ID: 1161405761

View in Genome Browser
Species Human (GRCh38)
Location 19:4090408-4090430
Sequence GCACCCCGGCCAGGACGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161405749_1161405761 17 Left 1161405749 19:4090368-4090390 CCTCTGAGACCACACACAGCAGC 0: 1
1: 0
2: 2
3: 31
4: 295
Right 1161405761 19:4090408-4090430 GCACCCCGGCCAGGACGGGCAGG 0: 1
1: 0
2: 0
3: 31
4: 233
1161405750_1161405761 8 Left 1161405750 19:4090377-4090399 CCACACACAGCAGCGTCGCCCGT 0: 2
1: 0
2: 0
3: 9
4: 69
Right 1161405761 19:4090408-4090430 GCACCCCGGCCAGGACGGGCAGG 0: 1
1: 0
2: 0
3: 31
4: 233
1161405753_1161405761 -10 Left 1161405753 19:4090395-4090417 CCCGTCCCCAGAGGCACCCCGGC 0: 1
1: 1
2: 5
3: 27
4: 297
Right 1161405761 19:4090408-4090430 GCACCCCGGCCAGGACGGGCAGG 0: 1
1: 0
2: 0
3: 31
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161405761 Original CRISPR GCACCCCGGCCAGGACGGGC AGG Exonic
900201283 1:1407752-1407774 GCACCCCAGCCAGGGCGACCGGG - Intergenic
902086749 1:13868704-13868726 ACTCCCTGGCCAGGAGGGGCTGG - Intergenic
902478100 1:16698634-16698656 GCACCCCAGCCAGGCTGGGATGG + Intergenic
903740150 1:25554069-25554091 GCACCCCAGTCAGGAAGGGTGGG + Intronic
903938599 1:26913502-26913524 GCACCGCAGCCAGGGAGGGCTGG + Exonic
903957814 1:27037046-27037068 TCAGCCTGGCCAGGGCGGGCAGG + Intergenic
906078397 1:43068382-43068404 GCACCCGGGCCGGGAGGGGGCGG + Intergenic
907248110 1:53120757-53120779 GCACCTGGCACAGGACGGGCTGG + Intronic
914899123 1:151702719-151702741 GCGTCCGGGCCAGGCCGGGCGGG + Exonic
915355769 1:155254656-155254678 GAACCCAGCCCAAGACGGGCAGG + Exonic
915736677 1:158089649-158089671 GCAGCCGGGCCTGGGCGGGCTGG + Intronic
916560306 1:165929259-165929281 GCACCCCAGTCAGGACTGTCTGG + Intergenic
918283094 1:183024076-183024098 GCACCCCGGCCAGCATGGTCTGG - Exonic
920292753 1:204935564-204935586 GCACCCAGCCCAGGACAGTCAGG - Intronic
1063300322 10:4844889-4844911 GCACACCGCCCGGGACTGGCAGG - Intronic
1067214906 10:44293533-44293555 GCCCCGCGGGGAGGACGGGCAGG + Intronic
1067681625 10:48445437-48445459 GCACCCAGGCCAGGCCCAGCTGG - Intergenic
1069779152 10:70943944-70943966 GCATCCCGGGCAGGACAGCCAGG - Intergenic
1069837955 10:71320897-71320919 GCACACCGGGGAGGACTGGCTGG - Intronic
1069954971 10:72044470-72044492 GCAACCATGCCAGGACGGCCTGG + Intergenic
1070257587 10:74825403-74825425 CGCCCCCGGCCAGGCCGGGCGGG + Intergenic
1070776182 10:79111216-79111238 GCACCCAGGCCAGGGCAGGGAGG + Intronic
1071817404 10:89247335-89247357 GCACTCCAGCCTGGGCGGGCAGG + Intronic
1071996324 10:91153162-91153184 GCACCTCGGACAGGACTGGTTGG - Intergenic
1073379847 10:103069754-103069776 GCAGCCCGAACAGGTCGGGCAGG + Intronic
1076319130 10:129565109-129565131 ACACCCCGGCCCCGCCGGGCAGG - Intronic
1076947824 10:133664494-133664516 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076948814 10:133667804-133667826 GCAGCCCAGCCAGGCCGCGCCGG + Exonic
1076949798 10:133671103-133671125 GCAGCCCAGCCAGGCCGCGCCGG + Intronic
1076950782 10:133674402-133674424 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076951772 10:133677712-133677734 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076952761 10:133681022-133681044 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076953745 10:133684321-133684343 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076954729 10:133740673-133740695 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076955718 10:133743983-133744005 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076956708 10:133747293-133747315 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076957695 10:133750602-133750624 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076958680 10:133753901-133753923 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076959669 10:133757211-133757233 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1076960653 10:133760510-133760532 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
1077200470 11:1304530-1304552 GCACCCGCGCCAGGACGGGGCGG + Intronic
1077514257 11:2992186-2992208 GCGGCCGGGCCCGGACGGGCGGG - Intronic
1077545092 11:3165625-3165647 GCACCCTGGCTAGGGTGGGCTGG - Intronic
1077547869 11:3183699-3183721 GCACCACGGCCGGGCCAGGCCGG + Intergenic
1082003588 11:47408177-47408199 CCACGCCGCCCAGGTCGGGCTGG - Intronic
1082175005 11:49049014-49049036 GCACCCCTGCCAGGAGCGGTTGG - Intergenic
1083611366 11:64005926-64005948 CCACTCCCGCCTGGACGGGCTGG + Intronic
1084814692 11:71639339-71639361 GCACCGCGGACACGCCGGGCCGG - Intergenic
1085423150 11:76380895-76380917 CCTCCCCGGCCCCGACGGGCGGG - Exonic
1086697757 11:89864433-89864455 GCGCCCCTGCCAGGAGCGGCTGG - Intergenic
1087083584 11:94195052-94195074 CCACCCCAGCCAGGCAGGGCAGG - Intergenic
1088883737 11:113991351-113991373 GCACCACGGCCAGCACCAGCTGG + Intergenic
1089397455 11:118145585-118145607 GCACCCACTCCAGGACGCGCAGG + Intronic
1090623000 11:128578154-128578176 GCAACCCGGCCAGGACCTGTAGG + Intronic
1091358226 11:134954653-134954675 GTAGCCAGGCCAGGACTGGCAGG - Intergenic
1092052511 12:5482247-5482269 GCACCCTGGCCAACACAGGCTGG - Intronic
1095478578 12:42610922-42610944 GCACACGGGGCAGGACTGGCAGG - Intergenic
1103510050 12:121467613-121467635 GCGCGCGGGCCAGGCCGGGCCGG - Intronic
1104602488 12:130162807-130162829 GCGCTCGGGCCAGGCCGGGCGGG + Exonic
1105557266 13:21459120-21459142 GCACCCAGCCCACGACGCGCTGG + Exonic
1105725742 13:23160427-23160449 GCGCCCCGGCCAGCACCGCCCGG + Intergenic
1106102273 13:26705475-26705497 GCACACCGGCCAGGTCATGCAGG + Intergenic
1106495247 13:30269881-30269903 CCACCCCGTCCAGGAGGGGGGGG + Intronic
1106789249 13:33137986-33138008 GCATCCAGGCCAGGAGGTGCTGG + Intronic
1108227351 13:48303513-48303535 GCACCCCGGCCTGGAGGGGGTGG + Intergenic
1112652625 13:101416066-101416088 GCGCCCCGGCCAGGCCGGCAAGG + Intronic
1113948031 13:114055808-114055830 GCACCGCAGCCAGGACAGCCTGG - Intronic
1118041433 14:61921277-61921299 ACACCCCGGGCAGGAGGGGAAGG - Intergenic
1121008751 14:90507559-90507581 GCAGTGGGGCCAGGACGGGCAGG - Intergenic
1122641892 14:103164892-103164914 GCACCCCAGCCAGGAAGGGAGGG - Intergenic
1122695563 14:103550561-103550583 ACACCCCTGCCAGGAAGGGCCGG - Intergenic
1122718232 14:103707866-103707888 GCACCCCGTCCAGGTGGAGCAGG + Intronic
1122862490 14:104588787-104588809 GCAGGACGGGCAGGACGGGCAGG + Exonic
1122906271 14:104802997-104803019 GAACCCCTGCCAGGAAGGCCTGG + Exonic
1123062654 14:105601276-105601298 GGACCCGGGCCAGGACGCGGGGG - Intergenic
1124340206 15:28885695-28885717 GCTCCCCAGCCAGCACGGCCGGG + Intronic
1124352757 15:28969906-28969928 GCTCACAGGCCAGGCCGGGCGGG + Intronic
1127864646 15:63022352-63022374 GCCCCCAGGCCAGGACAGGAGGG + Intergenic
1128325331 15:66720417-66720439 GAGCCCTGGCCAGGCCGGGCTGG + Intronic
1128456637 15:67835009-67835031 GCTCCCAGGCCAGGCCAGGCCGG - Intergenic
1129693394 15:77726346-77726368 GCACCCAGGCCAGGTAGGGCAGG - Intronic
1129778302 15:78251575-78251597 GCACCAGGGCCAGGAGAGGCCGG + Intergenic
1132027873 15:98418172-98418194 GCAGCCCGGCCAGTACCGACAGG + Intergenic
1132314232 15:100879186-100879208 GCACCCCGGCCCAGCCGGCCTGG - Intronic
1132651092 16:1021753-1021775 GGACCTGGGCCAGGAAGGGCCGG - Intergenic
1132855777 16:2043994-2044016 GCACCCAGGCCAGGCCAAGCAGG + Intronic
1132885711 16:2181139-2181161 GCACCCCGCCCAGGGAGGCCCGG - Exonic
1132931204 16:2460056-2460078 GCAGCCCGGCCGGGAAGGGGCGG + Intergenic
1132939672 16:2500556-2500578 CCACCCCGGTCAGGGAGGGCTGG - Intronic
1133736460 16:8619690-8619712 GCAGCCCTGCCAAGAAGGGCTGG + Intergenic
1136405736 16:30045869-30045891 ACACCCAGGCCAGGACAGGCTGG - Intronic
1136523710 16:30814419-30814441 GAGCCACGGCCAGGACGTGCAGG + Intergenic
1141032786 16:80604158-80604180 GCTCTCTGGCCAGGAAGGGCAGG + Exonic
1141143559 16:81513617-81513639 GCAGCCAGGCCAGAACGGACCGG - Intronic
1141184825 16:81779570-81779592 GGACCCCGGGCACGGCGGGCCGG - Intronic
1142283376 16:89160825-89160847 GCTTCCCGCCCAGGGCGGGCTGG - Intergenic
1143503821 17:7353140-7353162 GCAGCGCGTCCAGGAGGGGCCGG - Exonic
1144620345 17:16814816-16814838 GCTCCCCAGCCAGGCAGGGCTGG + Intergenic
1145094192 17:20009939-20009961 TCACCCCGGCCAGGAAGGGGCGG - Intronic
1146058811 17:29593897-29593919 CCCCTCCGGCCGGGACGGGCGGG + Intronic
1146945525 17:36870614-36870636 GCAGCCAGGCTAGGAAGGGCTGG + Intergenic
1147301945 17:39536470-39536492 GTACCCTGGCCAGGAAAGGCAGG + Intronic
1147429450 17:40362719-40362741 GCACCTGGGGCAGGCCGGGCTGG - Intronic
1147502192 17:40976276-40976298 CCACCCTGGCCAGGAGGGGCAGG + Intergenic
1147587458 17:41660598-41660620 GCAACACGGCCACGATGGGCAGG - Intergenic
1147989809 17:44325705-44325727 GCAGCCCGGGCCGGGCGGGCTGG + Intergenic
1148783193 17:50133063-50133085 GCACCCCGGCAAGGAAAGGCTGG + Intergenic
1151597608 17:75087924-75087946 GCGCCGCGGCCAGGCAGGGCGGG - Intronic
1151677455 17:75605971-75605993 GCATCCGGGGCAGGACGCGCTGG - Intergenic
1151704208 17:75758179-75758201 GCACCAGGGCCTGGGCGGGCAGG - Intronic
1151745595 17:76010111-76010133 GGACCCCGGCCTGGACAGCCAGG - Exonic
1153935201 18:9914536-9914558 GCACCGCAGCGAGGGCGGGCGGG - Intronic
1154991361 18:21600902-21600924 TCACCCCGGCCCGGACGGCTGGG + Intergenic
1155170144 18:23260972-23260994 GGACCCAGGCCAGGATGGGAAGG + Intronic
1157496657 18:48161693-48161715 GCGCCCGGGCCGGGCCGGGCCGG - Intronic
1160147818 18:76379008-76379030 GCGCCCCAGCCACGCCGGGCTGG + Exonic
1160388308 18:78511664-78511686 CCTTCCCGGCCAGGATGGGCTGG + Intergenic
1160865440 19:1253963-1253985 GCGCCCGGGCCGGGCCGGGCTGG + Intronic
1160946991 19:1648303-1648325 CCTCCCTGGCCAGGACGGGGAGG - Intronic
1161085628 19:2333645-2333667 GCGCCCAGGACAGAACGGGCTGG - Intronic
1161405761 19:4090408-4090430 GCACCCCGGCCAGGACGGGCAGG + Exonic
1161466401 19:4433062-4433084 GCAGCTGGGCCAGGACTGGCAGG - Exonic
1161680736 19:5678510-5678532 CTGCCCCGGCCAGAACGGGCAGG - Exonic
1162741243 19:12775097-12775119 CCACCCTGGCCTGGACGCGCAGG - Intronic
1165331168 19:35141745-35141767 GGAGCTCGGCCAGGAAGGGCGGG - Intronic
1166121762 19:40690886-40690908 GAGCCCAGGCCAGGACGGACCGG - Intronic
1202712121 1_KI270714v1_random:24461-24483 GCACCCCAGCCAGGCTGGGATGG + Intergenic
925253947 2:2466318-2466340 GCAGCCCAGCCAGGAAGAGCGGG + Intergenic
925742855 2:7020621-7020643 GCACCCTGGCCAGGGCTGCCCGG + Exonic
927997346 2:27495225-27495247 GCAGCCCGGCCGGGACGCGCGGG + Exonic
928233867 2:29523112-29523134 GAACCCCGGGCAGGAGGGGGAGG + Intronic
931348689 2:61470405-61470427 GCGCCCGGGCCAGGCCGAGCCGG + Intronic
931869652 2:66444693-66444715 GCTCCCGGGCCAGGGCTGGCGGG - Intronic
932396528 2:71452714-71452736 ACACCCAGGGCAGGATGGGCTGG - Intergenic
936389058 2:112055402-112055424 GAAACCCGGCCAGGACCGGGAGG - Exonic
938079854 2:128364158-128364180 ACCCCCAGGCAAGGACGGGCAGG - Intergenic
941110693 2:161416785-161416807 GTACCCCGGCCAGCACGGACCGG + Exonic
941612823 2:167682648-167682670 GCACCCCAGCCATGCTGGGCTGG - Intergenic
946338768 2:219055527-219055549 GCAGCCTGGCCAGTACGTGCTGG - Exonic
946405526 2:219490017-219490039 CCACCCCAGCCAGGACAGTCTGG - Intronic
948554244 2:238796356-238796378 GCATCCCGGCCAGGATGGCAGGG - Intergenic
948636838 2:239343690-239343712 GCTCCCTGGCCAGGGCAGGCAGG - Intronic
1169214580 20:3785853-3785875 GCCCCGCGGCCTGGTCGGGCAGG + Exonic
1170218833 20:13919723-13919745 CCACCCTGGCCAGGATGGTCTGG - Intronic
1171375933 20:24694172-24694194 ACACCATGGCCAGGAGGGGCTGG + Intergenic
1171521186 20:25775018-25775040 GCTCCCGGGCCAGGGCTGGCTGG - Exonic
1172109419 20:32536535-32536557 GCGCCCCGGCGGGGAGGGGCGGG + Intronic
1174391030 20:50218393-50218415 TCACCCAGGCCAGGTGGGGCAGG - Intergenic
1176426335 21:6550872-6550894 TCACCACTGCCAGGACGTGCAGG - Intergenic
1177905357 21:26966544-26966566 GCACCGCAGCCCGGACAGGCTGG - Intergenic
1179701826 21:43159189-43159211 TCACCACTGCCAGGACGTGCAGG - Exonic
1179730205 21:43363513-43363535 GCCCTCCGGACAGGACGCGCGGG - Intergenic
1179809151 21:43859197-43859219 GCACCCCAGCCAGTCCGAGCAGG - Intergenic
1179812773 21:43883118-43883140 GCACCCCAGCCAGGAAGGGAAGG - Intronic
1179888256 21:44323710-44323732 GCACCGAGGCCAGGGTGGGCCGG - Intronic
1179908920 21:44437872-44437894 GCGCCACGGCCAGGCCTGGCAGG - Intronic
1180109727 21:45642445-45642467 CCACCCCGGCGAGGACCCGCGGG + Intergenic
1180162297 21:46003521-46003543 GGACCCCGCCCACGACGTGCGGG + Exonic
1180950377 22:19718189-19718211 GCACGCGGGCCGGGGCGGGCCGG - Intronic
1181121614 22:20671033-20671055 GCCGCCCGGCCTGGCCGGGCAGG + Intergenic
1181493043 22:23272760-23272782 CCACCCTGGCAAGGACGGGCTGG - Intronic
1182013612 22:27020932-27020954 CGAACCCGGCCAGGACAGGCCGG + Intergenic
1183077381 22:35435668-35435690 CAACCCTGGCCAGGAGGGGCAGG + Intergenic
1183251027 22:36730445-36730467 GGGCCCCAGCCAGGAAGGGCTGG + Intergenic
1183452795 22:37906045-37906067 CCACCCCTACCAAGACGGGCCGG - Intronic
1183856082 22:40636251-40636273 GGACCCGGGCCGGGCCGGGCGGG - Intronic
1184362006 22:44024419-44024441 GCACCCTGGCCAGGAAGCGGAGG + Intronic
1184415395 22:44349222-44349244 GCTCCCTGGCCAGCACAGGCCGG + Intergenic
1184656073 22:45942603-45942625 GCACTCTGGCCAGGGAGGGCTGG + Intronic
1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG + Intronic
1185376032 22:50482923-50482945 GCACCCTGGCTGGGATGGGCAGG - Exonic
951491235 3:23272237-23272259 GCACCCAGGCCAGGGAGCGCCGG - Intronic
954404298 3:50337031-50337053 GGTCCCCGGCCAGGACCCGCGGG + Intronic
961665134 3:128489649-128489671 CCTCCGCGGCCAGGCCGGGCAGG + Intronic
961873304 3:130003196-130003218 GCACCGCGGACACGCCGGGCCGG + Intergenic
961956973 3:130814816-130814838 GCACCCCGCACGGGACTGGCAGG - Intergenic
963133277 3:141877129-141877151 GCAGCCCGGCCGGGCCGCGCTGG + Intronic
966875156 3:184317384-184317406 GCAGCTGGGCCAGGGCGGGCAGG - Exonic
966939847 3:184738999-184739021 GCACCCAGACCAGGGTGGGCTGG + Intergenic
968426407 4:526375-526397 TCACACAGGCCAGGACTGGCTGG + Intronic
968549445 4:1214641-1214663 GCACCGCGGCCCTGACAGGCTGG + Intronic
968648355 4:1750720-1750742 CCACCCCAGCCAGGACTGCCTGG - Intergenic
969737352 4:9000630-9000652 GCACCGCGGACACGCCGGGCCGG - Intergenic
969796560 4:9532218-9532240 GCACCGCGGACACGCCGGGCCGG - Intergenic
973848480 4:54937220-54937242 GCACTCCAGCCTGGACGTGCAGG + Intergenic
978282525 4:107035531-107035553 GCACCGCGGCCAGTAGGAGCAGG + Exonic
984717563 4:182939893-182939915 GCAGCACGGCCAGTGCGGGCTGG - Intergenic
985126927 4:186703710-186703732 GCACCCGGCCCAGGCCAGGCTGG - Intronic
985446105 4:190021990-190022012 GCAGCCCAGCCAGGCCGCGCCGG - Intergenic
985451277 4:190065293-190065315 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
985453252 4:190071885-190071907 GCAGCCCAGCCAGGCCGCGCCGG + Exonic
985454242 4:190075178-190075200 GCAGCCCAGCCAGGCCGCGCCGG + Exonic
985455230 4:190078471-190078493 GCAGCCCAGCCAGGCCGCGCCGG + Exonic
985456218 4:190081771-190081793 GCAGCCCAGCCAGGCCGCGCCGG + Exonic
985457202 4:190085065-190085087 GCAGCCCAGCCAGGCCGCGCCGG + Intergenic
985458189 4:190088358-190088380 GCAGCCCAGCCAGGCCGCGCCGG + Exonic
985459178 4:190091658-190091680 GCAGCCCAGCCAGGCCGCGCCGG + Exonic
985463431 4:190174427-190174449 GCAGCCCAGCCAGGCCGCGCCGG + Exonic
985521425 5:375676-375698 GCACCCCAGCAAGGCCGGGGGGG - Intronic
991085921 5:62648352-62648374 GCACCCTGGCCGGGAGGGGATGG + Intergenic
992379057 5:76219106-76219128 GCAGCCCAGCCAGGACAGGCAGG + Intronic
999307289 5:150527947-150527969 GCTCCCCGGCGAGGACTGGACGG + Exonic
1003107622 6:3227985-3228007 CCACCCCGGTCAGGACGCGCTGG - Intronic
1006832202 6:36975814-36975836 CCATCCCTGCCAGGACTGGCTGG - Intronic
1012401206 6:98843874-98843896 GCCCCGCGGCCAGCCCGGGCGGG + Intergenic
1013273208 6:108560894-108560916 GCCCCCCGGCCAGGCCGCGATGG - Exonic
1015813701 6:137186291-137186313 GCACCCCAGCCAGGAGGGAAGGG + Intergenic
1015843381 6:137495434-137495456 GCACCCCGGCCTGCGCGGGTGGG + Intergenic
1017825210 6:158076720-158076742 GCACCCCCGCCTGGACAGACAGG + Exonic
1019348559 7:542525-542547 GCACGCCAGCCAGCCCGGGCAGG + Intergenic
1019614159 7:1951365-1951387 ACACCCCGGACGGGAGGGGCAGG - Intronic
1022375378 7:29806903-29806925 CCGCCCCGGCCGGGCCGGGCCGG + Intronic
1022507487 7:30915917-30915939 CCTCCCTGGGCAGGACGGGCTGG - Intronic
1022905453 7:34850905-34850927 GCACCTCGGCCAGGAAGTGCTGG + Intronic
1024042961 7:45569054-45569076 GTAGCCTGGCCAGGCCGGGCAGG + Intergenic
1027173495 7:75889027-75889049 GCACCAGGGCCAGGTCAGGCAGG + Intergenic
1028392746 7:90334800-90334822 GCACACGGGGCAGGACTGGCAGG + Intergenic
1029374860 7:100171480-100171502 GGACCGCGGCCGGGAGGGGCGGG - Intronic
1032001054 7:128265523-128265545 GCATCCAGGCCAGGTTGGGCAGG - Intergenic
1034122946 7:148643976-148643998 GGACCCAGGCCAGGACTGGCAGG - Intergenic
1034417312 7:150971932-150971954 GCACCCCGGGCAGCAGGTGCTGG - Intronic
1034424540 7:151007596-151007618 GGACCCCACCCAGGATGGGCAGG + Intronic
1034548929 7:151808065-151808087 GAACCCCGGCCACAGCGGGCGGG + Intronic
1034944715 7:155254376-155254398 GAACCCAGGCCAGGGCGGGCAGG - Intergenic
1035165178 7:156985274-156985296 GCTCCTCGGCCACGACTGGCCGG - Intergenic
1037994022 8:23339898-23339920 CCACCCCGTCCAGGCAGGGCTGG + Intronic
1043303359 8:78762490-78762512 CCTCCCCGGCCCCGACGGGCGGG - Intronic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1044862090 8:96533820-96533842 GCACACCGAGCAGGACTGGCAGG - Intronic
1044929867 8:97241611-97241633 GCACCCCGGCCATGCCCCGCAGG + Intergenic
1049029465 8:140023623-140023645 GCAGCCAGGCCAGGCTGGGCGGG + Intronic
1049365167 8:142233539-142233561 GCAACGGGGCCAGGAGGGGCCGG + Intronic
1049585060 8:143429216-143429238 GCACCGGGGCCAGCACGGCCGGG + Exonic
1049589782 8:143452187-143452209 CCACCCCGGCAAGGAAGGGAAGG - Intronic
1049685930 8:143939308-143939330 GCACCCCCGCCAGGCAGGGCGGG - Intronic
1058904136 9:109467738-109467760 GCACCCACGCCAGCACGAGCAGG - Intronic
1059208347 9:112487032-112487054 GCAGCCCGGGCTGGACGGGACGG - Exonic
1059433455 9:114263377-114263399 GCTCCCGGGCCAGGATGGGCTGG + Intronic
1059891388 9:118809233-118809255 GCGCACCGCCCAGGACTGGCCGG - Intergenic
1061418323 9:130460121-130460143 GCACCCTGACCAGCCCGGGCAGG - Intronic
1061486966 9:130924902-130924924 GCACAGCGGCAAGGACCGGCCGG + Intronic
1061861146 9:133469347-133469369 GCACCAAGGCCAGCAGGGGCGGG - Exonic
1062301877 9:135878177-135878199 GGACCCCGGCCAGGAGGAGACGG + Intronic
1062499345 9:136845604-136845626 GCAGCCCGGCCTGGGCGGACTGG + Exonic
1062504642 9:136866618-136866640 GCACCCCGGCCGGGCCACGCGGG + Intronic
1062530269 9:136996609-136996631 GCCCCTCGGCCAGGGAGGGCGGG - Exonic
1062601385 9:137320071-137320093 GCTCCCAGGCCGGGGCGGGCAGG + Intronic
1062621171 9:137423203-137423225 GCACCAAGGCCAGCGCGGGCGGG + Exonic
1185735147 X:2490389-2490411 GCAGCCCGGGCAGGACGCGCTGG - Exonic
1189261525 X:39682364-39682386 TCACCCCGCCCAGGAAGTGCTGG + Intergenic
1190384152 X:49868302-49868324 GCACACAGGCCAAGAGGGGCAGG + Intergenic
1192193982 X:69016537-69016559 GCAGCCAGGCCAGGCTGGGCCGG + Intergenic
1192549905 X:72045464-72045486 CCACCCCTGCCACGAGGGGCTGG - Intergenic
1197753475 X:129980630-129980652 GCACCCAGGCAAGGGCGGGGTGG + Intergenic
1200683917 Y:6244092-6244114 GGACCCCGGCCAAGACGGCCTGG + Intergenic
1200686538 Y:6264409-6264431 GGACACCGGCCAAGACGGCCTGG + Intergenic
1200989410 Y:9335325-9335347 GGACCCCGGCCAAGACGGCCTGG + Intergenic
1200992083 Y:9355658-9355680 GGACCCCGGCCAAGACGGCCTGG + Intergenic
1200994736 Y:9375936-9375958 GGACCCCGGCCAAGACGGCCTGG + Intronic
1200997399 Y:9396282-9396304 GGACCCCGGCCAAGACGGCCTGG + Intergenic
1201002572 Y:9485128-9485150 GGACCCCGGCCAAGACGGCCTGG + Intronic
1201005228 Y:9505412-9505434 GGACCCCGGCCAAGACGGCCTGG + Intergenic
1201007889 Y:9525741-9525763 GGACCCCGGCCAAGACGGCCTGG + Intergenic
1201010506 Y:9545932-9545954 GGACCCTGGCCAAGACGGCCTGG + Intergenic
1201048718 Y:9910294-9910316 GGACCCCGGCCAAGACGGCCTGG - Intergenic