ID: 1161400319

View in Genome Browser
Species Human (GRCh38)
Location 19:4064413-4064435
Sequence CCGCGAGGGCCACCCGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161400319_1161400335 23 Left 1161400319 19:4064413-4064435 CCCATGGCGGGTGGCCCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1161400335 19:4064459-4064481 CTCAGGCCCTGGCAGCAGCAGGG 0: 1
1: 0
2: 7
3: 62
4: 447
1161400319_1161400337 28 Left 1161400319 19:4064413-4064435 CCCATGGCGGGTGGCCCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1161400337 19:4064464-4064486 GCCCTGGCAGCAGCAGGGCTGGG 0: 1
1: 0
2: 9
3: 68
4: 715
1161400319_1161400325 6 Left 1161400319 19:4064413-4064435 CCCATGGCGGGTGGCCCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1161400325 19:4064442-4064464 GCCCCCGGCCTGAAGCCCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 193
1161400319_1161400336 27 Left 1161400319 19:4064413-4064435 CCCATGGCGGGTGGCCCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1161400336 19:4064463-4064485 GGCCCTGGCAGCAGCAGGGCTGG 0: 1
1: 0
2: 14
3: 115
4: 917
1161400319_1161400334 22 Left 1161400319 19:4064413-4064435 CCCATGGCGGGTGGCCCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1161400334 19:4064458-4064480 CCTCAGGCCCTGGCAGCAGCAGG 0: 1
1: 0
2: 8
3: 72
4: 629
1161400319_1161400330 12 Left 1161400319 19:4064413-4064435 CCCATGGCGGGTGGCCCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1161400330 19:4064448-4064470 GGCCTGAAGCCCTCAGGCCCTGG 0: 1
1: 0
2: 3
3: 42
4: 377
1161400319_1161400323 -9 Left 1161400319 19:4064413-4064435 CCCATGGCGGGTGGCCCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1161400323 19:4064427-4064449 CCCTCGCGGACAAACGCCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161400319 Original CRISPR CCGCGAGGGCCACCCGCCAT GGG (reversed) Intronic
900382466 1:2391718-2391740 CCGGGAGGCCCGCCCGCCAACGG + Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
905449030 1:38045519-38045541 CGGCGCGGGCCACCCGCCCATGG - Exonic
907316356 1:53575203-53575225 CCGTGAGGGCCAGCGCCCATAGG - Intronic
914437071 1:147669952-147669974 CGGCCAGGGCCACCCGCCGCTGG + Exonic
1065967336 10:30780751-30780773 CCGCGGGGCTCACCCGCCAGAGG - Intergenic
1067274203 10:44819862-44819884 CAGCCAGGGCCACCCACTATGGG - Intergenic
1070810128 10:79293429-79293451 CCGCGGGGGCCTGCCTCCATGGG + Exonic
1073288752 10:102403094-102403116 CCACGAGGGCCTCCCGGCCTAGG - Exonic
1076895634 10:133309997-133310019 CCGCCGAGGCCACCCCCCATTGG + Intronic
1076980021 11:199310-199332 CCTCTAGGGCCACACGCCCTGGG + Intronic
1077143412 11:1034705-1034727 CCCCAAGTGCCACCCCCCATCGG - Intronic
1077331662 11:1986694-1986716 CCATGGGGGCCTCCCGCCATTGG + Intergenic
1202814643 11_KI270721v1_random:41870-41892 CCATGGGGGCCTCCCGCCATTGG + Intergenic
1094842501 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG + Intergenic
1103980881 12:124736270-124736292 CCGCCAGGGCCACCCGGGACAGG + Intergenic
1110596668 13:77327067-77327089 CCGCCGGGGCTACCCGCAATGGG + Intergenic
1118761880 14:68885127-68885149 CCTCGAGGGCTCCCTGCCATTGG - Intronic
1120856425 14:89216643-89216665 CAGCAAGGGCCACAAGCCATTGG - Intronic
1128744524 15:70104053-70104075 CAGCAAGGGCCACCCTCTATAGG - Intergenic
1141820843 16:86444442-86444464 CAGCCAGGGCCCCCGGCCATCGG - Intergenic
1148106391 17:45121083-45121105 CCGCGAGGGCCACCAGTCCGAGG - Exonic
1152149042 17:78587573-78587595 CTGCCAGGGCCACCAGCCAAGGG + Intergenic
1152318818 17:79596510-79596532 CCACCAGGGCCACCCACCGTGGG + Intergenic
1161400319 19:4064413-4064435 CCGCGAGGGCCACCCGCCATGGG - Intronic
1164581959 19:29440118-29440140 CGGCCAGCGCCACCCGCCCTGGG + Intergenic
1167220415 19:48195404-48195426 CAGCCAAGGCCCCCCGCCATCGG - Exonic
1168708029 19:58480696-58480718 CCGCAAGGGCCACCGGCCGGAGG + Exonic
927882347 2:26697634-26697656 CCGCCATGGGCACCTGCCATGGG + Intronic
944547313 2:200811518-200811540 ACCCGAGGGCCCCCCGCCCTCGG + Intronic
946235621 2:218323068-218323090 CCCCGAAGGCCACCCGGCTTGGG - Intronic
946690297 2:222304252-222304274 CCGGGAGGGCTGCCCGCCCTAGG + Exonic
1181133226 22:20746690-20746712 CCTGCAGGGCCACCCGCCCTGGG - Intronic
1183197654 22:36364531-36364553 CAGCAAGGGCCACCCACAATGGG + Intronic
1184342140 22:43891876-43891898 CCGCCCGGTCCACCCGCCATGGG - Exonic
954678946 3:52331105-52331127 CCACCAGTGCCCCCCGCCATGGG - Intronic
968911768 4:3480030-3480052 CAGAGAGGGCCACTCGCCCTGGG + Intronic
972418688 4:38867548-38867570 CCCCGAGACCCACCCGCCCTGGG + Intergenic
979530558 4:121765206-121765228 TCGCGAGGGCGTCCCGCTATGGG + Intronic
985609021 5:876249-876271 CCGCGAGGGCCAGGCGACAAGGG - Intronic
986265130 5:6184322-6184344 CTGCCAGGGCCACCTCCCATGGG - Intergenic
986733037 5:10649278-10649300 ACGCGAGGGACCCCCGCCGTGGG + Exonic
997220274 5:132156798-132156820 CCCTGAGGGGCACCCGCCAGAGG + Intergenic
998204568 5:140149529-140149551 CTGCAAGGCCCACCCACCATAGG + Intergenic
1002167554 5:177357978-177358000 CCGCGGGGGCTGCCCACCATGGG - Exonic
1002591129 5:180292157-180292179 CCGCCCGCGCCACCCTCCATCGG - Intergenic
1003342389 6:5234319-5234341 CCGTGAAGGCCACTTGCCATTGG - Intronic
1017497590 6:154995418-154995440 CCGCGAGGGCCACGCGCCGAGGG + Intronic
1018842069 6:167524487-167524509 CCGAGAGAGCCTCCCGCCAGAGG + Intergenic
1018924778 6:168198487-168198509 CCACGAGGGCCACCCGCACAGGG - Intergenic
1033779357 7:144650699-144650721 CCCCCACCGCCACCCGCCATGGG + Intronic
1037993709 8:23338428-23338450 CCCCGAGGGCCCCCCACCTTGGG - Intronic
1041109396 8:54470485-54470507 CCGCGCGCGCCGCCCGCCAAGGG - Intergenic
1049268395 8:141681582-141681604 CTGCTGGGGCCACCCGCCCTGGG - Intergenic
1056972718 9:91220962-91220984 CAGCGATTGCCACGCGCCATTGG - Exonic
1061496656 9:130978639-130978661 CAGCGAGAGCCACCGGACATGGG + Intergenic
1062295422 9:135822755-135822777 CAGCGAGGGCCCCCAGCCTTTGG - Exonic
1200209557 X:154341277-154341299 CCGTGAGGGCCACCAGCCACGGG + Intergenic
1200221319 X:154390851-154390873 CCGTGAGGGCCACCAGCCACGGG - Intronic