ID: 1161397884

View in Genome Browser
Species Human (GRCh38)
Location 19:4054398-4054420
Sequence CTACGGCCGCGGCGGAGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 90}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161397884_1161397897 12 Left 1161397884 19:4054398-4054420 CCTCCTCTCCGCCGCGGCCGTAG 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1161397897 19:4054433-4054455 GTGGCGGCCGGCGGGGCCACCGG 0: 1
1: 0
2: 2
3: 23
4: 276
1161397884_1161397889 -7 Left 1161397884 19:4054398-4054420 CCTCCTCTCCGCCGCGGCCGTAG 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1161397889 19:4054414-4054436 GCCGTAGTGGCCGTTCTGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 23
1161397884_1161397892 0 Left 1161397884 19:4054398-4054420 CCTCCTCTCCGCCGCGGCCGTAG 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1161397892 19:4054421-4054443 TGGCCGTTCTGCGTGGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
1161397884_1161397894 3 Left 1161397884 19:4054398-4054420 CCTCCTCTCCGCCGCGGCCGTAG 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1161397894 19:4054424-4054446 CCGTTCTGCGTGGCGGCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
1161397884_1161397898 15 Left 1161397884 19:4054398-4054420 CCTCCTCTCCGCCGCGGCCGTAG 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1161397898 19:4054436-4054458 GCGGCCGGCGGGGCCACCGGCGG 0: 1
1: 0
2: 3
3: 36
4: 275
1161397884_1161397891 -4 Left 1161397884 19:4054398-4054420 CCTCCTCTCCGCCGCGGCCGTAG 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1161397891 19:4054417-4054439 GTAGTGGCCGTTCTGCGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
1161397884_1161397895 4 Left 1161397884 19:4054398-4054420 CCTCCTCTCCGCCGCGGCCGTAG 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1161397895 19:4054425-4054447 CGTTCTGCGTGGCGGCCGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 57
1161397884_1161397899 18 Left 1161397884 19:4054398-4054420 CCTCCTCTCCGCCGCGGCCGTAG 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1161397899 19:4054439-4054461 GCCGGCGGGGCCACCGGCGGCGG 0: 1
1: 1
2: 2
3: 30
4: 400
1161397884_1161397896 5 Left 1161397884 19:4054398-4054420 CCTCCTCTCCGCCGCGGCCGTAG 0: 1
1: 0
2: 2
3: 6
4: 90
Right 1161397896 19:4054426-4054448 GTTCTGCGTGGCGGCCGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161397884 Original CRISPR CTACGGCCGCGGCGGAGAGG AGG (reversed) Exonic
903034439 1:20485316-20485338 CTACGGCGACGGCGGCGACGTGG - Exonic
903251100 1:22053290-22053312 TTGCGGCCGCGGCGGGGCGGTGG + Intronic
903398246 1:23019393-23019415 CTATGGCTGCGGGGGAGGGGCGG + Intergenic
904684097 1:32248354-32248376 CTCCCGCTGCGGCCGAGAGGGGG - Exonic
906124846 1:43421459-43421481 CTAAGGCCCCGGGGAAGAGGAGG + Intronic
915595335 1:156893699-156893721 CTGCGGGAGCGGCGGGGAGGCGG - Exonic
921199530 1:212791960-212791982 CAAAGTCCGGGGCGGAGAGGTGG - Exonic
1065342697 10:24722767-24722789 CGCCGGCCGGGGCGGAGGGGCGG - Intronic
1072654173 10:97319194-97319216 CTACCACCGCGCCGGGGAGGGGG - Intergenic
1077386198 11:2270632-2270654 CGACGGCGGCGGCGCGGAGGAGG - Exonic
1091718325 12:2795295-2795317 CTCCGGGCGCGGCGGAAGGGCGG - Intronic
1096117095 12:49060929-49060951 CCAGGGCCGCGGCGGAGAGGAGG - Intergenic
1098893221 12:76030800-76030822 CTGCGGCTGCGGCTGCGAGGGGG + Exonic
1102931052 12:116862549-116862571 CTAGGGCCGGGGCGGATAGGAGG + Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1111951359 13:94711737-94711759 CTACGGCCTGGGCGGCGTGGCGG - Exonic
1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG + Exonic
1114634177 14:24178109-24178131 CGACGGCGGCGGCGAGGAGGTGG - Exonic
1114634178 14:24178112-24178134 CGACGACGGCGGCGGCGAGGAGG - Exonic
1115235794 14:31207673-31207695 CGACGGCGGCGGCGGCGCGGCGG + Intronic
1116886967 14:50231403-50231425 CTACGGCCGAGGCGGCTCGGAGG + Exonic
1121253258 14:92514532-92514554 CTACGGCCAGGGCAGAGGGGCGG - Intronic
1122444857 14:101761202-101761224 CGAGAGCCGCGGCGGTGAGGGGG + Intergenic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1123032199 14:105457172-105457194 CTATGGAGGCGGCTGAGAGGTGG + Intronic
1202929124 14_KI270725v1_random:23285-23307 GTGCCGGCGCGGCGGAGAGGCGG - Intergenic
1125603085 15:40926177-40926199 CTGCGGTCGCTGCGGAGAAGGGG - Intergenic
1128078235 15:64841631-64841653 CTGCGGCGGGGGAGGAGAGGGGG - Intergenic
1132570459 16:641896-641918 CTGCGGGCGCCGCGGGGAGGGGG - Exonic
1134090966 16:11391596-11391618 TTAGGGCCCCGGTGGAGAGGGGG + Intronic
1137426333 16:48384709-48384731 CTCCGGGCGCCGCGGGGAGGAGG + Intronic
1139549816 16:67666975-67666997 CCTCGGCAGGGGCGGAGAGGCGG + Exonic
1203123056 16_KI270728v1_random:1555462-1555484 GCGCGGGCGCGGCGGAGAGGCGG - Intergenic
1143419297 17:6776370-6776392 CGAGGCCCGCGGCGGGGAGGCGG + Intronic
1146398724 17:32487517-32487539 CTGCGGCGGCCCCGGAGAGGAGG - Exonic
1147467133 17:40619111-40619133 CTGGGGCCCCGGCAGAGAGGAGG + Intergenic
1152245803 17:79183978-79184000 CTCCGGCCGCTGCGGAGAGGAGG + Intronic
1157706649 18:49813379-49813401 TTCCGGCCGCCGCGGAGAGTCGG - Intronic
1160706309 19:531790-531812 CGGCGGCGGCGGCGCAGAGGAGG + Exonic
1160717462 19:582773-582795 CTCCGGCGGCGGCGCAGACGTGG - Exonic
1161207203 19:3047271-3047293 GGGCGGCCGCGGCGGGGAGGGGG + Intronic
1161397884 19:4054398-4054420 CTACGGCCGCGGCGGAGAGGAGG - Exonic
1161702368 19:5802514-5802536 CCCCAGCCGCGGCGGGGAGGGGG + Intergenic
1163473475 19:17511648-17511670 CGAGGGCGGCGGCGGGGAGGAGG - Exonic
1165307662 19:35012206-35012228 CTACAGCCGGGGGGCAGAGGGGG - Intronic
1165433974 19:35786940-35786962 CTCCGGCCGGGGCTGAGAGCTGG - Exonic
1165504347 19:36215306-36215328 CTACGTGCGGGGCGGAGATGGGG + Intronic
1166042869 19:40213860-40213882 CCACGGCCGCCGCGAAGACGTGG + Exonic
1167134294 19:47608240-47608262 CCACGGCGGCGCCGGGGAGGCGG - Exonic
1167649044 19:50719626-50719648 CGGCGGCCGCGGCGGAAGGGGGG - Intergenic
1202683168 1_KI270712v1_random:28973-28995 ATAAAGCCGCGGCGGCGAGGGGG - Intergenic
1202693093 1_KI270712v1_random:105045-105067 AGGCGGCGGCGGCGGAGAGGCGG + Intergenic
929033889 2:37672553-37672575 CTCCGGCCCCGGCGGAGGGGAGG - Intronic
933666854 2:84971271-84971293 CGGCGGCGGCGGCGGGGAGGCGG - Exonic
933870755 2:86563274-86563296 CTACGGCGGCGGCAGATAAGCGG - Intronic
934079068 2:88452325-88452347 CTGCGGCGGCGGCGGAGGGCGGG + Exonic
936278726 2:111120775-111120797 CGGCGGCCGCGGCGCCGAGGGGG + Intronic
937926941 2:127174886-127174908 CTAGGGCAGAGGTGGAGAGGAGG + Intergenic
942277657 2:174334773-174334795 CTAGGGCCGCGGGGGTGGGGGGG - Intergenic
943766593 2:191669646-191669668 CTAGGGCTGCTGTGGAGAGGTGG - Intergenic
948684103 2:239659364-239659386 AGACGGGAGCGGCGGAGAGGAGG - Intergenic
1172698076 20:36835845-36835867 CGGCGGCGGCGGCGGGGAGGCGG - Intronic
1172771384 20:37384438-37384460 CTGGGGCCACGGCGGGGAGGCGG + Intronic
1173251660 20:41366837-41366859 CTGGGGCCGCGGAGGGGAGGCGG + Intergenic
1174357826 20:50010107-50010129 CGGCGGCGGCGGCGGCGAGGGGG + Intergenic
1181270818 22:21657619-21657641 CCACGGCCGCGGCGCAGGTGCGG - Intronic
1181563157 22:23717300-23717322 CTGCGGCCGAGACGGGGAGGGGG - Intergenic
1183665107 22:39242473-39242495 CTGCGGGAGAGGCGGAGAGGGGG + Intronic
1185032527 22:48452011-48452033 CAACGGCCAGGGCTGAGAGGAGG + Intergenic
950773760 3:15332565-15332587 CTCCGGCCGCGGCGGAGCAGAGG + Exonic
962263179 3:133927704-133927726 CCCGGGCCGCGGCGGAGGGGCGG + Intergenic
968613128 4:1566030-1566052 CTTCGTCCCCGGCGGGGAGGCGG + Intergenic
970188144 4:13484208-13484230 CTCCGGGGGCGGGGGAGAGGAGG + Exonic
972407652 4:38762174-38762196 CTAAGGCCGCCTGGGAGAGGTGG - Intergenic
972543194 4:40056875-40056897 CTGCGGCCGCGGGGGAGACACGG - Exonic
982288805 4:153759973-153759995 CTGCGGCGGCGGCGGAGCGGCGG + Exonic
985033067 4:185811694-185811716 CTGAGGCCGAGGCGGAGAAGGGG - Intronic
985629886 5:1008863-1008885 GTACGGCCGCGGGGCGGAGGTGG - Exonic
992249981 5:74866594-74866616 CGGCGGCCGGGGCGGAGAGAGGG - Intronic
1003290875 6:4776910-4776932 CTGCGGCCGCGGCGGGGGAGGGG - Intronic
1006439359 6:34043551-34043573 CTACGGCCGCTGCAGAGAGAAGG + Intronic
1006589112 6:35141276-35141298 GTACCACCGCGGCGGAGCGGCGG + Exonic
1008786495 6:55174849-55174871 CTCAGCCCGGGGCGGAGAGGGGG - Intronic
1013366390 6:109441056-109441078 CGACGGCCGCGGTGGGGACGGGG - Exonic
1017164178 6:151391656-151391678 CTCCCGCCGGGGGGGAGAGGCGG + Intergenic
1019143387 6:169962105-169962127 CTGCGGCCGCCCCGGTGAGGAGG - Intergenic
1020099705 7:5388209-5388231 CCACAGCCGCGCCGAAGAGGAGG - Exonic
1036930573 8:12951841-12951863 CTGCGGCCGCGGCGGGAAGAAGG + Intronic
1042962790 8:74321227-74321249 CTACTGCGGCGGCTGGGAGGAGG - Exonic
1044340433 8:91040790-91040812 TTGCGGCCTCGGCGGAGTGGTGG + Exonic
1055513390 9:77016145-77016167 CTGGGGCCGCGGTGGGGAGGGGG - Intergenic
1060770174 9:126326813-126326835 CGGCGGCGGCGGCGGAGGGGCGG - Intergenic
1186426088 X:9465199-9465221 CTGCGGCGGCGGCGGGGCGGGGG - Exonic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1189396063 X:40623877-40623899 CTACGGCGGCGGCGGCGCCGAGG + Intergenic
1189988716 X:46575305-46575327 CTACCCTCGCAGCGGAGAGGAGG + Exonic
1192034376 X:67546550-67546572 CGGCGGCGGCGGCGGCGAGGCGG + Exonic
1195138166 X:101931760-101931782 CTATGGCGGCGGCGGGGAGGGGG - Exonic