ID: 1161397561

View in Genome Browser
Species Human (GRCh38)
Location 19:4052584-4052606
Sequence CAGCCTCGGTGGGCGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397550_1161397561 21 Left 1161397550 19:4052540-4052562 CCCACGGGGTGGGGTTGGGAAGC No data
Right 1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG 0: 1
1: 0
2: 3
3: 48
4: 217
1161397549_1161397561 22 Left 1161397549 19:4052539-4052561 CCCCACGGGGTGGGGTTGGGAAG 0: 1
1: 0
2: 1
3: 26
4: 232
Right 1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG 0: 1
1: 0
2: 3
3: 48
4: 217
1161397551_1161397561 20 Left 1161397551 19:4052541-4052563 CCACGGGGTGGGGTTGGGAAGCT 0: 1
1: 0
2: 1
3: 23
4: 265
Right 1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG 0: 1
1: 0
2: 3
3: 48
4: 217
1161397546_1161397561 27 Left 1161397546 19:4052534-4052556 CCTGTCCCCACGGGGTGGGGTTG 0: 1
1: 0
2: 2
3: 15
4: 157
Right 1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG 0: 1
1: 0
2: 3
3: 48
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397561 Original CRISPR CAGCCTCGGTGGGCGTGGCT GGG Intronic
900493896 1:2967467-2967489 CAGCCTGGGTGGGAGAGGCTGGG - Intergenic
901808957 1:11755085-11755107 CAGCCTCGGAGGCTGGGGCTGGG - Intergenic
903034146 1:20484123-20484145 CAGCTCCGGTGGGCAAGGCTAGG + Intronic
906264452 1:44417838-44417860 CCGCCTCGGTGGCGGAGGCTGGG - Intronic
906695485 1:47820555-47820577 CAGCAGCGGTGGGCAGGGCTAGG + Intronic
907237758 1:53063177-53063199 CAGCCTCGGGGGCTGGGGCTAGG + Intronic
907272422 1:53298741-53298763 CAGCCCCAGGGGGCCTGGCTGGG - Intronic
907334692 1:53692610-53692632 CAGCCACTGTGGGTGTAGCTGGG + Intronic
911679227 1:100695130-100695152 CAGCCTTGATGAGGGTGGCTAGG + Intergenic
912652044 1:111448757-111448779 CAGCCTGAGTGGGCGCTGCTGGG - Exonic
912904538 1:113690022-113690044 CAGCGTGGGTGTGGGTGGCTGGG + Intergenic
916075454 1:161197786-161197808 AACCCTCGGTGGGTCTGGCTAGG + Intronic
916814461 1:168337893-168337915 CAGCCACGGCTGGAGTGGCTGGG + Intergenic
918571173 1:185994996-185995018 CAGCATCTGAGGGCGTGGCTTGG - Exonic
921065638 1:211620546-211620568 CAGCCTTGGTGGGCTGGCCTGGG + Intergenic
923091594 1:230745215-230745237 CAGCATCTGTGGGAGTGGCAGGG + Intergenic
923459639 1:234197204-234197226 CAGCCTCAGTGGGAGTGGGTAGG - Intronic
1063899828 10:10720790-10720812 TAACCTGGGTGGGCTTGGCTGGG + Intergenic
1067040671 10:42951734-42951756 CAGCCTGGGTGGGCCTGGCCTGG - Intergenic
1067088575 10:43255273-43255295 CAGCCTAGGCGGGCAGGGCTGGG - Intronic
1074377156 10:112950150-112950172 CAGCCGGGGTGGGCGGGGCGGGG - Intergenic
1074982001 10:118627214-118627236 TGGGCTCGGTGGGAGTGGCTGGG + Intergenic
1075275005 10:121085501-121085523 CAGCCACAATGGGCGGGGCTGGG - Intergenic
1075522353 10:123150527-123150549 AAGCCTCTGAGGGCCTGGCTTGG - Exonic
1076464854 10:130672016-130672038 CAGCCACGGCTGGAGTGGCTGGG + Intergenic
1076576489 10:131473377-131473399 CAGCCTCAGTGGGCTGAGCTGGG + Intergenic
1076584102 10:131533561-131533583 CAGCCTGGGTGGCAGTGGATGGG - Intergenic
1076624137 10:131811199-131811221 CACCAGCGGAGGGCGTGGCTGGG + Intergenic
1077299096 11:1839040-1839062 CGGCCTCGGCGGGCCGGGCTGGG - Intronic
1077402584 11:2366513-2366535 CAGCCTCACTGGCAGTGGCTGGG - Intergenic
1078337557 11:10475997-10476019 AAGTCTGGGTGGGCTTGGCTGGG - Intronic
1083635954 11:64121125-64121147 TTGTCTCGGAGGGCGTGGCTGGG - Intronic
1083663250 11:64261817-64261839 CAGTCTCAGGGGGCATGGCTAGG + Intronic
1083799019 11:65035608-65035630 CAGCCTCGGTGAGGGGGCCTCGG - Exonic
1085076353 11:73596624-73596646 CAGCCTTGGTGGCTGTGGTTGGG - Intronic
1085393397 11:76194060-76194082 CAGCTTCGGTTGGTGTGGGTGGG + Intronic
1085890547 11:80573624-80573646 CAGCCACGGCTGGAGTGGCTGGG + Intergenic
1086759019 11:90603708-90603730 CAGCCATGGTTGGAGTGGCTGGG - Intergenic
1087816595 11:102665057-102665079 CAGCCTGGCTGGGAGTGGATGGG + Intergenic
1088250875 11:107859817-107859839 AAGCCTCGGAAGGCGTGGCCAGG - Intronic
1088893431 11:114061122-114061144 AAGTCTCGGTGGGGGTCGCTGGG + Intronic
1089248216 11:117137832-117137854 CAGCCCCGGTGGGCAGGGCAGGG - Intergenic
1089258495 11:117206729-117206751 CAGCCCCGGTGGGCAGGGCAGGG + Exonic
1089700478 11:120241115-120241137 CAGCCAGGTTGGGCTTGGCTTGG + Intronic
1092184356 12:6467803-6467825 CAGCCACAGTGGGAGCGGCTGGG - Intronic
1092406386 12:8224558-8224580 CATCCAAGGTGGGCGTGGCTTGG - Intronic
1095852491 12:46826030-46826052 CAGCATCTAGGGGCGTGGCTGGG - Intronic
1096073759 12:48789476-48789498 GACCCTCGGTGGGCGGGGCGGGG - Intergenic
1096867896 12:54576093-54576115 CAGCCCAGGTGAGGGTGGCTGGG + Exonic
1097981463 12:65741507-65741529 CAGTCTGGGGGGGCGTGGCCGGG + Intergenic
1098169788 12:67735961-67735983 CAGCCTCTCTGGGCGAGGTTGGG + Intergenic
1098482497 12:70982029-70982051 CACCCTGGGTGGGCATGGCGGGG + Intergenic
1099668429 12:85659999-85660021 CAGCCACGGCTGGAGTGGCTGGG - Intergenic
1101788105 12:107903824-107903846 CAACGTGGCTGGGCGTGGCTGGG - Intergenic
1104096929 12:125566528-125566550 AAGCCTCAGTGGACGTGGCGGGG + Intronic
1105433323 13:20357236-20357258 CAGCCTAAGTGGGTGTGGCTGGG + Intergenic
1108791541 13:53974134-53974156 CAGCCTTGATGGAAGTGGCTGGG - Intergenic
1110008143 13:70297511-70297533 CAGCCTCGGTGGTAGCGGCCTGG + Intergenic
1112760674 13:102690457-102690479 GAGGGTCGATGGGCGTGGCTCGG + Intronic
1114984510 14:28210253-28210275 CAGCCTTGGCAGGAGTGGCTGGG - Intergenic
1115404137 14:32996567-32996589 CAGCCACTGTGGGAGTGGCTGGG - Intronic
1118933429 14:70264115-70264137 CAGCCACGGCTGGAGTGGCTGGG - Intergenic
1120392311 14:83924464-83924486 CAGCCATGGTGGGCATGGGTGGG - Intergenic
1121307684 14:92917290-92917312 CAGCCTCGGTGTCCAGGGCTTGG + Intergenic
1122581818 14:102776474-102776496 CAGCCTGGCTGGGCCTGGCGAGG - Intergenic
1123809799 15:23912416-23912438 CGGCATCGGTGGGCGTGGTCTGG - Intergenic
1124336510 15:28861309-28861331 CAGCCCTCGTGGGAGTGGCTTGG - Intergenic
1128583020 15:68821499-68821521 CAGCCGCGGTGGGGGTGACGGGG - Intronic
1129161821 15:73751963-73751985 CAGCCTGGGCAGGCCTGGCTGGG - Intronic
1130023581 15:80251727-80251749 CAGCCTCGGTGGGAGCCGCACGG - Intergenic
1130297032 15:82654665-82654687 CAGCCTCTGTGGGAGGGGCAGGG - Intergenic
1131360997 15:91790489-91790511 CAGCCTCCTTGGGAGTAGCTGGG + Intergenic
1132812739 16:1809415-1809437 CTCCTCCGGTGGGCGTGGCTCGG - Intronic
1132862415 16:2078161-2078183 CAGCCTGGGAGGGCCTGGGTGGG + Intronic
1136996529 16:35194700-35194722 CATCCTCGGTGGGCATGGCCTGG - Intergenic
1137537792 16:49340599-49340621 CAGCCTCGGAGGGTGAGGCCTGG + Intergenic
1138241963 16:55434620-55434642 CAGCCTGGGTGGCCGGGGTTGGG - Intronic
1138249294 16:55489949-55489971 CAGCCCAGGTGGGCGGGTCTGGG - Intronic
1141826683 16:86485607-86485629 GAGGCTGGGTGGGTGTGGCTGGG - Intergenic
1142006348 16:87691183-87691205 TAGACTCGGTGTGCGAGGCTGGG + Intronic
1142264350 16:89056959-89056981 CAGCATCACTGGGCATGGCTGGG - Intergenic
1142287811 16:89178557-89178579 CTGCCTCGGTGGGGCTGGGTGGG - Intronic
1142344953 16:89547967-89547989 CAGCCACGGTGTGGGTGGGTGGG - Intronic
1143512808 17:7405434-7405456 CAGCCCCGGGGGGCGGGGCCGGG - Intronic
1143780618 17:9226941-9226963 GGGCCTCGGGGGGCGGGGCTGGG - Intronic
1144960219 17:19040436-19040458 CAGCCTCTGTGGGGGAGGCTGGG + Intronic
1144974941 17:19134088-19134110 CAGCCTCTGTGGGGGAGGCTGGG - Intronic
1147593230 17:41699216-41699238 GAGGCTCAGTGGGAGTGGCTGGG + Intergenic
1147718354 17:42522706-42522728 CAGCTTCAGTAGGCCTGGCTGGG + Intergenic
1148150834 17:45395805-45395827 CAGCCGCTGTGTGCGTGACTTGG - Exonic
1148621131 17:49035627-49035649 CTGCAGCGGTGGGGGTGGCTGGG + Intronic
1148697948 17:49572427-49572449 CACCCTGGATGGGGGTGGCTGGG - Intergenic
1148748710 17:49932330-49932352 GAGCCTCGGTGGGGGTTGATAGG + Intergenic
1151977743 17:77492014-77492036 CTGCCTCGGTGGGTGTGGGTGGG + Intronic
1152138509 17:78522231-78522253 CCGCCATGGTGGCCGTGGCTCGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152639940 17:81445187-81445209 CGGCCCAGGTGAGCGTGGCTAGG - Intronic
1152642887 17:81456548-81456570 CAGCCACGGAGGGCTGGGCTGGG - Exonic
1152649217 17:81484169-81484191 CGGCCTCGGCGTGCGTGGCTCGG + Intergenic
1152749195 17:82054817-82054839 CTGCCTCGGCGGGCGGGGGTGGG + Intronic
1152799481 17:82324170-82324192 CAGCCGGGGTGGGGGTGGCAGGG + Intronic
1156502311 18:37567338-37567360 CAGCCCCAGTGGGCCTGGCGGGG - Intergenic
1156858870 18:41813864-41813886 CAGCCATGGTTGGAGTGGCTGGG + Intergenic
1157466980 18:47955822-47955844 CTGCATCGGTGGGCGTGGGATGG - Intergenic
1157829032 18:50839821-50839843 CAGCGTCTGTGGGCTTGGCCTGG - Intergenic
1158544898 18:58387926-58387948 CTGCCACGGTGGGGGTGGATGGG - Intronic
1160082014 18:75736907-75736929 CAGCCGTGGTTGGAGTGGCTGGG - Intergenic
1160963147 19:1733590-1733612 CAGCGTCTGTGGGCCTGGCGGGG - Intergenic
1161129397 19:2579279-2579301 CAGCCGTGCTGGGCGTGGCCTGG - Intronic
1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG + Intronic
1161551578 19:4915810-4915832 CAGCCTCAGTTGGTGTGTCTGGG + Intronic
1161645462 19:5450821-5450843 CACCCTGGCTGGGCGAGGCTAGG - Intergenic
1162127512 19:8507303-8507325 CAGCCTCAGCTGACGTGGCTTGG - Intergenic
1162794590 19:13079932-13079954 CCGCCTAGGTGGCGGTGGCTGGG + Intronic
1163117066 19:15195425-15195447 CAGCGTCGGGGGGCGGAGCTTGG - Intronic
1163248400 19:16111479-16111501 CAGCCTGGCGGGGCGTGGCTTGG - Intergenic
1163255495 19:16153499-16153521 AAGGCTCGGTGGGCGTGGCCTGG + Intronic
1163255528 19:16153666-16153688 GAAGCTCGGTGGGCGTGGCCTGG + Intronic
1165266528 19:34666604-34666626 CAGGCCCGGTGGGCGTGGCTTGG - Intronic
1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG + Intronic
1166331205 19:42079053-42079075 GAGCCTTGGTGGGTGTGGCCCGG - Exonic
1166368708 19:42290150-42290172 CAGGCTGGATGGGCATGGCTAGG + Intronic
1167327887 19:48836519-48836541 CGGCCTCGGGGGGCGTTGCCAGG + Exonic
1167423055 19:49415032-49415054 CAGCCTCTGTGGGTGTGGAGTGG - Intronic
1167843405 19:52140073-52140095 GAGCGGCAGTGGGCGTGGCTAGG + Intergenic
1168361220 19:55742359-55742381 GAGCCCCGGTGGGTGTGGGTGGG - Intergenic
1168707931 19:58480239-58480261 CAGCCTGGGAGGGCTTGTCTGGG + Exonic
926502480 2:13673353-13673375 CAGCCACGGTTGGAGTGGCTGGG + Intergenic
928093689 2:28391756-28391778 CTCCCTCGCTGGGCGGGGCTGGG - Intergenic
933790739 2:85882028-85882050 CAGCCACGGCTGGAGTGGCTGGG - Intronic
938370979 2:130768281-130768303 CAGCGCCGTTGGGCCTGGCTGGG - Intergenic
938502158 2:131835900-131835922 CATCCCGGGTGGGCCTGGCTTGG - Intergenic
939069844 2:137526024-137526046 CAGCCTGGGAGGGGCTGGCTAGG - Intronic
940048370 2:149434690-149434712 GAGCCTCTGTGGGAGTGGATGGG - Intronic
946026647 2:216675828-216675850 CAGCCTCTGTGGGGGAGGATAGG - Exonic
947990010 2:234479304-234479326 CTGCCTCAGTGGGCGTGGAAGGG + Intergenic
948048001 2:234958345-234958367 CAGCCATGGTGAGCGGGGCTGGG + Intronic
948488541 2:238296811-238296833 CAGCCTTGGTGGGGATGCCTGGG - Intergenic
948640298 2:239371741-239371763 GAGCCTCTGTCGGCGTGGCCCGG + Intronic
948795643 2:240400842-240400864 CAGCCTCGGGGCGTTTGGCTGGG + Intergenic
1168861051 20:1046341-1046363 CAGCCTCGGCTGGCCTTGCTGGG - Intergenic
1169706690 20:8514146-8514168 CAGCCTGGGTGGGCCGGGCATGG + Intronic
1169999272 20:11596645-11596667 CAGCCACGGCTGGAGTGGCTGGG + Intergenic
1172183335 20:33016756-33016778 CAGCCCAGGTGGTCGTAGCTGGG - Intronic
1174169005 20:48604725-48604747 AAGCCTGGGTGGGTGTGGCCTGG - Intergenic
1174951015 20:55041591-55041613 CAGCCACGGCTGGAGTGGCTGGG - Intergenic
1176413644 21:6462272-6462294 CAGAATGGGTGGGGGTGGCTGGG - Intergenic
1177781066 21:25622738-25622760 CAGCCTCGGTGGGGATGGTGGGG + Intergenic
1178602795 21:34009472-34009494 CACCCACGGTGGGCATGTCTGGG + Intergenic
1178815357 21:35924269-35924291 CACCCGTGGTGGGTGTGGCTGGG - Intronic
1179689142 21:43070595-43070617 CAGAATGGGTGGGGGTGGCTGGG - Intronic
1180023739 21:45146510-45146532 CAGCCTCCCTGGGAGTGGCTTGG + Intronic
1180134569 21:45853964-45853986 CAGCCTCTGTGCACGAGGCTAGG + Intronic
1180987273 22:19912344-19912366 CACCCTGGGAGGGCGTGGCAGGG + Intronic
1181630461 22:24148447-24148469 GAGCCTCAGTAGGTGTGGCTGGG + Intronic
1182472014 22:30554611-30554633 CAGCCTCAGTGGTGGTGACTTGG - Intergenic
1183406585 22:37633264-37633286 CAGCCTCAGGGGGCCAGGCTGGG + Exonic
1184297710 22:43535805-43535827 CAGCCTCTCTTGGCCTGGCTTGG - Intronic
1184738082 22:46410802-46410824 CAGCCTGGGTGGGCGGGGCTTGG - Intronic
1185075517 22:48680089-48680111 CAGCCCCGGTGGGTGTGGATGGG + Intronic
952980073 3:38727247-38727269 CCGCCTCAGTGGACGAGGCTTGG + Intronic
953503739 3:43462835-43462857 CAGCCACGGCTGGAGTGGCTGGG - Intronic
953768365 3:45760956-45760978 CAGCCTTGGCGGGAGGGGCTGGG + Intronic
954415034 3:50389141-50389163 CAGCCCCGGTGGGCCTGGGGCGG + Intronic
955445822 3:59008352-59008374 CAGCCTTGATGAGTGTGGCTGGG - Intronic
957777081 3:84767335-84767357 CAGCCTTGATGAGGGTGGCTGGG - Intergenic
958149105 3:89667733-89667755 CAGCCTTGATGAGGGTGGCTGGG - Intergenic
961360762 3:126365760-126365782 CAGCCTAGGTGGGGGTGTCATGG - Intergenic
961463677 3:127068758-127068780 AAGCCTGGGCGGGAGTGGCTGGG - Intergenic
963479657 3:145855001-145855023 CTGTCTCTGTGGGAGTGGCTTGG + Intergenic
964427376 3:156568151-156568173 CAGCCCCGGCTGGAGTGGCTGGG - Intergenic
966696427 3:182793976-182793998 CAGCCTCGGCGGCCCGGGCTTGG - Intronic
968266606 3:197367808-197367830 AAGCCTGGGTGGGGGTGGGTGGG + Intergenic
969146255 4:5126395-5126417 CAGCCCTGCTGAGCGTGGCTGGG + Intronic
969759749 4:9173425-9173447 CATCCAAGGTGGGCGTGGCTTGG + Intronic
970763252 4:19516934-19516956 CAGCCGCAGTTGGAGTGGCTGGG - Intergenic
971815061 4:31476788-31476810 CAGCCATGGTTGGAGTGGCTGGG - Intergenic
972467489 4:39371209-39371231 CAGCCACGGCTGGAGTGGCTGGG - Intergenic
972475586 4:39446656-39446678 AGGCCTAGGTGGGCGTGGGTCGG - Exonic
975311988 4:72913512-72913534 CAGCCACGGGTGGAGTGGCTGGG - Intergenic
983245643 4:165283990-165284012 CAGCCACGGCTGGAGTGGCTGGG + Intronic
983723865 4:170893673-170893695 CAGCCACGGCTGGAGTGGCTGGG + Intergenic
990005564 5:50940207-50940229 CAGCCTTGATGAGGGTGGCTGGG - Intergenic
993098290 5:83505971-83505993 CAGCCACGGTTTGAGTGGCTGGG + Intronic
993796724 5:92276207-92276229 CAGCCTTGATGAGGGTGGCTGGG - Intergenic
996985909 5:129564265-129564287 AAGTCTGGGTGGGCGTGACTGGG - Intronic
997210868 5:132075954-132075976 CAGCCATGGTGGGAGTGGCCTGG + Exonic
997236421 5:132274690-132274712 CATCCTGGTTGGGGGTGGCTTGG + Intronic
997817762 5:137034953-137034975 CAGCCTTGGTGGGGGTGGGAGGG + Intronic
1003045347 6:2728604-2728626 CAACCTCTCTGGGCATGGCTGGG - Intronic
1003045442 6:2729255-2729277 CAACCTCTCTGGGCATGGCTGGG + Intronic
1003440435 6:6136374-6136396 CAGCCTCGATAGGCTTGGTTTGG + Intergenic
1004007122 6:11647190-11647212 CAGCCTCAGTGGGGTCGGCTAGG - Intergenic
1004528753 6:16434331-16434353 CAGCCTCCGTTGGCATGGATGGG + Intronic
1005793544 6:29332455-29332477 CAGCCCTGATGGGTGTGGCTAGG - Intergenic
1010926463 6:81751982-81752004 CAGCTTCGGTGGGCATTGCTTGG - Exonic
1016108154 6:140188419-140188441 CAGCCACGGCTGGAGTGGCTGGG - Intergenic
1017525408 6:155237742-155237764 CAGCCATGGTTGGAGTGGCTGGG + Intronic
1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG + Intronic
1019121842 6:169810445-169810467 TGGCCTCGGTGGGCAGGGCTTGG + Intergenic
1019165209 6:170094026-170094048 CAGCCTGGGAGGGCCTGGCTGGG + Intergenic
1019198289 6:170295280-170295302 CCACTTGGGTGGGCGTGGCTGGG - Intergenic
1019303683 7:322360-322382 GGGCCTCGGGGGGCGTGGCCGGG - Intergenic
1019540918 7:1550614-1550636 CAGCCTCCGTGAGAGGGGCTCGG - Intronic
1019660365 7:2220578-2220600 CGACCTGGGTGGGCCTGGCTGGG + Intronic
1023878583 7:44306207-44306229 AAGCCACGGTGGGCTGGGCTGGG + Intronic
1024185057 7:46940916-46940938 CAGCCTCGCTGAGCCTTGCTAGG + Intergenic
1029550690 7:101235734-101235756 CAGCCCCAGAGGGAGTGGCTGGG - Intronic
1030634280 7:111931061-111931083 CAGGCTGCGTGGGCCTGGCTGGG + Intronic
1034266515 7:149783691-149783713 GAGCCTGGGTGGGGTTGGCTGGG - Intergenic
1034487635 7:151375977-151375999 CAGCCTCGGGTGGGGTTGCTTGG + Intronic
1035225102 7:157428386-157428408 CAGCGTCAGTGGCTGTGGCTGGG + Intergenic
1036263342 8:7257156-7257178 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036264645 8:7264778-7264800 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036265944 8:7272400-7272422 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036267246 8:7280022-7280044 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036268549 8:7287644-7287666 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036269853 8:7295266-7295288 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036298040 8:7551788-7551810 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1036299345 8:7559437-7559459 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1036300650 8:7567086-7567108 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1036301955 8:7574731-7574753 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1036303253 8:7582380-7582402 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1036315386 8:7715695-7715717 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036316690 8:7723343-7723365 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036317997 8:7730991-7731013 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036319304 8:7738639-7738661 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036320613 8:7746286-7746308 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036321923 8:7753934-7753956 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036323232 8:7761582-7761604 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036324531 8:7769229-7769251 CATCCAAGGTGGGCGTGGCTTGG + Intergenic
1036351503 8:8015078-8015100 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1036352811 8:8022724-8022746 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1036354100 8:8030372-8030394 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1036733282 8:11284727-11284749 CAGGCTGGGTGGGCGCGGCGAGG - Exonic
1036846761 8:12175497-12175519 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1036868126 8:12417816-12417838 CATCCAAGGTGGGCGTGGCTTGG - Intergenic
1037886738 8:22599585-22599607 CAGCCCCGCTGGGAGTGTCTGGG + Intronic
1038036811 8:23693038-23693060 CAGCCTCAGAGGGAGTGACTCGG - Intergenic
1042832949 8:73051454-73051476 CAGCCCAGGAGGGTGTGGCTGGG + Intergenic
1048858062 8:138700668-138700690 CAGCCTAGGTGGGGGTGGCCAGG - Intronic
1049076280 8:140398979-140399001 CAGCCTTGGCTGGAGTGGCTGGG - Intronic
1049180859 8:141221452-141221474 GACCCTCTGTGGGCCTGGCTGGG - Intronic
1049211558 8:141388986-141389008 CAGCCACGGAGGGCATGGGTGGG - Intergenic
1049425318 8:142535524-142535546 CAGCCTCGGGGGTGGTGGCCAGG + Intronic
1049475358 8:142794668-142794690 AGGCCTCGGGGGCCGTGGCTGGG - Intergenic
1049676761 8:143892782-143892804 CCTCCTGGGTGAGCGTGGCTGGG - Intergenic
1049755588 8:144310041-144310063 CAGCCACGGGCGGCGGGGCTGGG - Intronic
1050672796 9:8016735-8016757 CAGGCTTGGGGGGCGTGGATTGG + Intergenic
1051257682 9:15231982-15232004 CAGCCCTGGTGGGGGTGACTCGG - Intronic
1053130090 9:35609696-35609718 CAGGCTGGGTGTGGGTGGCTTGG - Exonic
1053173440 9:35906618-35906640 CAGCCTCAGCGAGCGTGGCGGGG - Exonic
1053214386 9:36258485-36258507 CACTCCGGGTGGGCGTGGCTGGG - Intronic
1058102924 9:100937195-100937217 CAGCCTTGATGAGGGTGGCTGGG + Intergenic
1058343071 9:103921468-103921490 CAGCCTTGATGAGGGTGGCTGGG - Intergenic
1058411720 9:104740490-104740512 CAGCCTCGCAAGGTGTGGCTGGG - Intergenic
1059372257 9:113851602-113851624 CAGCGTGGCTGGGCGTGGCCGGG - Intergenic
1060208965 9:121699036-121699058 CGGCCGCGGTCGGCGCGGCTCGG + Intronic
1060295017 9:122337502-122337524 CAGCCTCTGTGGCCAAGGCTGGG + Intergenic
1060311922 9:122470267-122470289 CAGCTACAGTGGGAGTGGCTGGG - Intergenic
1060859221 9:126940085-126940107 CAGCCTCAATGGGAGTGCCTGGG - Intronic
1062497284 9:136837779-136837801 CATCCCGGGTGGGCCTGGCTTGG + Intronic
1189821397 X:44873021-44873043 CGGCCTCGGTGGGCGGGGCTCGG + Intergenic
1190056851 X:47186162-47186184 CAGCCTCTGTGTGAGTGGCTGGG + Exonic
1190533959 X:51407839-51407861 CAGCCTCGGCGGGCAGGGCCTGG - Exonic
1193011982 X:76686992-76687014 CAGCCCTGGTGGGAGTGGCAGGG + Intergenic
1197854780 X:130903012-130903034 AAGCCCCGGTGGCCGTGGCTGGG - Intronic
1198167441 X:134071556-134071578 CAGCCTGGCTGGGAGTGGATGGG - Intergenic
1202091361 Y:21194282-21194304 CAGCCACGGCTGGAGTGGCTGGG - Intergenic