ID: 1161408001

View in Genome Browser
Species Human (GRCh38)
Location 19:4101193-4101215
Sequence CGCCCTCCCCAGAGCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161408001_1161408014 22 Left 1161408001 19:4101193-4101215 CCCCCGGGGCTCTGGGGAGGGCG 0: 1
1: 1
2: 5
3: 38
4: 310
Right 1161408014 19:4101238-4101260 TGATCTGGTGCTTCTCTCGGAGG 0: 2
1: 0
2: 1
3: 6
4: 76
1161408001_1161408011 7 Left 1161408001 19:4101193-4101215 CCCCCGGGGCTCTGGGGAGGGCG 0: 1
1: 1
2: 5
3: 38
4: 310
Right 1161408011 19:4101223-4101245 CCTTACCTCGGTGCATGATCTGG 0: 1
1: 0
2: 0
3: 4
4: 44
1161408001_1161408009 -5 Left 1161408001 19:4101193-4101215 CCCCCGGGGCTCTGGGGAGGGCG 0: 1
1: 1
2: 5
3: 38
4: 310
Right 1161408009 19:4101211-4101233 GGGCGGGCTGGGCCTTACCTCGG 0: 1
1: 0
2: 1
3: 23
4: 164
1161408001_1161408013 19 Left 1161408001 19:4101193-4101215 CCCCCGGGGCTCTGGGGAGGGCG 0: 1
1: 1
2: 5
3: 38
4: 310
Right 1161408013 19:4101235-4101257 GCATGATCTGGTGCTTCTCTCGG 0: 2
1: 0
2: 0
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161408001 Original CRISPR CGCCCTCCCCAGAGCCCCGG GGG (reversed) Intronic
900226636 1:1536192-1536214 CGCCCGCCCCGGGGCCGCGGAGG + Intronic
900292358 1:1928925-1928947 CCACCTCCCCGGAGCCCCTGCGG + Intronic
901513441 1:9729883-9729905 CTCCCTCCCCAGACCCCAGAGGG - Exonic
901868173 1:12121416-12121438 CTCCACCCCCAGAGCCCTGGTGG - Intronic
902401524 1:16160239-16160261 GGCCCCCCCTAGAGCCCCAGGGG + Intergenic
903774751 1:25785615-25785637 CACCTGGCCCAGAGCCCCGGGGG - Exonic
903810193 1:26031050-26031072 CACCCTCCCCAGAGCCTGGAAGG + Intronic
904306378 1:29592794-29592816 AGCCCTTTCCAGAGCCCCTGTGG - Intergenic
904504032 1:30936103-30936125 CACCCTTCCCAGAGTCCCTGAGG - Intronic
904505496 1:30949532-30949554 CACCCTTCCCAGAGTCCCTGAGG - Intronic
904526391 1:31136943-31136965 CACAATCCCCAGAGCCCCAGAGG - Intergenic
905846836 1:41241399-41241421 CGCCTGCCCCAGTGCCCCGCCGG - Intronic
906798758 1:48718289-48718311 TGCCCTCCACAGGGCCCAGGAGG - Intronic
907515533 1:54991086-54991108 CGGCCCCCTCAGAGCCCTGGCGG - Intronic
912492673 1:110070633-110070655 CGCGAGCCCCGGAGCCCCGGAGG - Exonic
913660650 1:121003628-121003650 CTCCCTCCCCAGTGACCCAGAGG - Intergenic
918143493 1:181736982-181737004 CTCCCTTCCCAGAGCCCTGCTGG - Intronic
918339042 1:183552137-183552159 CTCCCTCCGGAGGGCCCCGGGGG - Intronic
918348996 1:183635182-183635204 CGCCTTCCCCAGCGCCGCGAGGG + Intronic
920376911 1:205513735-205513757 CCCCTTCCCCACAGCCCTGGAGG + Intronic
920380756 1:205533285-205533307 CTCCCTCCCCAGAAGCCAGGGGG - Intergenic
920692728 1:208159157-208159179 AGCCCTCCCCAGAGCCTCTAGGG - Intronic
923318589 1:232805826-232805848 CGCCCACCCCACAGCTCCTGGGG + Exonic
923673957 1:236064722-236064744 CGCCGTGCCCGGTGCCCCGGCGG + Intronic
924623200 1:245679982-245680004 CCCCCTCCCCAGAGCCAGGCGGG - Intronic
1062848441 10:725715-725737 AGCCCTGCCCAGAGCCCAGCAGG + Intergenic
1064310515 10:14208345-14208367 AGCCCTCCCCAGAGACCTGGGGG - Intronic
1064552950 10:16521066-16521088 CACCACCCCCAGCGCCCCGGCGG + Exonic
1067285262 10:44903194-44903216 AGTCCTCCCCAGAGACCCAGGGG - Intergenic
1074526906 10:114270622-114270644 TGCCCTCCCAGGAGCCCTGGAGG + Intronic
1075788317 10:125065461-125065483 CGCCTTCCCCAAAGCCCCTGCGG - Intronic
1075800304 10:125149584-125149606 CGGCCCCACCAGAGCCCCAGCGG + Intronic
1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG + Intronic
1076512555 10:131022816-131022838 CACCCTTCCCTGAGTCCCGGAGG - Intergenic
1076876400 10:133218332-133218354 CGCCAGCCACAGAGCCCCGGAGG + Intronic
1077146799 11:1050123-1050145 GACCCTCCCCAGATCCCTGGGGG + Intergenic
1077323545 11:1953414-1953436 CTTCCTCCCCAGAGCCCCCCAGG - Intronic
1077329337 11:1977083-1977105 GGCCCACCCCAGGGCCCAGGAGG - Intronic
1077635989 11:3841355-3841377 GCCCCTGCCCTGAGCCCCGGGGG + Intergenic
1079353433 11:19712534-19712556 CGTCCGCCCCAGAGCCACGCGGG - Intronic
1080844583 11:36015616-36015638 TGCCAACCCCAGAGCCCCGGTGG + Intronic
1081711556 11:45219784-45219806 CGCCCACCTCTGAGCCCCAGGGG + Intronic
1081773881 11:45665143-45665165 CGCCCGCCCCGGAGCCCGCGGGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1081967478 11:47178415-47178437 TGCCCTCACCCGAACCCCGGTGG + Exonic
1083428587 11:62602163-62602185 CCCACCCCACAGAGCCCCGGAGG + Intergenic
1083722279 11:64609257-64609279 CCCCCTCCCCAGAACCCCCATGG + Intronic
1083890203 11:65592191-65592213 CGTTCTCCCCAGCGCCCTGGAGG + Exonic
1084070172 11:66728473-66728495 GGCCCCGCCCAGAGCCCCGCGGG - Intronic
1084412652 11:69013378-69013400 AGCCCCCCCCAGAGCCCCACCGG + Exonic
1084432987 11:69121890-69121912 GGGCCTCCCCAGAGTCCCTGGGG - Intergenic
1084786932 11:71448108-71448130 CCGCCTCCCCGGAGCCCCAGCGG + Intronic
1089453132 11:118610541-118610563 GGCGCTCCCCGGAGCCCCGCGGG - Intronic
1091223737 11:133945824-133945846 AGCCCTCTCCACAGCCCAGGCGG + Intronic
1202806532 11_KI270721v1_random:8609-8631 CTTCCTCCCCAGAGCCCCCCAGG - Intergenic
1202812316 11_KI270721v1_random:32262-32284 GGCCCACCCCAGGGCCCAGGAGG - Intergenic
1091390113 12:121046-121068 GGCCCTTCCCAGAGCACTGGAGG - Intronic
1091699529 12:2650796-2650818 CCCCTTCCCCAGGGCCCCTGAGG + Intronic
1091853682 12:3721841-3721863 TCCCCTCCCCACAGCCCTGGGGG - Intronic
1092246644 12:6867744-6867766 CGCCCTCTCCCGAGGCCCCGAGG + Intronic
1092253563 12:6914670-6914692 CGCCAGGCCCAGAGCCCCTGTGG + Intronic
1096781658 12:53995568-53995590 TGCCCTGCCCGGAGCCCCAGTGG - Intronic
1097794096 12:63844128-63844150 CGCCCTGGGCACAGCCCCGGCGG - Intergenic
1098161099 12:67648840-67648862 CGCCCTCCCCTGCGCGCCGCGGG - Exonic
1100391725 12:94150044-94150066 CGCTCTCCGCGGCGCCCCGGGGG - Intronic
1101716685 12:107318607-107318629 CGCTCTTCCCTGAGCCCCGCTGG - Exonic
1102519804 12:113471254-113471276 CCCCTTCCCCAGCGCCCCAGTGG + Intronic
1103730307 12:123022924-123022946 CTCCCTCCCCAGAGCCCCGCTGG + Intronic
1103764091 12:123269671-123269693 CCCCCGCCCCAGAGCCCCCCAGG - Intronic
1103855966 12:123972130-123972152 CGCCCACCCCAGTGCCAAGGGGG - Intronic
1104348989 12:128028652-128028674 CGCCCTGCCCACAGCCCCTGAGG - Intergenic
1104963264 12:132498084-132498106 CACCCTCCCCAGAGGCCCTGTGG - Intronic
1105024888 12:132841361-132841383 GACCCTCCCCAGAGCCCCGGGGG - Exonic
1105239187 13:18595380-18595402 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
1106243362 13:27927242-27927264 GCCCCACCCCAGAGCCCAGGCGG - Intergenic
1106776679 13:33016334-33016356 CGCCCACCCCCGCTCCCCGGCGG - Intergenic
1108292384 13:48975189-48975211 CCCCCTCCCCAGGTCTCCGGCGG + Intergenic
1113738874 13:112697209-112697231 TGCCTTCCCCAGGGCCACGGTGG + Intronic
1113892045 13:113741341-113741363 GGCCCTCCCCAGAGGCCAGCTGG - Intergenic
1113933652 13:113981848-113981870 CGCCCTCCACAGAGGCCTGTGGG - Exonic
1114248214 14:20934382-20934404 CGCCCCGCCCAGAGCCTCAGTGG - Intergenic
1114499579 14:23158332-23158354 TGTCCTCCCTAGAGCCCCGAGGG - Intronic
1115850052 14:37583958-37583980 CGCGCCCCCCCGAGCCCAGGGGG + Intergenic
1116326820 14:43540818-43540840 CGGCTGCCCCAGAGCCCCTGAGG - Intergenic
1119176107 14:72568640-72568662 CGCCCTCCCCAGACCCCACATGG + Intergenic
1119327434 14:73769177-73769199 CTCCCTCCCCAGAGTCACTGAGG + Intronic
1121104681 14:91272664-91272686 CGGCCTCCCCGGAGCCCGGCGGG - Exonic
1121431282 14:93890157-93890179 CATCCTCCCCAAAGCCCCAGGGG - Intergenic
1122238831 14:100348437-100348459 CGCCCTCTCCAGTGCCCCCCAGG - Intronic
1122695994 14:103552381-103552403 TGGCCACCCCAGAGCCCCGGTGG + Intergenic
1122858347 14:104570902-104570924 CCCTCTCCCCACAGGCCCGGAGG + Intronic
1122858941 14:104573681-104573703 TGCCCTCCCCAGTGGGCCGGAGG + Intronic
1123059190 14:105586779-105586801 CCCCCTGCCCTGAGCCTCGGGGG - Intergenic
1123115859 14:105893742-105893764 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123117884 14:105902852-105902874 GGCCTGCCCCAGAGCCCAGGAGG - Intergenic
1123120101 14:105912457-105912479 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123402839 15:20004043-20004065 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123492063 15:20788704-20788726 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1123512176 15:21010697-21010719 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123548567 15:21357794-21357816 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1124098569 15:26671787-26671809 TCCCCTCCCCAGTGCCACGGGGG + Intronic
1124142312 15:27088330-27088352 GGGCTTCCCCAGAGCCCTGGAGG - Intronic
1126099750 15:45111999-45112021 CGCCCTCCCCACGGCCAGGGCGG + Intronic
1129694826 15:77734693-77734715 CACACTCCCCAGGGCCCCAGCGG + Intronic
1202956901 15_KI270727v1_random:85025-85047 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1132670848 16:1101801-1101823 CGCCCTCGACACAGCCCCAGGGG - Intergenic
1132763008 16:1520087-1520109 AGCCCTCCCCGGGGCCCCGCTGG + Intronic
1132810475 16:1794454-1794476 GGCCCTCACCAGAGCCTTGGGGG - Intronic
1132983899 16:2753369-2753391 GGCCCTCCCCGCAGCGCCGGGGG - Intronic
1134884909 16:17781909-17781931 AGCTCTCCCCAGAGCTCAGGTGG + Intergenic
1135057333 16:19241718-19241740 CGCCCTCCCCACAGCTACGGCGG + Intronic
1135323476 16:21511977-21511999 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1136146014 16:28317207-28317229 CGCCTTCCCCAAAGCCTCAGGGG - Intronic
1136334964 16:29605242-29605264 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1136365287 16:29806660-29806682 CGGCCCCCGCTGAGCCCCGGGGG + Exonic
1136579555 16:31143240-31143262 CGCCCCCCCCACACCCCCTGGGG + Intronic
1138096285 16:54214437-54214459 CGCCCATCCCAGAGCCCACGGGG - Intergenic
1141083867 16:81077385-81077407 CGCCGACCCGAGAGCCCGGGTGG - Intergenic
1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG + Intergenic
1141699797 16:85637178-85637200 CGCCCTCCCCCAGCCCCCGGCGG + Intronic
1142035678 16:87861061-87861083 CACGCTCCCCAGAGGCCCTGTGG - Intronic
1142177388 16:88651396-88651418 CGGCCTCTCCAGAGCCTTGGGGG + Intergenic
1142409777 16:89910118-89910140 CGCCCTCCCTAGAGCTCCTGAGG + Intronic
1142766119 17:2065230-2065252 GGCCCTGCCCAGGGCCCCCGAGG - Intronic
1142812196 17:2400599-2400621 CCCCTTCCCCAGTGCCCCAGGGG + Intronic
1143018544 17:3904469-3904491 CGCTCTCCCTAGGGCCCTGGGGG - Intronic
1143447643 17:7018617-7018639 CCCACTCCCCAGGGCCCCTGAGG + Intergenic
1143749839 17:9020708-9020730 AGCCCTCCCCAGATCCCCTGAGG - Intergenic
1144132423 17:12259778-12259800 CTGCCTTCCCAGAGCCCAGGAGG - Intergenic
1144639129 17:16927908-16927930 TGCCCACCCCAAATCCCCGGGGG - Intergenic
1145817909 17:27808801-27808823 GGCCCTCCCGGGAGCCCCTGGGG - Intronic
1146703302 17:34980778-34980800 GGCCCTCCCGGGAGCCCAGGGGG + Intronic
1147590001 17:41676586-41676608 TTCCCTCCCCAGAGGCCAGGAGG - Intergenic
1147917653 17:43898330-43898352 ATCCCTCCCCAGTGCCACGGGGG - Exonic
1147971333 17:44220172-44220194 CGACCTCGCCAGACCCGCGGGGG + Intronic
1148386586 17:47238620-47238642 CACCCTCCCCGCAGCCGCGGTGG + Intergenic
1150226547 17:63527654-63527676 TGCCCTCACCAGGGCCCTGGAGG - Intronic
1151188877 17:72383180-72383202 CGCCCTCCCCAGAGGTCAGGAGG - Intergenic
1152103166 17:78314443-78314465 CGCCCTGCCCAGGGCGCAGGTGG + Intergenic
1152257393 17:79248130-79248152 CTCCCTCTCCTGTGCCCCGGAGG - Intronic
1152352133 17:79789988-79790010 CGCCCACCCCTTACCCCCGGGGG - Intergenic
1152504361 17:80737964-80737986 GGCCATCCCCAAAGCCCCGCTGG + Intronic
1152566713 17:81103615-81103637 CACCCTCCCCAGCGCCCTGTCGG + Exonic
1152628377 17:81398776-81398798 CCGGCTCCTCAGAGCCCCGGAGG - Intronic
1152729132 17:81961268-81961290 CCCCCTCCGCCGAGCCCGGGCGG - Exonic
1153801845 18:8678076-8678098 CTGCCTCCACAGAGCCCCCGTGG - Intergenic
1154449605 18:14463260-14463282 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1157520528 18:48342279-48342301 CCCCCTGCCCAGAGCCCAAGTGG + Intronic
1159882802 18:73875428-73875450 CTCCCTCCGCAGGGCCACGGTGG + Intergenic
1159885534 18:73900621-73900643 GGCCCTACCCTGAGCCCCAGGGG - Intergenic
1160242621 18:77133795-77133817 AGCCTCCCCCAAAGCCCCGGAGG + Intergenic
1160631271 18:80247600-80247622 GCCCCGCCCCCGAGCCCCGGAGG + Intergenic
1160853723 19:1206569-1206591 CGGCCTCCCCAGGGTCCCCGAGG + Exonic
1161072693 19:2270509-2270531 CGCCACCCCCAGCTCCCCGGCGG - Intronic
1161076575 19:2288659-2288681 CGTCCTCCCCACAGCCCAGCAGG - Intronic
1161400751 19:4065572-4065594 CGCCCTCCCCCCAGCCCGGGTGG - Intronic
1161408001 19:4101193-4101215 CGCCCTCCCCAGAGCCCCGGGGG - Intronic
1161563113 19:4984667-4984689 AGCCCTCCCGAGGGCCCCAGCGG - Intronic
1161590077 19:5125559-5125581 CTCCCTCCCGAGATCCCCGGGGG + Intronic
1161597352 19:5157406-5157428 CCCCCTCCCAAGAGTCCAGGGGG + Intergenic
1162059697 19:8087083-8087105 AGCCCTCCCCAGAGCCAGGCAGG + Exonic
1162572017 19:11479637-11479659 CCCCGCCCCCAGGGCCCCGGGGG - Intronic
1162725988 19:12689936-12689958 GGCCCTCCCCAGGGGCCTGGAGG - Intronic
1163144323 19:15370332-15370354 GGCCCTGTCCTGAGCCCCGGAGG - Intronic
1163397218 19:17070676-17070698 CCTCCTCCCTAGAGCCCCAGGGG + Intronic
1163548106 19:17951071-17951093 CCCCCTCCCCAGCCCCCCGGCGG - Intergenic
1163713108 19:18858654-18858676 CAGCGTCCCCAGAGCCCAGGAGG + Intronic
1163758333 19:19120094-19120116 CGTCCTCCCCAGAGCCGATGGGG + Exonic
1163806885 19:19405233-19405255 CGCCCTCCCCACAGACACCGGGG + Intronic
1165064456 19:33220954-33220976 CGCCCTGCCCTGAGCCACCGTGG + Intronic
1165382433 19:35490567-35490589 TCCCCCTCCCAGAGCCCCGGGGG - Intronic
1165685601 19:37817327-37817349 CGCCCACCGCCGAGTCCCGGAGG - Intergenic
1165940769 19:39413698-39413720 CGCCCTCCCCTGGGACCCCGCGG + Intronic
1166079329 19:40433989-40434011 CTCCCTCCCCAGAGGCCGGACGG - Intergenic
1166354248 19:42217561-42217583 CCCGCTCCCCAGAGCCCAGGTGG + Intronic
1166976749 19:46609424-46609446 AGCCCTCCCCAGATCCCCTTGGG + Exonic
1167079703 19:47270718-47270740 CGCCCTGCGGAGAGCCCTGGGGG - Intronic
1167617401 19:50543015-50543037 CGCCCTCCCGTGAGCTCTGGGGG - Intronic
1168239271 19:55081219-55081241 CGCCCTCCGCAGGGCCACGCAGG + Exonic
1168293814 19:55369504-55369526 CGCCCTCCCAGGAGCCCCGCCGG + Intronic
925148233 2:1595119-1595141 GGCCCTGCACAGAACCCCGGGGG - Intergenic
925355347 2:3237113-3237135 CGCCCTCCCCATCTCCCAGGTGG - Intronic
925863399 2:8202156-8202178 CCCCCTCCCCAAATCCCTGGAGG - Intergenic
926075603 2:9940692-9940714 CTCCGGCCCCAGAGCCCCCGGGG + Intergenic
926095705 2:10079870-10079892 CGCCGTCCCCCGAGGCCCTGCGG + Intronic
927413788 2:22855857-22855879 GGCCTTCCCCACAGCCTCGGGGG - Intergenic
928025500 2:27735773-27735795 CGCCTTCCCGAGAGCCCCGCCGG - Intergenic
931321454 2:61177638-61177660 GGCCCTCCCCAGATCCCGGAAGG - Exonic
932776177 2:74529685-74529707 CGCCTTCCCAAGAGCCCCTGCGG - Exonic
932873187 2:75424448-75424470 TCCCCTCCCCACAGCCCCTGGGG - Intergenic
934846473 2:97664030-97664052 CGCCCTCCAGAAAGCCCCGCGGG - Exonic
936410669 2:112255139-112255161 CGGCCTGCCCAGAGTCGCGGAGG - Intergenic
937915815 2:127098228-127098250 CCCCATCCTCAGAGCCCCTGGGG - Intronic
938481834 2:131669487-131669509 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
939243978 2:139599216-139599238 CGCCCTCACCAGAACCATGGTGG - Intergenic
940316805 2:152335468-152335490 CGCCCTCCGCCGCGCCCAGGCGG - Exonic
940971856 2:159904379-159904401 CGCCCTCCTCCGGGCCCCCGAGG + Intronic
942558732 2:177198590-177198612 CGGCTGCCCCAGAGCCCGGGAGG + Intergenic
946023521 2:216657823-216657845 CAGGCTCCCCAGAGCCCCTGTGG + Intronic
947586238 2:231358609-231358631 CGCCCCACCCAGAGACCCCGTGG + Intronic
947758563 2:232587150-232587172 GGCCATTCCCAGAGCCCCAGGGG - Intergenic
948207154 2:236168320-236168342 CGCGCTCCCCAGCGGCCCGCGGG - Exonic
948566123 2:238887587-238887609 CACACTCCTCAGAGCCCCTGTGG + Intronic
948606598 2:239139686-239139708 CGCCGTCCCCAGCATCCCGGCGG - Exonic
948906876 2:240983870-240983892 CACACACCCCAGAGCCCCAGAGG + Intronic
1169116857 20:3071795-3071817 CTCCCTCCCCGGAGCGCCGCGGG - Intronic
1169130875 20:3165913-3165935 CGCCCTCCCCAGAGCCCAGGTGG + Exonic
1170548272 20:17453730-17453752 TGCTCTCCCCAGGGCCGCGGCGG + Exonic
1171245405 20:23606449-23606471 CCCCCTCCCGAGACCCTCGGGGG - Intergenic
1172186710 20:33035514-33035536 GGCCATCCCAAGAGCCCTGGTGG - Intronic
1173664001 20:44752606-44752628 GGCCCTCACAAGAGCCCCTGGGG - Intronic
1173665011 20:44757143-44757165 CGTCCTCCCCAGACCCCATGGGG - Intronic
1173860982 20:46283423-46283445 CATCCTCACCATAGCCCCGGGGG - Intronic
1173870341 20:46337853-46337875 CTCCTTCCCCAGAGCCCCGTGGG + Intergenic
1174046765 20:47739317-47739339 GGCCTTCCCCAGATCCCAGGAGG - Intronic
1174898638 20:54475882-54475904 CACCCTCCCCAGAGCCACTTCGG + Exonic
1175424556 20:58855368-58855390 CCCCCTCCCCGGTTCCCCGGCGG - Intronic
1175429257 20:58890961-58890983 CGCCCACCCCAGCCCCTCGGCGG + Intronic
1175739760 20:61412407-61412429 CCTCCTCCCCAGAGTGCCGGAGG + Intronic
1175760676 20:61560629-61560651 AGCCCTCGCCAGGGCCCCGCGGG - Intronic
1175892571 20:62322093-62322115 CGCTCCCCGCTGAGCCCCGGGGG + Exonic
1175937944 20:62523537-62523559 GGCCCTCCCCAGAGCCCTCCTGG + Intergenic
1175940236 20:62534429-62534451 TGCCCTTCCCACAGCCCCCGGGG + Intergenic
1175964572 20:62654110-62654132 GACCCTCCTCAGAGCCCCAGGGG - Intronic
1175997187 20:62817129-62817151 CGCGCTCACCTGCGCCCCGGCGG - Exonic
1176053705 20:63134040-63134062 CGGCATCCCCAGAGCCCAGCGGG + Intergenic
1176130609 20:63495217-63495239 CTCCCTCCCCAAGGCCCCAGTGG - Intronic
1177176112 21:17702304-17702326 CTCCCTCCCCAGAGGTCAGGAGG + Intergenic
1178349999 21:31866113-31866135 AGCCCTGCCCAGGGCCACGGAGG + Intergenic
1178473623 21:32917486-32917508 CCCCCTGCTCAGAGCCCAGGAGG + Intergenic
1178924365 21:36762480-36762502 CACCCTCCCCAGACCCAAGGCGG - Intronic
1179893703 21:44350284-44350306 CGCCCTCGCCCCGGCCCCGGCGG - Intronic
1179908709 21:44436994-44437016 CACCCTCCCCTGCGCCGCGGCGG - Intronic
1179950803 21:44707918-44707940 CACCCTTCCCGGAGCCCTGGGGG + Intronic
1179953215 21:44723525-44723547 AGCCGTCCCCAGGGCCCCGGGGG + Intergenic
1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG + Intronic
1181017707 22:20080564-20080586 GGCCCGCCCCCCAGCCCCGGAGG - Intronic
1181107803 22:20585089-20585111 CCGCCTCCCCAGGGCCCCAGTGG + Exonic
1182472411 22:30556621-30556643 CGCCCCCACCAGGGCCCCGTTGG + Intronic
1183230383 22:36578445-36578467 AGGTCTCCCCAGAGCCCCAGTGG - Intronic
1183427408 22:37746935-37746957 CGCCCCACCCACAGCCCGGGAGG + Intronic
1183483555 22:38077644-38077666 CACCCTCCCCAGGACCCCAGGGG + Intergenic
1183720192 22:39557903-39557925 CGCCGCCCCCCGCGCCCCGGGGG + Intergenic
1184265256 22:43342992-43343014 CCCCCTCCCCGCAGCCCGGGCGG - Intronic
1184309325 22:43631092-43631114 TGCCCTCCCCACAGCCCCCCAGG + Intronic
1184889619 22:47371830-47371852 CGCCCTCCCCACAGTCGGGGGGG + Intergenic
1185058950 22:48595537-48595559 TGGCCTCCACAGAGCCCCAGTGG - Intronic
1185105847 22:48869358-48869380 CTCCCTCCCCAGGGCCCCGCAGG - Intergenic
1185149149 22:49154245-49154267 CACCCTCCCCAGGCCCCCTGGGG - Intergenic
1185338273 22:50280423-50280445 CACCAGCCCCAGAGCCCCTGCGG + Intronic
949610402 3:5698264-5698286 TTCCCACCCAAGAGCCCCGGTGG - Intergenic
950027886 3:9833226-9833248 TGCCTTCCCCAGAGCCTCGCTGG - Exonic
950479822 3:13237326-13237348 GGCCCTGTCCAGAGCCTCGGAGG - Intergenic
954128840 3:48549453-48549475 CGCTCACCCCAGCGCCCCGTGGG - Intronic
954177829 3:48858457-48858479 CACCCTGCCCTGAGCCCCAGAGG + Intronic
955360994 3:58274843-58274865 TACCCTCCCCAGAGGCCCGGGGG + Intronic
959561645 3:107789124-107789146 TGACCTCCCCAAAGCCCCGGTGG - Intronic
963603565 3:147396519-147396541 CGCTCTTCCCTGGGCCCCGGGGG + Intronic
964438158 3:156675162-156675184 AGCCCTTCCCAGACCCCGGGGGG + Exonic
968233155 3:197016029-197016051 CCTCCTCCCCAAAGCCCCAGGGG + Intronic
968512832 4:1002976-1002998 CGCCCCCTCCAGAGCCCCAGCGG - Intronic
968901320 4:3433310-3433332 CGCCCTCCCCATTGCCATGGTGG + Intronic
968949832 4:3684698-3684720 CGTCCGGCCCAGAGCCACGGAGG + Intergenic
968965696 4:3768097-3768119 CACCCTCCCCTGCGCCCTGGAGG - Exonic
969195752 4:5562591-5562613 CCACCTCCCCAGGGCCCTGGAGG - Exonic
969486841 4:7477108-7477130 CCCCCTCCCCACGGCCCAGGTGG - Intronic
971954660 4:33400721-33400743 CAGCTTCCCCAGAGCCCGGGAGG + Intergenic
980230745 4:130043300-130043322 GGCCCTCCCCAGAACCTCTGGGG - Intergenic
980745471 4:137007364-137007386 CACCCTCCCCAGAGGCCAGGAGG - Intergenic
983069744 4:163254258-163254280 AGCCATCCCCAGAGCCCCCTTGG + Intergenic
985553255 5:543752-543774 GGCCCTGCCCAGAGCCCCCCAGG - Intergenic
985657202 5:1138483-1138505 CACCCTACCCAGAGGCCCAGCGG + Intergenic
989147052 5:38259010-38259032 CGCCCTCCCCCGAGCCCGGGCGG + Intronic
991658519 5:68927375-68927397 TGCCACCCCCAGAGCCCCAGAGG + Intergenic
992561743 5:77958884-77958906 AGCCACCCCCAGAGGCCCGGAGG + Intergenic
994320713 5:98391996-98392018 CGGCTGCCCCAGAGCCCGGGAGG - Intergenic
998150951 5:139757159-139757181 CCCCCATCCCAGAGCCCAGGAGG - Intergenic
998164860 5:139837156-139837178 CCTCCTCCCCAGCGCCCCGTGGG + Exonic
999251943 5:150188016-150188038 CTCCATCCCCACAGCCCTGGTGG - Intergenic
1000220519 5:159209539-159209561 CGGCCGCCGCAGAGCGCCGGGGG - Intronic
1001395726 5:171418937-171418959 AACCGACCCCAGAGCCCCGGAGG + Intergenic
1001937588 5:175716331-175716353 CCCCCTCCCCAAAGCAACGGAGG + Intergenic
1002896615 6:1383551-1383573 AGCCCTCCGCGGAACCCCGGCGG - Intergenic
1004690391 6:17987835-17987857 CGGCCTCTCCCGAGCCCCGGCGG - Intergenic
1005997562 6:30940694-30940716 CCACTTCCCCAGAGCCCTGGAGG + Intergenic
1006171677 6:32096805-32096827 CGCCCTCGCCACAGTCCCAGGGG + Intronic
1006580918 6:35077499-35077521 GGACGTCCCCAGAGCCCCGCTGG - Intronic
1006931121 6:37689080-37689102 CGAGCTCCCCAGTCCCCCGGTGG + Intronic
1007109225 6:39303524-39303546 CAGCCTCCCCAGAGCCCTGTGGG - Intronic
1007390492 6:41547260-41547282 CCCCATTCCCAGAGGCCCGGCGG - Intronic
1013412853 6:109897290-109897312 CCACCTCCCCAGAGACCAGGAGG - Intergenic
1015539115 6:134296937-134296959 CGGCTGCCCCAGAGCCCAGGAGG - Intronic
1016307924 6:142702822-142702844 CCTTCTCCTCAGAGCCCCGGAGG - Intergenic
1016433056 6:144008105-144008127 CGGCCTCGCCTGAGCTCCGGGGG - Intronic
1017766795 6:157613552-157613574 TGCCATCCCCAGGGTCCCGGAGG - Intronic
1017914278 6:158819381-158819403 CGCGCTCCCAAAAGCCCCGGCGG + Exonic
1018892263 6:167990439-167990461 GAGGCTCCCCAGAGCCCCGGGGG - Intergenic
1019663905 7:2241936-2241958 CGGCCTCCCCACGGCCCCGCCGG + Intronic
1020091716 7:5345637-5345659 CGCCCTCCCCAGCCCCACGGTGG - Exonic
1021600151 7:22356746-22356768 CGCCCCCCTCAGCGGCCCGGGGG + Intronic
1022518281 7:30989195-30989217 GGCCCTCCCCCGAGGCCCTGCGG + Intronic
1023029278 7:36078844-36078866 CGGCCACCCCAGGGCCCCCGGGG + Intergenic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1028035258 7:85973044-85973066 CGCACTCCTCAGAGCCACTGGGG - Intergenic
1028684172 7:93574664-93574686 CTACCTCCCCAGAGTCCAGGAGG + Intronic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1029601099 7:101563894-101563916 CTCCCTCTCCACAGCCCCTGGGG + Intergenic
1029606526 7:101602534-101602556 CGCCTTCCCCAAAGCCTCTGGGG - Intergenic
1031401378 7:121329226-121329248 CCCCCTCCCCAGAGGCCCTTCGG - Exonic
1032781227 7:135166696-135166718 AGCCCTTCCCAGAGGCCGGGGGG - Exonic
1034166581 7:149029022-149029044 CCAGCTTCCCAGAGCCCCGGCGG - Intergenic
1034546774 7:151794496-151794518 CGCCATGCCCAGTGCCACGGGGG - Intronic
1035236547 7:157501020-157501042 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236562 7:157501069-157501091 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236577 7:157501118-157501140 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236591 7:157501164-157501186 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236606 7:157501213-157501235 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236621 7:157501262-157501284 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035236636 7:157501311-157501333 CGTCATGCCCCGAGCCCCGGAGG - Intergenic
1035309041 7:157953200-157953222 AGCCCTCCCCAGAGCTGCTGGGG - Intronic
1035395117 7:158529709-158529731 GCCCCTCCCCACAGCCCCTGGGG - Intronic
1035460909 7:159038209-159038231 CGACCTCCCCTGAGCCCTGCAGG + Intronic
1035909822 8:3554406-3554428 GGCTCTCCCCAGACCCCCAGAGG - Intronic
1037200745 8:16249658-16249680 TGCCCTCCCCTCAGGCCCGGTGG + Intronic
1037574593 8:20189445-20189467 TCCCCTCCCCAGCGCCCCTGTGG + Intergenic
1037959288 8:23084203-23084225 CACCTTCCCCAGAGCGGCGGTGG + Intergenic
1038423112 8:27446193-27446215 CCCCCTCTCCTGAGCCCCAGGGG + Intronic
1040915719 8:52565150-52565172 CGCGCTCCCCTGCGCCCCCGGGG + Exonic
1041355204 8:56993195-56993217 CGCCTTCCCCAGCGTCCAGGTGG - Exonic
1046547163 8:115667708-115667730 CGCCTTCTCCAGAGCCCAGCTGG + Intronic
1049283725 8:141763383-141763405 CTCCCGCCCCAGAGCCGAGGTGG + Intergenic
1049414473 8:142488982-142489004 CGCCATCCCCACAGCCAGGGTGG - Intronic
1049435246 8:142583471-142583493 CTCCTTCCCCAGACCTCCGGAGG + Intergenic
1053380432 9:37644909-37644931 CGTGCTCCCCACAGCCCCCGGGG - Intronic
1055783254 9:79843002-79843024 CGGCCTGCACAGAGCCCAGGAGG - Intergenic
1059646165 9:116270091-116270113 CTCCCTCCCCAGAGACCAGCTGG - Intronic
1060213770 9:121726139-121726161 AGCCCACCCCACAGCCCCTGGGG + Intronic
1060358354 9:122931488-122931510 CCCCCTTCCCGGAGCCCCGAGGG - Exonic
1061262582 9:129488381-129488403 CGCGCTCCCCCGCGCTCCGGAGG - Intergenic
1061561377 9:131406084-131406106 AGCCCTCCCCGGGGGCCCGGGGG + Intronic
1062140150 9:134951650-134951672 GGCCAACCCCAGAGCACCGGCGG - Intergenic
1062254000 9:135612621-135612643 GGGCCTCCCCAGGGCCCCAGGGG + Intergenic
1062312145 9:135944639-135944661 GGCCCTGCCCAGAGACCGGGAGG - Intronic
1062499940 9:136847969-136847991 CGCCCTGCCCACCGCCTCGGCGG - Exonic
1062577265 9:137214533-137214555 CGGCGTCCCCACAGCCCTGGTGG + Intronic
1185747452 X:2584159-2584181 CGCCCTCCCGCGCGCCCCGCTGG - Intergenic
1186669886 X:11758015-11758037 CACCCCTCCCGGAGCCCCGGCGG + Intergenic
1187249522 X:17584257-17584279 CTCCCTCCTCAGAGCCTCTGAGG - Intronic
1187836492 X:23437072-23437094 CTCCCCCCCCACAGCCCCAGGGG + Intergenic
1189235560 X:39484305-39484327 AGCCCTCCCCAGACTCCCGGAGG - Intergenic
1189297578 X:39929858-39929880 CCCCCACCCCCCAGCCCCGGTGG + Intergenic
1196290140 X:113930123-113930145 CACCCTCCCCGAAGCCCAGGTGG - Intergenic
1199927361 X:152481061-152481083 CGACTTGCCCAGAGCCCGGGAGG + Intergenic
1200138697 X:153886762-153886784 TGCGCACCCCAGAGCCCAGGTGG + Intronic
1200231113 X:154444374-154444396 CGCGCTGCCCAGGTCCCCGGCGG + Intronic