ID: 1161420691

View in Genome Browser
Species Human (GRCh38)
Location 19:4174700-4174722
Sequence CGGGCTCTGAGCCGTTGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161420689_1161420691 -8 Left 1161420689 19:4174685-4174707 CCCGTTTGGGGCTGGCGGGCTCT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1161420691 19:4174700-4174722 CGGGCTCTGAGCCGTTGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1161420686_1161420691 -3 Left 1161420686 19:4174680-4174702 CCGCTCCCGTTTGGGGCTGGCGG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1161420691 19:4174700-4174722 CGGGCTCTGAGCCGTTGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1161420690_1161420691 -9 Left 1161420690 19:4174686-4174708 CCGTTTGGGGCTGGCGGGCTCTG 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1161420691 19:4174700-4174722 CGGGCTCTGAGCCGTTGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161420691 Original CRISPR CGGGCTCTGAGCCGTTGTGC TGG Exonic
901631158 1:10648862-10648884 GGGGCTCTGAGCCCCTGTCCAGG - Intronic
904933156 1:34106618-34106640 CAGGCTCTGACCCCTGGTGCTGG - Intronic
905627613 1:39498950-39498972 CGGACACTGAGCCGCTGTCCTGG + Intronic
905668811 1:39778158-39778180 CGGACACTGAGCCGCTGTCCTGG - Intronic
1063565878 10:7172002-7172024 CGGGCTCTGAGCCGCTCCGCAGG + Exonic
1064563241 10:16613374-16613396 CAGTCTCTGAACCATTGTGCTGG - Intronic
1065034571 10:21624828-21624850 CGGCCTCTCTGCTGTTGTGCAGG + Intronic
1067682509 10:48449883-48449905 CAGGCTATGAGCCCTTGTACTGG + Intronic
1069861180 10:71472666-71472688 CGAGGCCTGAGCCCTTGTGCTGG + Intronic
1070781898 10:79142554-79142576 AGGCCTCTGAGCCTTTGTGTAGG - Intronic
1075393845 10:122113057-122113079 CCGGCCCTGCGCCGTTGTCCCGG + Intronic
1075740365 10:124692185-124692207 GGGGCACTGAGCCCTGGTGCAGG + Intronic
1083263718 11:61536604-61536626 CAGGCGCTGAGCCCATGTGCAGG - Intronic
1085821203 11:79795518-79795540 CTGGTTCTGGGCTGTTGTGCAGG - Intergenic
1089363592 11:117907493-117907515 CGTGCTCTGAGCCTGTGAGCTGG - Intronic
1092164957 12:6336882-6336904 CTGGTTCTGACCAGTTGTGCTGG + Intronic
1097071702 12:56360032-56360054 CGGGCCCTGAGAGGGTGTGCTGG - Intronic
1099786799 12:87274896-87274918 AGGGATCTGAGCAGCTGTGCAGG + Intergenic
1101812934 12:108123287-108123309 ATGGCTCTGAGCCATTGAGCAGG - Intergenic
1103301396 12:119930241-119930263 ATGGCTCTGAGCCTTTCTGCAGG - Intergenic
1103446705 12:120999597-120999619 CTGGCGCTGAGCCGGTGGGCCGG - Exonic
1104933332 12:132351868-132351890 CGGGCTCTGAGCTGAGATGCAGG + Intergenic
1106189955 13:27442951-27442973 CAGGCTCTGAGCTGTAGTGCCGG - Intronic
1106407229 13:29484555-29484577 ATGGCTCTGAGCCGGTGTCCAGG + Intronic
1112436772 13:99396198-99396220 CGGGCTCTGAGGCAGTGTGTGGG + Intergenic
1124064795 15:26332372-26332394 CGGGCTTTGACACATTGTGCTGG - Intergenic
1130909627 15:88262192-88262214 CCGGCTCTGAGCAGTTGAGTTGG + Intergenic
1131467025 15:92663927-92663949 CGGGGTCTGTGCCCTGGTGCTGG - Intronic
1132711801 16:1272174-1272196 TGGGCTCTGTGCCGTTGTCCAGG + Intergenic
1134024648 16:10944650-10944672 CGGGCGCTGGGCCGCTCTGCTGG + Exonic
1134796481 16:17041753-17041775 CTGGCTCTTAGCAGCTGTGCAGG + Intergenic
1136534646 16:30892688-30892710 TGGGCTCTGTGCCCTTTTGCAGG + Exonic
1139966753 16:70749983-70750005 CTGGCTTTGAGCCTCTGTGCTGG + Intronic
1142179981 16:88663646-88663668 CGGGTTGTGAGGCGCTGTGCGGG + Intergenic
1143492191 17:7290984-7291006 CCAGCTCTGACCCGTTCTGCGGG - Intronic
1145235209 17:21203042-21203064 TGGCCTCAGCGCCGTTGTGCAGG - Intronic
1147672378 17:42184141-42184163 CGGGATCTGAGTCGTTCTTCGGG - Exonic
1149146746 17:53503134-53503156 CTGCCTCTGAGCCTTTGTACAGG + Intergenic
1151984814 17:77535493-77535515 CAGGCTGAAAGCCGTTGTGCTGG + Intergenic
1152575856 17:81140719-81140741 GGGGCTGTGAGCCGTGGGGCCGG + Intronic
1152575885 17:81140805-81140827 GGGGCTGTGAGCCGTGGGGCCGG + Intronic
1155174651 18:23291645-23291667 GGAGCCCTGAGCTGTTGTGCAGG - Intronic
1156722377 18:40085726-40085748 AGGACTCTGAGTGGTTGTGCTGG + Intergenic
1161420691 19:4174700-4174722 CGGGCTCTGAGCCGTTGTGCTGG + Exonic
1161434998 19:4257992-4258014 CGGGATCTGAGCCCTGGGGCAGG - Intronic
1161981681 19:7633356-7633378 TGGGCTCTGAGACCTTGAGCTGG + Intronic
1166077590 19:40422823-40422845 AGGGCGCTGAGCCCTCGTGCTGG - Exonic
1166697299 19:44859411-44859433 CTGGCTCTGCGACCTTGTGCAGG - Intronic
928025527 2:27735874-27735896 CTGGCCCTGAGCCGGTTTGCTGG + Intergenic
929886304 2:45881842-45881864 AGGGCTCTGTGTAGTTGTGCAGG + Intronic
930808980 2:55520595-55520617 CGGGTTCTGAGCAGTTCTTCAGG + Intronic
932750999 2:74371612-74371634 CGGAGTCTGAGCCGGGGTGCTGG + Exonic
933772540 2:85753608-85753630 CGTGCTCGGGGCGGTTGTGCAGG + Intronic
946718161 2:222575539-222575561 CGGGCTCGGAGGCTTTTTGCTGG - Intronic
948801167 2:240434332-240434354 GGGGCTCTCAGCCGCTGTGTGGG - Intergenic
1175142853 20:56873578-56873600 CGGGCTCTGAGCCAGTGAGCCGG + Intergenic
1178979965 21:37255478-37255500 TGTGCTCTGATCCGTTGGGCAGG - Intronic
1181620415 22:24087324-24087346 TGGGCTCTGAGCCCTGGTGTGGG + Intronic
1184551256 22:45205358-45205380 CTGGCTCTGGGCCTGTGTGCCGG - Intronic
949627239 3:5880638-5880660 CAGGCCCTGTGCAGTTGTGCAGG + Intergenic
961488928 3:127237625-127237647 CGGGCTGTGACCAGTTCTGCTGG - Intergenic
966557709 3:181282620-181282642 CAGGCTGTGAGCCACTGTGCTGG + Intergenic
967917341 3:194588494-194588516 TGGGCTCTGAGCTGATGAGCTGG + Exonic
968941684 4:3642336-3642358 CGTGCTCTGCGCGGGTGTGCGGG + Intergenic
968941704 4:3642462-3642484 CGTGCTCTGCGCGGGTGTGCGGG + Intergenic
973624756 4:52760193-52760215 CTGGCTGTGAGCAGTAGTGCAGG - Intergenic
976152332 4:82104818-82104840 GGGGATCTGAGCAGGTGTGCTGG + Intergenic
980087219 4:128403761-128403783 CGGACTCTGGGCTGTTGTGGGGG - Intergenic
985881024 5:2639270-2639292 CGGTCACTGAGCCGTGCTGCGGG - Intergenic
997264428 5:132486857-132486879 CGGGCTGTCAGCCTTGGTGCAGG + Intronic
997609595 5:135206230-135206252 CAGCCTCTGAGCCGTGGTTCTGG + Intronic
1000554261 5:162705207-162705229 TGGGCTCTGAGCTATTGTGAAGG + Intergenic
1004947279 6:20629793-20629815 TGGGCTCTGAGACCCTGTGCTGG + Intronic
1005407949 6:25511779-25511801 AGGGCTCTGAGCTGGTGGGCAGG + Intronic
1024965466 7:55019441-55019463 CGGGCGCCGAGCCGGTGCGCCGG - Intronic
1034974008 7:155437401-155437423 CTGCCTCTGAGCTGTTGTTCTGG - Intergenic
1035295504 7:157864923-157864945 CCAGCTGTGAGCCCTTGTGCAGG - Intronic
1035492744 7:159294556-159294578 TGGGCTCTGAGCCCTGGGGCAGG - Intergenic
1036809911 8:11860711-11860733 CGTGCTCTTAGCCGCTCTGCTGG - Intronic
1038807896 8:30812147-30812169 CGGGCCCTGAACCGATGGGCCGG + Intronic
1043572306 8:81618687-81618709 CGGTCTCTGTGCGGGTGTGCGGG - Intergenic
1047188734 8:122658949-122658971 CAGGCTCAGAGCCACTGTGCAGG + Intergenic
1057509149 9:95663303-95663325 CAGGCTCTGAGCCGGTGCTCAGG + Intergenic
1057800180 9:98186131-98186153 CGGGAGCTGAGCATTTGTGCAGG - Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1189462062 X:41250885-41250907 TGGGCTGTGAGCAGTTGTTCTGG - Intergenic
1198087437 X:133294178-133294200 CGAGCTCTGAGCTGTCTTGCAGG - Intergenic