ID: 1161404352

View in Genome Browser
Species Human (GRCh38)
Location 19:4083302-4083324
Sequence CAGGGGAGACAGCAGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161404342_1161404352 14 Left 1161404342 19:4083265-4083287 CCCCAAATATTTGTGGGTCACGA No data
Right 1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG No data
1161404344_1161404352 12 Left 1161404344 19:4083267-4083289 CCAAATATTTGTGGGTCACGAAG No data
Right 1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG No data
1161404343_1161404352 13 Left 1161404343 19:4083266-4083288 CCCAAATATTTGTGGGTCACGAA No data
Right 1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161404352 Original CRISPR CAGGGGAGACAGCAGGATGG TGG Intergenic
No off target data available for this crispr