ID: 1161404384

View in Genome Browser
Species Human (GRCh38)
Location 19:4083454-4083476
Sequence GGGTGCAAACAGAAGGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161404379_1161404384 -3 Left 1161404379 19:4083434-4083456 CCTGGTCAGCCTATTTTGTGGGG No data
Right 1161404384 19:4083454-4083476 GGGTGCAAACAGAAGGGATGTGG No data
1161404374_1161404384 25 Left 1161404374 19:4083406-4083428 CCGCAGAGGTTGTGTGGGGAGAG No data
Right 1161404384 19:4083454-4083476 GGGTGCAAACAGAAGGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161404384 Original CRISPR GGGTGCAAACAGAAGGGATG TGG Intergenic
No off target data available for this crispr