ID: 1161398305

View in Genome Browser
Species Human (GRCh38)
Location 19:4056397-4056419
Sequence CCCGGGGGCCCTCCTCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161398305_1161398319 14 Left 1161398305 19:4056397-4056419 CCCCTCCGAGGAGGGCCCCCGGG 0: 1
1: 0
2: 2
3: 14
4: 163
Right 1161398319 19:4056434-4056456 GGGCACTTTGAGGCCCGGCTCGG 0: 1
1: 0
2: 2
3: 15
4: 165
1161398305_1161398317 4 Left 1161398305 19:4056397-4056419 CCCCTCCGAGGAGGGCCCCCGGG 0: 1
1: 0
2: 2
3: 14
4: 163
Right 1161398317 19:4056424-4056446 CCTGTTGAAAGGGCACTTTGAGG 0: 1
1: 0
2: 1
3: 12
4: 146
1161398305_1161398312 -7 Left 1161398305 19:4056397-4056419 CCCCTCCGAGGAGGGCCCCCGGG 0: 1
1: 0
2: 2
3: 14
4: 163
Right 1161398312 19:4056413-4056435 CCCCGGGAATGCCTGTTGAAAGG 0: 1
1: 0
2: 1
3: 6
4: 78
1161398305_1161398314 -6 Left 1161398305 19:4056397-4056419 CCCCTCCGAGGAGGGCCCCCGGG 0: 1
1: 0
2: 2
3: 14
4: 163
Right 1161398314 19:4056414-4056436 CCCGGGAATGCCTGTTGAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 68
1161398305_1161398318 9 Left 1161398305 19:4056397-4056419 CCCCTCCGAGGAGGGCCCCCGGG 0: 1
1: 0
2: 2
3: 14
4: 163
Right 1161398318 19:4056429-4056451 TGAAAGGGCACTTTGAGGCCCGG 0: 1
1: 0
2: 1
3: 45
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161398305 Original CRISPR CCCGGGGGCCCTCCTCGGAG GGG (reversed) Intronic
900350734 1:2233298-2233320 GCCGGGGGTCCTGCTCCGAGGGG + Intronic
902231443 1:15030130-15030152 CCTGGCCGCCCTCCTAGGAGAGG - Intronic
902618739 1:17638340-17638362 ACCTGGAGCCCTCCTCTGAGAGG - Intronic
902757847 1:18560863-18560885 GCAGGGGGCCCTGCTCGGAGAGG + Intergenic
903497382 1:23778704-23778726 CCAGGCGGCCCACCTTGGAGCGG - Exonic
903499015 1:23791674-23791696 CCCAGGCTCCCTCCTCGGAGGGG - Intronic
905867246 1:41382808-41382830 CCCGGCGGCCGGCCTCCGAGAGG - Exonic
906556675 1:46719279-46719301 CCCGGAAGCCCTCCTGGGGGCGG - Intergenic
916789857 1:168115708-168115730 CCCGGGGACCCTCATTAGAGAGG - Intronic
916994228 1:170278900-170278922 CCCAGGGTCTCTCCTTGGAGGGG + Intergenic
917944502 1:179954996-179955018 ACCGGGTGCCCTCCTCGCACCGG - Exonic
1063364331 10:5480670-5480692 CCTCGGGGCCCTCCAGGGAGGGG - Intergenic
1067700659 10:48569039-48569061 TCCAGGGCCCCTCCTTGGAGTGG + Intronic
1069841838 10:71344672-71344694 CCCGTGAGCCCTCTTGGGAGTGG - Intronic
1069913511 10:71773577-71773599 CCCGGGGGCGCTGCGCGAAGGGG - Intronic
1070566157 10:77605243-77605265 CCCGGATGCCCTCCTTGAAGAGG + Intronic
1072219418 10:93315234-93315256 CCAGGGGTCCCTCCTGGCAGAGG - Intronic
1074845251 10:117391989-117392011 GCGGGGGGCCCTCCTCTGAGTGG - Intergenic
1076736377 10:132460998-132461020 CCTGGGGGTCCTCCCCAGAGTGG + Intergenic
1076768775 10:132651637-132651659 TACGGGGGCCCACCTGGGAGAGG - Intronic
1076820842 10:132938841-132938863 CCTGAGGCCCCTCCTGGGAGGGG - Intronic
1077014785 11:394698-394720 CCCGGGGTCCCTGCTTGGACAGG - Intronic
1077108874 11:853427-853449 CCTGGGGGCCTACCTGGGAGGGG + Intronic
1078594597 11:12675006-12675028 CCCGGCCGCTCACCTCGGAGGGG - Intronic
1083276464 11:61599798-61599820 CCTGGGATCCCTCCTCTGAGGGG + Intergenic
1083891596 11:65598356-65598378 CCTGGGGGCCCCCCTGGAAGGGG + Exonic
1084564511 11:69921472-69921494 CCCGGTGGCCCCCTCCGGAGAGG - Intergenic
1084568257 11:69943822-69943844 CCCGGGGGCCAGCCTGGGACAGG - Intergenic
1089508331 11:118979675-118979697 GCCGGGGGCCCTGCGAGGAGGGG + Intronic
1091829729 12:3540937-3540959 CCGGGGGGCCCCTCTGGGAGGGG + Intronic
1096214605 12:49792308-49792330 CCCAGGGGTCCTCCTCCCAGAGG + Intronic
1096413285 12:51391986-51392008 CCCGGAGGCCTGCCCCGGAGGGG + Intronic
1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG + Intergenic
1104957289 12:132473048-132473070 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957361 12:132473290-132473312 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957385 12:132473372-132473394 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957410 12:132473453-132473475 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957422 12:132473494-132473516 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957457 12:132473615-132473637 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957482 12:132473697-132473719 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104957494 12:132473738-132473760 CCCGGGGTCCCTTCCTGGAGAGG + Intergenic
1104964873 12:132504427-132504449 CCTGGTGGTCCTCCTGGGAGAGG + Intronic
1108501241 13:51071811-51071833 TCCCGGGGCCATCCTCGCAGAGG - Intergenic
1113655812 13:112067354-112067376 CCCAGGCGCCCTCGGCGGAGCGG - Intergenic
1113819708 13:113204429-113204451 CACCGGGGCCCTCCAAGGAGAGG + Intronic
1113908448 13:113830844-113830866 CCCTGGGGCCCTCCTCCCCGGGG + Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114259459 14:21026192-21026214 CCAGGGAGCCTTCCTCCGAGGGG - Intronic
1119259293 14:73228109-73228131 CCAGGGGGCCCTCCGCGGAGTGG - Intergenic
1120953550 14:90062433-90062455 CCCGAGTGGCCTCCTCGTAGTGG - Exonic
1121595100 14:95156795-95156817 CCCTGGGGCCCTCCTCTGATGGG - Intronic
1122900257 14:104779482-104779504 CCGGGGGCCCCTCCTCCAAGGGG - Intronic
1124964724 15:34424303-34424325 CCCTGGGGCCCTCCTCAGGAGGG - Intronic
1124981340 15:34570529-34570551 CCCTGGGGCCCTCCTCAGGAGGG - Intronic
1129521664 15:76190188-76190210 CACGGTGGCCCCCCTCAGAGGGG - Intronic
1132404595 15:101534854-101534876 CCCCGGGGCCCTGATCAGAGCGG - Intergenic
1132576952 16:668586-668608 CCCGGGGGCCCGGCCCGCAGCGG + Intronic
1132871762 16:2118567-2118589 CCCGGAGGCCCCCCCCAGAGAGG + Intronic
1132889321 16:2196281-2196303 CCGGGGGCCCCTCCCCGGCGCGG - Intronic
1133119153 16:3595657-3595679 CCCGGCGGCCTTCCTCTGACTGG - Exonic
1133181079 16:4055163-4055185 CCTGGGGGCCCTTCCCGGTGTGG - Intronic
1134520765 16:14918328-14918350 CCCGGAGGCCCCCCCCAGAGAGG - Intronic
1134708437 16:16316979-16317001 CCCGGAGGCCCCCCCCAGAGAGG - Intergenic
1134715652 16:16357012-16357034 CCCGGAGGCCCCCCCCAGAGAGG - Intergenic
1134951165 16:18351666-18351688 CCCGGAGGCCCCCCCCAGAGAGG + Intergenic
1134959105 16:18395147-18395169 CCCGGAGGCCCCCCCCAGAGAGG + Intergenic
1137617089 16:49854963-49854985 CCGGGGCGCCCTCCGCGGAGGGG + Intronic
1139614416 16:68080289-68080311 CCTGAGGGCCCTCCTCTTAGAGG + Intergenic
1142262790 16:89050547-89050569 CCCTGGGGCCCTCGAGGGAGGGG + Intergenic
1142421267 16:89972117-89972139 CCCGCGCGGCCTCCTCGGAGTGG - Exonic
1143321675 17:6072428-6072450 CCTAGAGGCCCTGCTCGGAGGGG - Intronic
1148200376 17:45746331-45746353 CCCGGAGGCTCTGCTGGGAGTGG + Intergenic
1152237326 17:79145392-79145414 CCTGGGTGCCCTCCCTGGAGAGG + Intronic
1155516028 18:26624710-26624732 CCAGTGGGCACTCCTCGTAGGGG - Intronic
1156468701 18:37363999-37364021 CCCAGGGGCCCTCTGAGGAGAGG + Intronic
1160454868 18:78993032-78993054 CCCGGGGTCCCTGCTGGGTGCGG + Exonic
1160575122 18:79848841-79848863 CCCGGGGCCACTCCTCAGGGAGG - Intergenic
1160812270 19:1017954-1017976 CCCAGGGGCCCTGCTCTGAATGG - Intronic
1160832258 19:1109463-1109485 CCCGCGGGCCCTCCTCTGGGGGG + Intronic
1160998074 19:1893986-1894008 CTCGAGGGACCTCCTAGGAGTGG - Intergenic
1161019393 19:2000950-2000972 CTCTGGGGACCTCCTAGGAGTGG - Intronic
1161350015 19:3786204-3786226 CGCGGAGGCCCTCCTGGGGGCGG - Intronic
1161398305 19:4056397-4056419 CCCGGGGGCCCTCCTCGGAGGGG - Intronic
1161554733 19:4934519-4934541 CTCGGGGGACCTCCTAGGAATGG + Intronic
1162385362 19:10357727-10357749 CCCTTGGGCCCTCCCCGCAGTGG - Intronic
1162899315 19:13785216-13785238 CCCTGGGGTGCTCCTCGAAGGGG - Intergenic
1163427668 19:17248015-17248037 CCCTGGGGCCCGCCTGGGGGTGG + Intronic
1163816221 19:19466055-19466077 CCAGGGCACCCTCCTCGGAGCGG + Intronic
1166181827 19:41114234-41114256 CCTGGGGGCCCTCCTGGGATGGG - Intergenic
1166340673 19:42134917-42134939 CCCGGGGGCCCGGCGGGGAGTGG + Intronic
1166361179 19:42253674-42253696 CCCAGGGCCCCTCCTCGGTCCGG + Intronic
1168276196 19:55279996-55280018 TCCGGCGCCCCTCTTCGGAGAGG - Intronic
927520633 2:23696126-23696148 CCCGGGGGGCCTCACCTGAGAGG - Exonic
928209248 2:29311648-29311670 CCCAGGGGAGCTCCTGGGAGTGG - Intronic
928252588 2:29694901-29694923 TCTGGGAGGCCTCCTCGGAGGGG + Exonic
929595568 2:43173571-43173593 TCCTGGGGCCCTTCTCTGAGGGG - Intergenic
933764090 2:85695402-85695424 CCTGGGGGCCCTCCTGGGCCAGG - Exonic
936085774 2:109467979-109468001 CCTGGAGGACCTCCTCAGAGCGG + Intronic
936433333 2:112482520-112482542 CCCGTCTGCCCTCCTCGGAGCGG + Intronic
938310491 2:130285780-130285802 CCCGGGGTCCCTGCTCAGTGAGG + Intergenic
938444438 2:131366587-131366609 CCCGGGGTCCCTGCTCAGTGAGG - Intergenic
939178676 2:138780453-138780475 CCGCGCGCCCCTCCTCGGAGGGG + Intergenic
942444522 2:176069190-176069212 CCCAGGGCCCCTGCTGGGAGGGG - Intergenic
946422022 2:219570665-219570687 CGCCGGGGCCGTCCTCGGCGCGG + Exonic
948648583 2:239424752-239424774 CCCTCTGGCCCACCTCGGAGGGG - Intergenic
1173706638 20:45115038-45115060 CCTGGGGGCCCTCCTGGCTGTGG - Exonic
1174049365 20:47757134-47757156 CCCAGGGACCCTGCTCCGAGGGG + Intronic
1174353217 20:49982673-49982695 GCCGGGGTCCCACCTCGCAGAGG + Intergenic
1175511046 20:59526336-59526358 CGCGGGCGCCATCCTGGGAGAGG - Intergenic
1176412176 21:6455018-6455040 CCCCGGGGTGCTTCTCGGAGCGG + Intergenic
1179687670 21:43063340-43063362 CCCCGGGGTGCTTCTCGGAGCGG + Intronic
1180054652 21:45351615-45351637 CCAGGAGGCCCTCAGCGGAGCGG - Intergenic
1180699569 22:17774155-17774177 CCCGGGCGCCCTCCTCGGCGCGG - Intronic
1182299258 22:29328763-29328785 CCCGAGGGGCCTCCTCGATGGGG + Exonic
1182549047 22:31091253-31091275 CCCTGGGGCCCTCCTCCTGGGGG - Exonic
1183370146 22:37427521-37427543 CCCGGGCGCCCTCCCCGCCGAGG - Intergenic
1183427507 22:37747358-37747380 CCCAGTGGCCCTCCTGGGGGAGG + Intronic
1184419046 22:44368976-44368998 GCCGGGGGCCCTCTTGGGAGAGG + Intergenic
1185173579 22:49306901-49306923 CCCGGGGCTCCTCCTCACAGGGG - Intergenic
1185272311 22:49935145-49935167 CTCGGAGTCCCTGCTCGGAGCGG + Intergenic
952411576 3:33054376-33054398 CCACGGGGACCTCCTCAGAGAGG - Intronic
953352136 3:42223489-42223511 CCCGGGGGCCCACAGAGGAGGGG - Exonic
954660342 3:52223721-52223743 CCCGGGTGCCCTCCTTGGCCTGG - Exonic
956933230 3:74070334-74070356 CCCGGGGGCCTACTTGGGAGTGG + Intergenic
961377292 3:126475526-126475548 CGCTGGGGCCCTGCTCGGGGCGG + Exonic
961789705 3:129366639-129366661 CCCCGGGGCACTCCACGGTGGGG + Intergenic
966592140 3:181695439-181695461 GCTGAGGCCCCTCCTCGGAGCGG - Intergenic
968135996 3:196220008-196220030 CCAGCGGGCCCTCCTGGGACAGG + Intronic
968807865 4:2787073-2787095 CCTGGGAGGCCTCCTGGGAGAGG - Intergenic
968908638 4:3465810-3465832 CCCCGGGGCCCTGCCCAGAGAGG - Intronic
968945910 4:3664115-3664137 GCCCGGGGCCCTCCTGAGAGGGG - Intergenic
971351821 4:25862625-25862647 CCCCGGGGCCCCGCGCGGAGGGG + Intronic
985484280 5:140115-140137 TCCGTGGGCCCTGCTCTGAGGGG - Intergenic
997582906 5:135028426-135028448 GCCGCGTGCCCTCCGCGGAGTGG + Exonic
999297046 5:150466198-150466220 CCTTGGGGCCTTCCTCCGAGGGG + Intergenic
1001395746 5:171418985-171419007 CCCGGGAGCCCCCTTCGCAGCGG + Intergenic
1001933028 5:175686637-175686659 CCCGGGAGCCCATCCCGGAGAGG + Intergenic
1002071004 5:176678955-176678977 CCCAGTGGCCCTACTCAGAGAGG + Intergenic
1004848180 6:19668933-19668955 CCAGGGATCCCTCCTCAGAGAGG - Intergenic
1005887241 6:30106301-30106323 CGCGGGGGCCCTCTTAGGAGGGG + Intronic
1006921925 6:37633000-37633022 CCCAGGGACCCTCCTAGGATAGG - Exonic
1012933954 6:105346134-105346156 CTCTGAGGCCCTCCTCAGAGAGG + Intronic
1019032412 6:169024476-169024498 CCCGGGGACCCGCCGCCGAGTGG - Intergenic
1019492381 7:1321466-1321488 CCCAGCAGGCCTCCTCGGAGCGG - Intergenic
1019513218 7:1428855-1428877 CCCGGGGACCCTCCCGGCAGAGG - Intronic
1020067243 7:5197996-5198018 CCCGAGGCCCCTGCTGGGAGGGG + Intronic
1022108039 7:27210721-27210743 CCTGCGGGCCCGCGTCGGAGCGG + Intergenic
1022797711 7:33745363-33745385 CCCGGGAGCCAGCCTAGGAGAGG + Intergenic
1025212538 7:57028271-57028293 CCCTGGGGCCCTTCTAAGAGAGG - Intergenic
1025659417 7:63548556-63548578 CCCTGGGGCCCTTCTAAGAGAGG + Intergenic
1026360805 7:69599525-69599547 CCCCCGCGCCCTCCTCGGGGCGG + Exonic
1029297444 7:99552250-99552272 CCCTGTGCACCTCCTCGGAGCGG - Intronic
1030059819 7:105613384-105613406 CCCAGGGTCCCACCTGGGAGTGG - Intronic
1035169349 7:157009218-157009240 CCCGCGGCCCCTCCAGGGAGAGG - Intronic
1035170855 7:157016787-157016809 GCTGGGGGCCCGCCTGGGAGGGG + Intergenic
1045379349 8:101607641-101607663 CTGGGGGGCACTCCTGGGAGGGG + Intronic
1045910290 8:107399661-107399683 CCCTGGGGCATTCCTGGGAGAGG - Intronic
1049424593 8:142532448-142532470 CCTGGAGGACCTCCTGGGAGGGG + Intronic
1049435511 8:142584464-142584486 CCCTGGGGCGCCCCTCGGCGAGG + Intergenic
1049471447 8:142776724-142776746 CCCAAGTGCCCTCCTGGGAGGGG - Intronic
1049643491 8:143725980-143726002 CCCTGGTGCCCTCCTCCGCGGGG + Exonic
1049705527 8:144040397-144040419 CCAGTGGGGCCTCCGCGGAGTGG - Exonic
1051174739 9:14350083-14350105 CCCGGGGACCCTCCTGGGCCTGG + Intronic
1052378220 9:27741663-27741685 CCCGGAGGCCCTGCTTGGTGAGG + Intergenic
1053280669 9:36818262-36818284 CCCGGGGGGCCTCCTCGGCTGGG - Intergenic
1057767510 9:97934997-97935019 CCAGGGTTCCCTCCTCAGAGAGG - Intronic
1060663038 9:125415627-125415649 CCCGGAGGCCAGCCTGGGAGGGG - Intergenic
1060730531 9:126034119-126034141 CCCGAGGGCCCTCCAGGGTGGGG - Intergenic
1060932063 9:127495453-127495475 CCCTGGGGACCTCCTCCCAGAGG + Intronic
1060994335 9:127867670-127867692 CCCGGGGCCCTTCCTCGCACAGG - Exonic
1061027916 9:128062527-128062549 CCTGGAGGCCTTCCTAGGAGGGG + Exonic
1061153973 9:128846037-128846059 CCCCGGGACCCTCCGAGGAGCGG - Intronic
1061242291 9:129381712-129381734 CCCGGGCTCCCTCCTCCGGGAGG + Intergenic
1061726499 9:132584800-132584822 CCCGGGGGGCCTGCTTAGAGAGG + Intronic
1061864326 9:133484795-133484817 CCCTGGGGCCTTCCTCGGGGAGG - Intergenic
1062406844 9:136400706-136400728 CCCCGGGGCCCTCCCCTAAGTGG + Intergenic
1185478706 X:430435-430457 CTCGAGGGACCTCCTCGAAGTGG - Intergenic
1189336757 X:40175172-40175194 GGCGGGGGCTCTCCTCCGAGGGG + Intronic
1189821267 X:44872550-44872572 CCCGAGCGCCCTCCTCGCGGAGG + Intergenic
1197905170 X:131417004-131417026 CCTGGTGGCCCACCTCAGAGAGG + Intergenic