ID: 1161410206

View in Genome Browser
Species Human (GRCh38)
Location 19:4112761-4112783
Sequence GGCCTGTGGGGTCACCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161410206_1161410216 1 Left 1161410206 19:4112761-4112783 CCCTCATGGTGACCCCACAGGCC 0: 1
1: 0
2: 0
3: 18
4: 201
Right 1161410216 19:4112785-4112807 CAGGGCCACCCCAGCACCCCAGG 0: 1
1: 1
2: 6
3: 72
4: 1157
1161410206_1161410224 22 Left 1161410206 19:4112761-4112783 CCCTCATGGTGACCCCACAGGCC 0: 1
1: 0
2: 0
3: 18
4: 201
Right 1161410224 19:4112806-4112828 GGATGCTCTCCCCTCCAGCCAGG 0: 1
1: 0
2: 1
3: 35
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161410206 Original CRISPR GGCCTGTGGGGTCACCATGA GGG (reversed) Intronic
900294810 1:1943519-1943541 GGCCTGCGGGGTTTCCATGACGG - Intronic
900578502 1:3395906-3395928 CGCCTGTGGGGTCAGCAGCAAGG + Intronic
900914178 1:5623128-5623150 GCACTGTGGGGACCCCATGAGGG - Intergenic
901241365 1:7695663-7695685 GGACTGTGGCTGCACCATGAGGG + Intronic
902203582 1:14851609-14851631 GGCCTTCGGGGTTACCATGCTGG + Intronic
904567341 1:31435615-31435637 GACCTGTGGGGTCACCGAGGAGG + Intergenic
904830520 1:33303656-33303678 GGCCTCTGGGCTCACTAGGAGGG + Intergenic
905697772 1:39988160-39988182 GGCCTGAGGGGCCAACATGAGGG + Intergenic
906551797 1:46671617-46671639 GCTCTGTGGGTTCACCATAAGGG + Intronic
906645584 1:47472171-47472193 GGCCTGCTGGGTCACCAGGAGGG + Intergenic
906700451 1:47853590-47853612 GGACTGTGTGGAGACCATGATGG + Intronic
907563265 1:55410680-55410702 GGCCTGTGGGTTTAGCCTGATGG - Intergenic
908036805 1:60063705-60063727 GGTCTGTGGAGTCACTAGGATGG + Intronic
908356617 1:63329463-63329485 GGCCTCCGGGGTCACCCTGGAGG + Intergenic
919802614 1:201362605-201362627 GGCTGGTGTGGTCACCATGGGGG + Intronic
922055861 1:222041888-222041910 GGACTGTGGGGACACCAACAAGG + Intergenic
922182044 1:223243170-223243192 GTCCTGTGGTGTCTCCATGTGGG - Intronic
922726117 1:227923830-227923852 TCCCTGTGGGGCCACCAGGAGGG - Intronic
1072766146 10:98096678-98096700 GGCCTATGTGGTCACCATAAAGG + Intergenic
1073423700 10:103443503-103443525 GGCCTGTGGGGTCAAGGTGAGGG + Intronic
1074101598 10:110358435-110358457 GGGCTGAGGGGTCACTATGGTGG - Intergenic
1075614905 10:123883781-123883803 GGCCTGTGTGCTGTCCATGAAGG - Intronic
1075712521 10:124538195-124538217 ACCATGTGGGGTCACCATGCGGG + Intronic
1076905438 10:133358529-133358551 GGTCCCTGGGGTCACCATGGTGG + Intergenic
1077145070 11:1041019-1041041 GGGCTGTGGGGTCTCATTGAGGG - Intergenic
1077357264 11:2124133-2124155 GGCCTCATGGGTCATCATGAGGG + Intergenic
1077390445 11:2298563-2298585 GGCCCGGGGGGTCACTCTGAAGG + Intronic
1078145200 11:8717699-8717721 GGCCTGTAGGGTTAGCGTGAGGG - Intronic
1081669957 11:44937289-44937311 GGGGTGGGGGCTCACCATGATGG + Exonic
1081929380 11:46858196-46858218 GGCCAGTGGTGGCACCAGGAGGG + Exonic
1083643470 11:64158325-64158347 GGCCTGAGGGGTGACAAGGAAGG + Intronic
1084473216 11:69375049-69375071 GGCCTGAGGGGTCACCAGGCTGG + Intergenic
1088595599 11:111438165-111438187 GGTCTCTGGTGTCACCCTGATGG + Intronic
1089009585 11:115121676-115121698 GGACTGTGGGGTCAGCCTGGAGG + Intergenic
1089582748 11:119491698-119491720 GGCCTGTGGCGCCCCCAGGATGG - Intergenic
1090806043 11:130202941-130202963 AGCCCCTGGGGTCACCATGGGGG + Intronic
1091361494 11:134981538-134981560 GGCATGTGGCGTCACCACGCTGG - Intergenic
1092695973 12:11171582-11171604 GGCCTCCGGGGCCAGCATGATGG + Intronic
1093892440 12:24538406-24538428 GGCCTGTTGAGTCACCGTGAAGG - Intergenic
1096501163 12:52064490-52064512 GGCCTGTGGGGAGACCTTGAAGG - Intergenic
1101023088 12:100573395-100573417 GGCCTGTGGGAACAACAGGACGG + Intergenic
1101676092 12:106917895-106917917 GGCCTTTAGGGTCAGCATGGGGG - Intergenic
1104816483 12:131648989-131649011 GGCCTGTGGGGACCACATGGGGG + Intergenic
1104887129 12:132117303-132117325 GGCCTGGGGAGTCACCATCCAGG + Intronic
1104918974 12:132280731-132280753 GGGCTGGGGGGCCACCCTGAGGG - Intronic
1112019503 13:95359428-95359450 GGCCTGAAGGGTCCCCAGGAAGG + Intergenic
1112592430 13:100776070-100776092 GGCCTGTGGGATCAACCTGTGGG - Intergenic
1113698499 13:112365521-112365543 GGAGGGTGGGGTCCCCATGATGG + Intergenic
1113956220 13:114101097-114101119 GGCCTGTGCAGTCACCAGCAAGG + Intronic
1117609048 14:57463747-57463769 GGCCTGTGGGGATACGATGGGGG - Intergenic
1119391267 14:74292717-74292739 AGCATGTGGGGTGACCAAGAGGG + Intronic
1122248629 14:100422584-100422606 GGCCCGTCAAGTCACCATGAGGG - Intronic
1122885464 14:104708547-104708569 GGCCCGGGGGGCCACCATGGTGG - Exonic
1123034794 14:105467508-105467530 GTCCTGTGGGGTCAGCACGCCGG + Intronic
1124014715 15:25864838-25864860 GGCCTCGGGGGTCACCAGGTGGG - Intronic
1124349346 15:28943857-28943879 AGCCTGTGGGCACACCATGTAGG - Intronic
1127419052 15:58787178-58787200 GGCCAGAGGTGTCACCATGTTGG + Intronic
1128292541 15:66489018-66489040 TGCCTGTTGGGTAACCATGTTGG - Intronic
1129246274 15:74280794-74280816 GGGCAGGGGGCTCACCATGATGG - Exonic
1129530251 15:76259546-76259568 GGCCTTCGGGGTGACCATGTGGG - Intronic
1129603451 15:77013389-77013411 TGCCTCTGGGGTCTCCATGGGGG + Intronic
1129969039 15:79761086-79761108 GGCTTCTGGGGTCTCTATGAGGG - Intergenic
1132535501 16:477483-477505 GGCCTGTGGGGAAGGCATGACGG - Intronic
1132674782 16:1117108-1117130 GGCCTGTGGGGACAGGGTGAGGG - Intergenic
1132834386 16:1945484-1945506 GGGCGGTGAGCTCACCATGAAGG + Exonic
1135144304 16:19948319-19948341 GGCTTTTGGGGTTAACATGATGG - Intergenic
1137586922 16:49669387-49669409 GGCCTCTAGGGTCGCCATGTGGG - Intronic
1138976511 16:62214387-62214409 GGCCATAGGGGTCACCATGCCGG + Intergenic
1139777226 16:69324085-69324107 GGCCTCTGGGGTGGCCTTGAAGG + Intronic
1142068082 16:88074133-88074155 CGCCTGCAGAGTCACCATGAAGG - Intronic
1142125399 16:88407736-88407758 GGCCTGTGGTGTCACCACCCTGG - Intergenic
1143452108 17:7042506-7042528 GGGCTGGGGGGTCTCCAGGAAGG + Exonic
1143517373 17:7426640-7426662 GGGCTGTGGGGCCACCAGGGTGG + Exonic
1143521685 17:7447740-7447762 GCCCTGTGGGGTCAGCAGGATGG + Intronic
1144702156 17:17347005-17347027 GGCCTGTGGGGCCAGTATGCTGG + Exonic
1144708352 17:17384563-17384585 GGTCCATGGGGTCACCAGGAAGG + Intergenic
1147237385 17:39068001-39068023 GGAGTGTGGGGTCCCCATGGGGG - Intronic
1147244186 17:39109591-39109613 GGCCTGTTGGGGCACCACTAGGG - Intronic
1150003211 17:61454847-61454869 GGCCTGCGGGGTCGCAAGGAGGG - Intronic
1151264927 17:72947465-72947487 GGACAGTGGGGTCACTCTGATGG - Intronic
1152920691 17:83065086-83065108 GACCTTTGGGGTCACCAGGTTGG - Intergenic
1160246238 18:77162504-77162526 GGCCAGTGGGGCCAGGATGAGGG - Intergenic
1160364623 18:78313635-78313657 TGCCTGTGGGGTCCCCATGTAGG - Intergenic
1160734651 19:657001-657023 AGCCTGGGGAGTCACCATGCAGG - Intronic
1160927063 19:1551760-1551782 GGCCAGGGGTGTCACCATGCTGG - Intergenic
1161265679 19:3362883-3362905 TGGCTGTGGGGTTACCATGGGGG + Intronic
1161406119 19:4092102-4092124 GGCCTTTGGGGTTCCCAGGAGGG + Intronic
1161410206 19:4112761-4112783 GGCCTGTGGGGTCACCATGAGGG - Intronic
1162013397 19:7830923-7830945 GTCCTGTGGGGTCAGCATGGGGG - Intronic
1162186530 19:8909414-8909436 GGCTTTTGGGGTCAAGATGATGG + Exonic
1162722509 19:12670675-12670697 AGCCTGTGAGGCCAGCATGATGG - Exonic
1162812228 19:13171207-13171229 GGCCTGTGGTTTCTCCATGTGGG + Intergenic
1162907917 19:13834319-13834341 GGATCGTGGGGTGACCATGAGGG - Intergenic
1166378399 19:42341785-42341807 GGCCAGAGGGGTCACCAGGGAGG + Intronic
1167490796 19:49791915-49791937 TCCCTGTGGGGACACCATGCAGG - Exonic
925386101 2:3462838-3462860 GAGCTGTGGGGACACCAGGAGGG - Intronic
925449175 2:3953607-3953629 GGCCTTTGGAGTCACAGTGATGG + Intergenic
925654316 2:6128960-6128982 GGCCTTTGGGGTCACACTGCAGG + Intergenic
927094001 2:19733986-19734008 GCCCTGTGGGGACAGCATGGGGG - Intergenic
927854999 2:26522479-26522501 CGCCTCTGGGGTCACCACAAGGG - Intronic
927999992 2:27515460-27515482 GGCCAGGGGTGTCACCATGTTGG + Intronic
928398461 2:30961035-30961057 GGCCTCTGGGGGCTCCTTGAGGG - Intronic
929047149 2:37801150-37801172 GGTCTGTGGAGTCTCCACGAGGG + Intergenic
929085616 2:38164702-38164724 GGCCTGAGGGAGCACCATCATGG - Intergenic
934716881 2:96549668-96549690 GGCCTGTCAGGGCACCAGGAAGG + Intronic
934857397 2:97737843-97737865 GAGCTATGGGGTCACCATGTGGG + Exonic
936057572 2:109272378-109272400 GGACTGTGCAGGCACCATGAGGG + Intronic
936095554 2:109528270-109528292 GGCCTGTGGGGTGGTCAGGATGG - Intergenic
937025452 2:118693463-118693485 GGACTGCGGGGTCACCATTTTGG + Intergenic
938260466 2:129892092-129892114 GGCCAGTTGGGTCCCGATGAGGG - Intergenic
939162338 2:138605162-138605184 GGCCTGAGCGGTAACCATCAGGG + Intergenic
939556828 2:143685180-143685202 GGCTTGTAGGGTGACCATGGGGG + Intronic
940117438 2:150224541-150224563 GGACTGTGGGGTAAACATGGTGG - Intergenic
944763605 2:202841755-202841777 GGACTTCTGGGTCACCATGATGG + Intronic
944875581 2:203961375-203961397 GGCCAGGTGGGCCACCATGAAGG - Exonic
946026176 2:216673229-216673251 GCCCTGTGGGGGTACCATGGAGG + Exonic
947582860 2:231332505-231332527 GGCCTGTGGAGTCACCATCTGGG + Intronic
948648257 2:239422579-239422601 GCCCTGTGGAGTGGCCATGAGGG - Intergenic
1169327698 20:4688293-4688315 GGGCTTTGGGGTCACAAAGATGG + Intronic
1169331933 20:4722995-4723017 GGCCTGGGGGAACACCAGGAGGG - Intronic
1170775930 20:19374630-19374652 AGCCTGTGGGGTAGGCATGAAGG + Intronic
1172357410 20:34289945-34289967 GGCATGTGGGGTCAGGATGGAGG - Intronic
1172947967 20:38703225-38703247 GGCCTGGTGGGCCACCCTGAAGG + Intergenic
1174603130 20:51740616-51740638 GGACTGTGGTGGCACCATCATGG + Intronic
1178490701 21:33049446-33049468 GGCCTATGGGGTCATGGTGATGG + Intergenic
1178904643 21:36626609-36626631 GGCCTGTGTGGTGACCTGGAGGG - Intergenic
1180149248 21:45939336-45939358 GGCCTATGGGGCAGCCATGAGGG - Intronic
1181306719 22:21921294-21921316 GGGCTGTGTGGTCCCCATGAAGG - Exonic
1181405894 22:22685087-22685109 GTGCTGTGGGGTCACCTGGAAGG + Intergenic
1183292670 22:37012404-37012426 GGCCTGTGGCCTCACCCTGTGGG - Intronic
1183585622 22:38751371-38751393 GTCCTGTGGGACAACCATGAGGG + Exonic
1183958689 22:41397804-41397826 GGCCTGGTGGATCACCAAGAGGG + Exonic
1184762704 22:46553913-46553935 GCCCTCTGGGGTCATCATTAGGG - Intergenic
1185130477 22:49035933-49035955 GGCCTGAGGGGGCTCCATGCTGG - Intergenic
950021918 3:9793235-9793257 GGGTTGTGGGGACACGATGAGGG + Intronic
950544125 3:13628852-13628874 GGCCTGGGAGGACACCATGCCGG + Intronic
950679908 3:14577954-14577976 GGCCTGTGGGGTGAACAGGATGG + Intergenic
951499886 3:23373320-23373342 GTCCTGTGGGGTAAGCAGGAAGG + Intronic
952535418 3:34304312-34304334 GGAGGGTGGGGTCACCATGAGGG + Intergenic
953021160 3:39114278-39114300 GCCATGTGAGGTCACCCTGAAGG - Intronic
953608729 3:44429380-44429402 GGCCTGTGAGGACCCCATGTGGG - Intergenic
953890156 3:46745296-46745318 GGCCTCTGGGGTCTCCCTGCTGG - Intronic
954293762 3:49663037-49663059 GGCCTGTGGCCTCATGATGAGGG + Exonic
954892654 3:53945182-53945204 CTCCTGTGTGGGCACCATGAGGG + Intergenic
955374145 3:58380161-58380183 GGACTGAGTGCTCACCATGAGGG + Intronic
955532635 3:59890235-59890257 GCCCTGTGGGGACTCCATGGTGG + Intronic
956462546 3:69485798-69485820 TGCCTTGGGGGCCACCATGATGG - Intronic
961452349 3:127008096-127008118 GGCCTGTGGGGTCACTGTCTTGG + Intronic
962470675 3:135705375-135705397 AGCCTGTGAGAGCACCATGAGGG - Intergenic
962748881 3:138418178-138418200 GGACTGTGGGGTTCCCAGGAAGG + Intergenic
968883076 4:3311079-3311101 AGCCCGTGGGGTCACCCTGGAGG + Intronic
968945609 4:3661998-3662020 TGCCTGAGGGGTAACCAGGAGGG - Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
969591837 4:8126504-8126526 GGCCTGTGGGGTGAAGGTGATGG - Intronic
969652719 4:8477494-8477516 GGCCTCTGGGGTCCCCACGCTGG + Intronic
974843421 4:67323548-67323570 CCCCTGTGGGGTCTCCATGTGGG - Intergenic
976037998 4:80847509-80847531 GGCATGTAGGGTCACCACAAGGG - Intronic
980736369 4:136894971-136894993 TTCCTGTGGGCACACCATGATGG + Intergenic
984465424 4:180095025-180095047 GGCCTGTGGGCTTCCCAGGAGGG + Intergenic
985647117 5:1090205-1090227 GGCTTCTGGGGTCACCGTGCCGG + Intronic
985803494 5:2021576-2021598 GCTCTGTGGGGACACCCTGAGGG + Intergenic
995858986 5:116622186-116622208 GGAATGTGGGGTCACAGTGAGGG + Intergenic
997139366 5:131362341-131362363 GGGCTTTGTGGTCACCATAATGG + Intronic
998513313 5:142731733-142731755 GGCCTGTGAGGTAAGAATGATGG - Intergenic
1000230158 5:159308375-159308397 GTTCTGTGGAGTCAACATGATGG + Intergenic
1001882902 5:175260007-175260029 GGCATCTGGGGTCACCGAGAGGG - Intergenic
1002541512 5:179908925-179908947 GGGATGTGGGGTCACCCTGCTGG + Intergenic
1005161174 6:22865836-22865858 GGAATGTGGGGTCTTCATGATGG - Intergenic
1005200712 6:23341264-23341286 GGCCTGTTTGGTCACATTGATGG + Intergenic
1009318821 6:62258866-62258888 TGCCTGAGAGGTCACCCTGATGG - Intronic
1011781614 6:90796081-90796103 GGTCTGTGGGGTAAGCAAGATGG + Intergenic
1012232896 6:96781575-96781597 TGCCTCTGGGTGCACCATGAAGG - Intergenic
1017142878 6:151207611-151207633 GGCCTGTGGTCTCTCCATGAAGG + Intergenic
1017742487 6:157419102-157419124 GGACTGTGGGATCCCCATGTCGG + Intronic
1018055850 6:160051610-160051632 GGCCTGTGGGTGAACGATGAGGG + Intronic
1018694144 6:166377350-166377372 GGGCTGCTGGGTCACCCTGATGG + Intronic
1018845314 6:167551722-167551744 GGCCTGTGGGGTGCCCACGCTGG + Intergenic
1018858116 6:167689857-167689879 GGCCTGTGGGGTCAGGAGGTGGG - Intergenic
1019370259 7:659464-659486 GGCGTGTGCGGCCACCATGTGGG - Intronic
1019506381 7:1393532-1393554 AGCCTGAGGGGGCACCATGGCGG + Intergenic
1022794913 7:33724366-33724388 AGCCTGTGGAGACACAATGATGG + Intergenic
1023733863 7:43217983-43218005 GGCCTGTGGGGTCCACTAGAGGG + Intronic
1024784144 7:52886708-52886730 GGCCTGAGTGGTCCCCATGAAGG - Intergenic
1026282660 7:68935574-68935596 GGCCTGATGGGCCAACATGATGG - Intergenic
1027793018 7:82657020-82657042 GGCTTCTGCGGTCTCCATGACGG + Intergenic
1028850055 7:95527942-95527964 GGCCAGGGGGGTCTCCATGTGGG - Exonic
1029129509 7:98319253-98319275 GGTCTGTAGGGCCACCCTGAAGG + Intronic
1032425393 7:131818683-131818705 GAGCTTTGGGCTCACCATGAAGG + Intergenic
1032552495 7:132797419-132797441 GACCAATGGGGTCACCATAAAGG - Intronic
1033708015 7:143907158-143907180 GGCCTGTCAGGTCACCTTGCGGG - Intergenic
1034218878 7:149429306-149429328 GGCATGTGGTGGCACCATCATGG - Intergenic
1034493030 7:151404497-151404519 GGCCTGCGGGGTCACCCTAGCGG + Intronic
1037240510 8:16771968-16771990 TGACTGTATGGTCACCATGATGG + Intergenic
1047004504 8:120605808-120605830 GGCCTGTGGTGTCAGCCTTATGG + Intronic
1047940943 8:129826912-129826934 GGCCTGAGGGGTCACACTGAGGG + Intergenic
1048250779 8:132865074-132865096 GGCATGTGTGGTCCCCAAGAAGG + Intergenic
1049547490 8:143240205-143240227 GCCCTGTGGGGTCATTGTGAAGG - Intergenic
1049844632 8:144793815-144793837 AGGCTGTGGGGTCCCCAAGATGG + Intergenic
1053200497 9:36148734-36148756 GGCCTGTGGCTACACCACGAGGG - Intronic
1053203720 9:36169422-36169444 GGCCTGTGGGATCAGATTGATGG - Exonic
1054797538 9:69316678-69316700 GGCCTGTGGAGAAACCATGGAGG - Intergenic
1056085981 9:83149598-83149620 GGCCTGAGAGGCCACAATGAGGG + Intergenic
1056824808 9:89869645-89869667 GGTATGTGGGTTCACCCTGAGGG + Intergenic
1057533328 9:95874732-95874754 GTCCTGTGGAGTCACCAGAAAGG + Intergenic
1058057706 9:100465708-100465730 GGCCTGGGGGTTCAGCATAAGGG - Intronic
1058932714 9:109737282-109737304 GGCCTGAGTGGTCATCACGATGG + Intronic
1059657045 9:116366807-116366829 GGCCTGTCAGGAAACCATGAAGG + Intronic
1059698874 9:116755965-116755987 GTCTTGTAGGGTCACCATCAAGG - Intronic
1060139763 9:121200445-121200467 TTGCTGTGGGGTCACCAGGAAGG + Intronic
1060547427 9:124469493-124469515 GGGCTGTGGGCTCAACATGCGGG - Exonic
1060892643 9:127198511-127198533 GGCCAGTGGGGTCACAGAGAGGG - Intronic
1061953752 9:133950844-133950866 GGCCTCCGAGGTCAACATGAGGG + Intronic
1062346475 9:136117591-136117613 GGGCCGTGGGGTCACCTTGCTGG + Intronic
1186044497 X:5520095-5520117 CACCTGTGGGGTCATGATGAGGG - Intergenic
1189027686 X:37414541-37414563 CCCCTGAGGGGCCACCATGAGGG + Intronic
1189591752 X:42519988-42520010 GGCCTGTAGGGGGACCATGTGGG - Intergenic
1192524249 X:71828174-71828196 GGCCTGCCGAGTCACCATGGTGG - Intergenic
1196746717 X:119077722-119077744 GGCCTTTGAGGTCATTATGAAGG + Intergenic
1200251367 X:154556031-154556053 GGCGGGTGGGGGCACCAGGATGG + Intronic
1200266399 X:154648385-154648407 GGCGGGTGGGGGCACCAGGATGG - Intergenic