374 -1 Left 1161397369 19:4051928-4051950 CCACCACAGGCCCCACTTACTCA 0: 1
1: 0
2: 9
3: 45
4: 281
Right 1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 80
1161397362_1161397374 24 Left 1161397362 19:4051903-4051925 CCAGCCTGGGTAATTATAGCCCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 80
1161397360_1161397374 26 Left 1161397360 19:4051901-4051923 CCCCAGCCTGGGTAATTATAGCC 0: 1
1: 0
2: 2
3: 4
4: 197
Right 1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 80
1161397368_1161397374 3 Left 1161397368 19:4051924-4051946 CCGGCCACCACAGGCCCCACTTA 0: 1
1: 0
2: 1
3: 24
4: 314
Right 1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397374 Original CRISPR AACGCCCTGCTGTGACTCAG AGG Intronic
902733027 1:18382442-18382464 AAAGCCCTGCTCTGTCTCATGGG + Intergenic
903670958 1:25034980-25035002 CACGGCCTCCAGTGACTCAGTGG - Intergenic
904566678 1:31432235-31432257 CACCCCTTGCTGTGAGTCAGTGG - Intronic
915334822 1:155135117-155135139 AAAGCCCTGCGGTGACGGAGTGG - Intergenic
917567945 1:176231493-176231515 ATTGCCCTGCAGGGACTCAGTGG + Intergenic
921797976 1:219370012-219370034 AATGGCCAGCTGTGACTCTGTGG + Intergenic
923016313 1:230129018-230129040 CACACCCTGCTTTTACTCAGTGG + Intronic
1063462125 10:6221624-6221646 GACGCCCTGCGGGGACCCAGTGG - Exonic
1066573643 10:36801830-36801852 AATGCCAGGCTGTGACTCAGAGG - Intergenic
1069752985 10:70756705-70756727 AACAACCTGCTGTGACTCCACGG - Intronic
1070888822 10:79927195-79927217 GAGGCTCTGCTGTGACACAGAGG - Intergenic
1071983781 10:91030520-91030542 AACCCAGTGCTGTGATTCAGTGG - Intergenic
1075974898 10:126686491-126686513 GAGGACCTGGTGTGACTCAGTGG + Intergenic
1076802791 10:132839154-132839176 AACGCCCTGCCGAGAGTCAAGGG - Intronic
1086987921 11:93270220-93270242 AAAGCCCTGCTGGGACACAGGGG - Intergenic
1088528056 11:110777976-110777998 AAGTCCCTGCAGTGACTCAGAGG + Intergenic
1091259931 11:134225579-134225601 AGCGCCCTGCTGTGCCTCGTGGG + Intronic
1091991972 12:4962726-4962748 AAAGCCCTGGTGTGACTCACAGG - Intergenic
1100571263 12:95845227-95845249 TATGCCCTGCTGAGAATCAGGGG - Intergenic
1102982496 12:117253260-117253282 GACACCCTGCTATGACCCAGTGG - Intronic
1102982698 12:117254706-117254728 GACACCCTGCTATGACCCAGTGG - Intronic
1105007446 12:132730030-132730052 AGGGTCCTGCTGTGATTCAGAGG + Exonic
1116091862 14:40318315-40318337 AAAGCTCTGCTGAGATTCAGTGG - Intergenic
1117439284 14:55745043-55745065 ACCCACCAGCTGTGACTCAGAGG + Intergenic
1118095537 14:62533049-62533071 CAAGCCCTTCTGTGTCTCAGTGG - Intergenic
1118709724 14:68509341-68509363 AGGACCATGCTGTGACTCAGAGG + Intronic
1119948996 14:78725210-78725232 AACCTCCTGCTGTGGCTCACTGG + Intronic
1132939326 16:2499147-2499169 CCTGCCCTGGTGTGACTCAGGGG - Intronic
1140541325 16:75758827-75758849 AACACCAAGCTGTGACTCATGGG - Intronic
1153259482 18:3209443-3209465 AGCGACATGCTCTGACTCAGTGG - Intronic
1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG + Intronic
1165330437 19:35138835-35138857 AACGTCCTGCTGTGCCCCGGGGG - Intronic
1167322292 19:48804680-48804702 AACGCACTGCTGTGATCCCGCGG - Intronic
926742423 2:16123770-16123792 AAGGCCCTGCTGTGACCAAGAGG + Intergenic
928213963 2:29345755-29345777 AACACCCTTGTGTGACACAGGGG - Intronic
938236550 2:129710743-129710765 AACGCCCTCCTGTGAGTGATGGG - Intergenic
942228275 2:173835844-173835866 GAGGCCCTGCTGTCACTAAGTGG - Intergenic
946130897 2:217605936-217605958 AATGTCCTGCTGTGAGTTAGTGG - Intronic
948276559 2:236713461-236713483 AGCCCCCTGCTGTGTCTCTGAGG - Intergenic
948310551 2:236982477-236982499 GACACTCTGCTGTGAATCAGAGG - Intergenic
1170102572 20:12718672-12718694 AACTCCTTGCTCTGGCTCAGTGG + Intergenic
1172039006 20:32030892-32030914 AAATCCCTGCTGTCACTCACTGG - Intronic
1173657682 20:44711678-44711700 AAATCCATGCTCTGACTCAGAGG + Intergenic
1173825886 20:46047408-46047430 ACAGCCCTGCTGGGGCTCAGAGG + Intronic
1175494609 20:59404887-59404909 ATCTCCCAGCTGTGACTGAGAGG - Intergenic
1178615786 21:34131770-34131792 AAAGCCCAGCAGTGAGTCAGGGG + Intronic
1185384711 22:50526452-50526474 GGCGCCCTGCTCTGGCTCAGCGG - Exonic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
950422101 3:12905292-12905314 TACGCCCTGCCCTGACTCTGAGG - Intronic
954751255 3:52815141-52815163 AAGACCCTGCTGTTACTCAGAGG + Intronic
957776361 3:84760535-84760557 AAGCCCCAGCTGTGTCTCAGTGG - Intergenic
963063470 3:141243270-141243292 AGCGCCATGATGTAACTCAGAGG + Intronic
963429844 3:145186027-145186049 AGAGCCCTGATGTGACTCAAAGG - Intergenic
963752988 3:149202231-149202253 TTCCCCCTGCAGTGACTCAGCGG - Exonic
967110676 3:186290793-186290815 AACTCTCTGCTGTTACTCAAAGG - Intronic
970480110 4:16464008-16464030 AAGGCCCGCCTGTGACTGAGGGG + Intergenic
970491556 4:16580362-16580384 AGCCCCCTGCTGAGACTGAGAGG + Intronic
975715033 4:77197376-77197398 ACCGCTCTGCTCTCACTCAGGGG - Intronic
985492942 5:189781-189803 AACACCCTGCTGTCACTGCGGGG - Exonic
986107375 5:4672675-4672697 AACGCCCCGGTGTGACTGTGGGG - Intergenic
992497549 5:77308669-77308691 AACTCCATGCTGTGACACAGTGG + Intronic
992838431 5:80663282-80663304 AACAACCTGCTGTGACTCTATGG - Intronic
996394654 5:123001248-123001270 ATAGCCATGCTGTGGCTCAGTGG + Intronic
999125307 5:149241921-149241943 CTGGCTCTGCTGTGACTCAGAGG - Intronic
999759151 5:154687011-154687033 AGCACCATGCTGTGACTGAGGGG - Intergenic
1000283965 5:159810452-159810474 AATGCCCTGCTATAAATCAGGGG + Intergenic
1001275702 5:170349638-170349660 AACGCACATCTGTGACCCAGAGG + Intergenic
1002290382 5:178196403-178196425 CACGCCCTGCTGAGTCTCAGAGG - Intergenic
1007174512 6:39886906-39886928 ATCTGCCTGCTGGGACTCAGAGG + Intronic
1013470119 6:110456639-110456661 AAAGCACTGCGGTGACCCAGTGG - Exonic
1015187229 6:130431618-130431640 AACACCCTGCTGAGACCCTGTGG - Intronic
1017051786 6:150400125-150400147 GAAGCCCTCCTGTGGCTCAGGGG + Exonic
1017864459 6:158431179-158431201 AACGCACTTCTGAGACTCGGGGG - Intronic
1017966449 6:159271054-159271076 AAAGCCCAGCTGTAACTCAGGGG - Intronic
1020240791 7:6393426-6393448 GCCACCCTGCTGTGACTCAGGGG + Intronic
1021307105 7:19045633-19045655 AACTCCCTGCTTAGCCTCAGAGG - Intronic
1023845239 7:44116681-44116703 AGCGCCCTGCAGTGACTCTGGGG - Intronic
1024104710 7:46071310-46071332 AAAGCCCAGCAGTGACTCAGGGG - Intergenic
1024610775 7:51062396-51062418 GAAGTCATGCTGTGACTCAGGGG - Intronic
1031982351 7:128135996-128136018 AAGGGCCTGCTGTGCTTCAGAGG - Intergenic
1031982463 7:128136515-128136537 AAGGGCCTGCTGTGCTTCAGAGG - Intergenic
1032325214 7:130921725-130921747 AGCGCCCTGCTCTGTCGCAGGGG + Intergenic
1032472667 7:132189764-132189786 AACCCCCTGCGGAGACTCATGGG + Intronic
1034501150 7:151451831-151451853 AAGTCCCTGCTGTGAGGCAGGGG + Intergenic
1034693729 7:153035437-153035459 ATCGTCCAGCTGTGACCCAGTGG + Intergenic
1036391429 8:8327769-8327791 CAAGCCCTGCTGTGACTCGGGGG - Exonic
1040331840 8:46389602-46389624 AGCGCACCGCTGGGACTCAGGGG + Intergenic
1048854386 8:138673966-138673988 AACGCCATGCAGTCACTCAGGGG + Intronic
1049469187 8:142767807-142767829 AACGCCCTGCCCAGCCTCAGAGG - Intronic
1050691700 9:8234527-8234549 AAGGCCCTGCTGGGGCTCTGGGG + Intergenic
1053391577 9:37740088-37740110 CAGGGCCTGCAGTGACTCAGAGG + Exonic
1057273308 9:93662877-93662899 AAAGGGCTGCTGTGACCCAGAGG - Intronic
1057798198 9:98172962-98172984 GATGCTCTGCTGTGACACAGCGG - Intronic
1061211072 9:129193803-129193825 CAAGCCCTGCTGTGATTCTGAGG - Intergenic
1185648429 X:1631457-1631479 ATCTCCCTCCTGTGACTCAGTGG + Intronic
1199289931 X:146093963-146093985 CACCCCCAGCTGTGACTCAAAGG - Intergenic