ID: 1161425091

View in Genome Browser
Species Human (GRCh38)
Location 19:4198673-4198695
Sequence CAGAGGTTGGGGCAGCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 375}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161425066_1161425091 27 Left 1161425066 19:4198623-4198645 CCCCATTCCAGACCCGGGAAAGA 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 375
1161425073_1161425091 15 Left 1161425073 19:4198635-4198657 CCCGGGAAAGATGGTCGGCGGCG No data
Right 1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 375
1161425064_1161425091 29 Left 1161425064 19:4198621-4198643 CCCCCCATTCCAGACCCGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 375
1161425065_1161425091 28 Left 1161425065 19:4198622-4198644 CCCCCATTCCAGACCCGGGAAAG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 375
1161425074_1161425091 14 Left 1161425074 19:4198636-4198658 CCGGGAAAGATGGTCGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 375
1161425063_1161425091 30 Left 1161425063 19:4198620-4198642 CCCCCCCATTCCAGACCCGGGAA 0: 1
1: 0
2: 1
3: 21
4: 217
Right 1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 375
1161425068_1161425091 25 Left 1161425068 19:4198625-4198647 CCATTCCAGACCCGGGAAAGATG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 375
1161425070_1161425091 20 Left 1161425070 19:4198630-4198652 CCAGACCCGGGAAAGATGGTCGG 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 375
1161425067_1161425091 26 Left 1161425067 19:4198624-4198646 CCCATTCCAGACCCGGGAAAGAT 0: 1
1: 0
2: 1
3: 17
4: 75
Right 1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG 0: 1
1: 0
2: 2
3: 16
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161425091 Original CRISPR CAGAGGTTGGGGCAGCTTTT GGG Intronic
900130297 1:1084540-1084562 CTGAGGTTGAGGCAGCTCCTGGG - Intronic
900738420 1:4315083-4315105 CAGAGGTTGGAACAGATTGTAGG - Intergenic
900931384 1:5739960-5739982 CATAGGTAGGAGCAGCTTTGAGG + Intergenic
902393709 1:16120700-16120722 CAGAGGTTGGGGCAGGGATGGGG - Intergenic
902692468 1:18118386-18118408 CAGAGGCTGGGGCAGCTGGAGGG + Intronic
905473350 1:38208889-38208911 CAGAGGCTGGGGAAGTTTGTTGG + Intergenic
906039262 1:42774890-42774912 CAGAGGCTGGAGTAGATTTTTGG - Intronic
907517678 1:55003118-55003140 CAGAGGAAGAGGCAGCTTCTAGG + Intronic
908855539 1:68422894-68422916 CAGAAGTAGGGGAAGCTGTTAGG - Intergenic
909405166 1:75281024-75281046 CAGAGGTTGGAGCAGTTTGGAGG + Intronic
911204744 1:95080805-95080827 CAGAGGTTGGGTCAGATTGGGGG + Intergenic
911880739 1:103235776-103235798 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
913050411 1:115112657-115112679 CAGAGGTTGTAGCAGTTTCTCGG + Intergenic
914918086 1:151830547-151830569 CAGAGGTTAGGGAAGCTATAGGG - Intronic
915855910 1:159386331-159386353 CAGAGGTTGGGACAGTTTGGAGG + Intergenic
916467128 1:165083677-165083699 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
917629688 1:176879576-176879598 CAGAGCTTGGGCCAGCTTGGGGG - Intronic
919388811 1:196955400-196955422 CAGAGGTTGGAACAGCTTAGGGG - Intronic
920255232 1:204650104-204650126 CAGAGGCTGAGGAAGTTTTTGGG - Intronic
920783617 1:209019505-209019527 CAGAGGTTGGAGCAGTTTGGGGG + Intergenic
921386615 1:214576450-214576472 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
921853762 1:219958770-219958792 CAGATGTTGTGGGAGCATTTGGG - Intergenic
922349995 1:224727529-224727551 CAGGGGTTGGGGCTGCTGATGGG - Intronic
922568685 1:226618978-226619000 CAGAAGATGGGGTAGCTTCTGGG - Intergenic
924662837 1:246037697-246037719 CAGAGGTGAGGGCAGGATTTTGG - Intronic
1062911727 10:1216179-1216201 CTGAGGTTGGGGGAGGTCTTAGG + Intronic
1064528606 10:16283990-16284012 CAGTGGTTGGGGAAGGTTCTGGG + Intergenic
1065225968 10:23544406-23544428 CAGAGGTTGGAACAGTTTTGAGG + Intergenic
1065488893 10:26262214-26262236 TTGAGGTGGGGGCAGATTTTTGG + Intronic
1065864170 10:29899171-29899193 CAGAAGTTGGGGGAGATTTCTGG + Intergenic
1066154315 10:32658136-32658158 CAGAGGTTGGAGCAGTTTGGAGG - Intronic
1067134857 10:43598844-43598866 CAGAGGGTGGGGCTGCTGCTGGG + Intergenic
1067561671 10:47308909-47308931 CCAAGGTTGGGGCAGCTTCCTGG + Intronic
1068011389 10:51455873-51455895 CAGAGGTTGGAACAGCTTTCAGG - Intronic
1068148033 10:53096712-53096734 AAGAGGTTGGAACAGTTTTTAGG + Intergenic
1068636152 10:59350463-59350485 CAGACCTGGGGGCAGCCTTTGGG + Intronic
1069957689 10:72061863-72061885 CAGAGCCTGGGGGAGCTTTTAGG - Exonic
1071518838 10:86316523-86316545 CCTAGGCTGGGGCAGCTTTGAGG - Intronic
1071636905 10:87265295-87265317 CAGAGGTTGGAACAGCTTCGAGG + Intergenic
1071658343 10:87472659-87472681 CAGAGGTTGGAACAGCTTCGAGG - Intergenic
1075354371 10:121757357-121757379 CAGAGGTTGGAACAGTTTGTAGG - Intronic
1078648699 11:13167131-13167153 CAGAGGTGGGGGGACCTATTAGG - Intergenic
1078747554 11:14129605-14129627 CAGAGGTTGGAGCAGTTTGGAGG - Intronic
1078988984 11:16626020-16626042 CTGAGGTGGTGGCAGTTTTTTGG + Intronic
1079769634 11:24443652-24443674 CAGAGGTTGGAACAGTTTGTAGG + Intergenic
1080665726 11:34334271-34334293 CTTAGGTTGGGGCAGGTCTTAGG - Intronic
1081388843 11:42504579-42504601 CAGAGGTTGGGACAGTTTGGAGG - Intergenic
1082556946 11:54574199-54574221 CAGAGGTTAGTGCTGCCTTTTGG - Intergenic
1083309168 11:61775745-61775767 CAGAGGTGGGGGGAGCGTGTGGG + Intronic
1083666700 11:64279221-64279243 CACAGGTTGGGTCAGCTGGTGGG - Intronic
1083679027 11:64342850-64342872 CAGAGGATGGGGCAGGTGTAGGG + Intronic
1084148985 11:67279318-67279340 AGGAGGTTGGGGCGGCTTTGTGG + Intronic
1084192665 11:67505880-67505902 CAGAGGTGGGGGAGGCTTTGTGG - Intronic
1087474429 11:98618826-98618848 CAGAGGTTGGGACAGTTTGGAGG - Intergenic
1087690771 11:101318287-101318309 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
1088013940 11:105036846-105036868 CAGAGGTTGGAACAGTTCTTAGG + Intergenic
1088111413 11:106266417-106266439 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
1088290795 11:108234766-108234788 GAGAGGTTGAGGCTGCTGTTGGG + Intronic
1092217791 12:6694951-6694973 CTGAGGGTGGGGCAGCTGTGGGG - Exonic
1092721987 12:11450428-11450450 CGAAGGTCGGGGCTGCTTTTAGG + Intronic
1096968927 12:55649934-55649956 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
1097748364 12:63324706-63324728 CTGAGGTGGGGGCAGTTTTGTGG + Intergenic
1098650016 12:72952974-72952996 CAGAGGTTGGAGCAGATTGGAGG - Intergenic
1099206281 12:79731180-79731202 CAGAGGTTGGGGCTGCTGCAGGG + Intergenic
1099501362 12:83418267-83418289 CAGAGGTTGAAACAGATTTTAGG + Intergenic
1099655179 12:85480012-85480034 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
1100674997 12:96856772-96856794 CAGAGGTTGGGACAGTTTGGAGG - Intronic
1101441149 12:104705055-104705077 GAGAGGATGGGCCAGCTGTTTGG + Intronic
1103741490 12:123094551-123094573 CAGAGTTGGAGGCAGCTATTTGG - Intronic
1105325002 13:19362781-19362803 CAGAGGTTGGGTGAGGTTTAAGG - Intergenic
1107365969 13:39676183-39676205 CAGAGGTTGGGGAAGATAGTGGG - Intronic
1108599142 13:51975539-51975561 CAGAGGTGGGGACCTCTTTTGGG - Intronic
1108791089 13:53970087-53970109 CAGAGGTTGGAACAGTTTTGAGG - Intergenic
1108832453 13:54497402-54497424 CAGAGGTTGGAACAGTTTGTAGG + Intergenic
1108981432 13:56520792-56520814 CAGAGGTTGGAACAGCTTGGAGG + Intergenic
1109237503 13:59842904-59842926 AAGAGGTTGGGGGAGCTTCTGGG - Intronic
1109832691 13:67812892-67812914 CAGAGGTTGGAACAGTTTGTAGG - Intergenic
1109876196 13:68406673-68406695 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
1110028180 13:70570008-70570030 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
1111148382 13:84215352-84215374 CAGAGGTTGAGATAGCATTTTGG - Intergenic
1111614409 13:90644695-90644717 CAGAGGTTGGAGCAGTTTCGAGG - Intergenic
1112055171 13:95684085-95684107 CAGAGGTTGGGACAGTTTGGAGG + Intronic
1112861449 13:103832976-103832998 CAGAGGTTGGAACAGTTTTGAGG + Intergenic
1113121020 13:106924065-106924087 CAGAGGATGAGGCAGCTCTCTGG + Intergenic
1113674630 13:112198785-112198807 CAGAGGCTGGGGCAGCTCCCCGG + Intergenic
1116742568 14:48775733-48775755 CAGAGGTTGGAACAGTTTCTAGG + Intergenic
1117907409 14:60604946-60604968 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
1117908327 14:60612810-60612832 CAGAGGTTGGAGCAGTTTGGAGG - Intergenic
1118388231 14:65274532-65274554 CAGAAGTGGGGACAGCATTTTGG - Intergenic
1119436159 14:74599333-74599355 CAGGGGCTGGGGCTGCTTTGGGG - Intronic
1119646160 14:76350084-76350106 CAGAAGTTGGGGCAGGTTGGTGG - Intronic
1119789021 14:77332456-77332478 CAGAGATTGGGGTAGCTTCTGGG + Intergenic
1120063977 14:80018204-80018226 CAGGGGTTAGGGCAGGTGTTAGG + Intergenic
1120153892 14:81069588-81069610 CAGAGGTTTAGGCATCTATTAGG + Intronic
1120791022 14:88582099-88582121 CAGAGGTTGGCAAATCTTTTAGG - Intronic
1121445626 14:93977098-93977120 CTGAGCTTGTGGCAGCATTTGGG + Intergenic
1121494224 14:94380825-94380847 AAGAGGTGTGGGCAGCTTCTTGG + Intronic
1122337266 14:101001974-101001996 CAGAGGCAAGGGCAGCTTTCGGG - Intergenic
1123403069 15:20005088-20005110 CAGGGGGTGGGACACCTTTTAGG + Intergenic
1123512408 15:21011742-21011764 CAGGGGGTGGGACACCTTTTAGG + Intergenic
1125279167 15:38026154-38026176 CAGAGGTTGGAACAGTTTTGAGG + Intergenic
1125511101 15:40292853-40292875 CACAGGGTGGGGCAGCTTCTGGG - Intronic
1128879557 15:71230863-71230885 CAGAGGAAGAGGCATCTTTTTGG - Intronic
1129029671 15:72609204-72609226 CAGGGGATGGGGCAGCTGGTTGG - Intergenic
1129037607 15:72660236-72660258 CAGGGGATGGGGCAGCTGGTTGG - Intronic
1129212280 15:74076989-74077011 CAGGGGATGGGGCAGCTGGTTGG + Intronic
1129398117 15:75264090-75264112 CAGGGGATGGGGCAGCTGGTTGG - Intronic
1129401728 15:75288371-75288393 CAGGGGATGGGGCAGCTGGTTGG - Intronic
1129729409 15:77921307-77921329 CAGGGGATGGGGCAGCTGGTTGG + Intergenic
1129839107 15:78732663-78732685 CAGGGGATGGGGCAGCTGGTCGG - Intergenic
1131029381 15:89173764-89173786 CAGAGGCTGGGGCAGTTTGCAGG - Intronic
1133030770 16:3009996-3010018 CACAGGTTTGGGCAGCTGTCAGG - Intergenic
1133554256 16:6889776-6889798 CAAAGGTTGGGTGAGATTTTAGG + Intronic
1134622033 16:15696765-15696787 CAGAGGCTGGGCCACCTGTTCGG - Exonic
1137706949 16:50542170-50542192 CAGGGGTTGGAGCAGCTTCTTGG - Intergenic
1138183371 16:54958318-54958340 CAGGCGATGGGGCAGCTCTTTGG - Intergenic
1139262180 16:65605095-65605117 CCCAGGTTGGGGCAGGTGTTGGG + Intergenic
1139968093 16:70756630-70756652 CAGAGGCTGGGACAGCCCTTGGG + Intronic
1140866859 16:79069917-79069939 CAAAGGTTTGGGTAACTTTTTGG - Intronic
1141798025 16:86287471-86287493 CAGAGGCTGCGGCAGCTGGTGGG - Intergenic
1142204508 16:88776519-88776541 CAAAGGCTGGGGCAGCTAGTGGG - Intronic
1142519323 17:493935-493957 CAGTGTTTGGTGCAGCTTATTGG - Intergenic
1142765492 17:2061871-2061893 GACGGGTTTGGGCAGCTTTTGGG - Intronic
1143333880 17:6158197-6158219 CACAGGTGGGGGCATCTTGTGGG + Intergenic
1144726606 17:17505545-17505567 CAGAGGCTGGAGCAGATGTTGGG + Exonic
1145890060 17:28407908-28407930 CACAGGTGGGGGCAGCTTGCAGG - Intergenic
1147656613 17:42094809-42094831 CAGCGGTTGGTTAAGCTTTTGGG - Intergenic
1148809461 17:50280715-50280737 CAGAGCTGGGGGCAGCTTGATGG + Exonic
1149052806 17:52326411-52326433 CAGAGGTTGGAACAGTTTGTAGG - Intergenic
1149112454 17:53049481-53049503 CAGAGGTTGGGACAGTTTGGAGG - Intergenic
1149158871 17:53666924-53666946 CAGAGGTTGGGACAGTTTGAAGG + Intergenic
1149291915 17:55225724-55225746 CAGAAACTTGGGCAGCTTTTAGG - Intergenic
1149454209 17:56774473-56774495 CAGAGGGTGGGGAAGCTTGGTGG + Intergenic
1149804477 17:59602263-59602285 CTGAAGTTGGGGCAGTTGTTGGG + Intronic
1151354337 17:73549649-73549671 CAGAGATGGGGGCAAGTTTTAGG + Intronic
1152939414 17:83160338-83160360 CAGAGTGAGGGGTAGCTTTTGGG - Intergenic
1153225010 18:2893207-2893229 CAGAGTTGGGGTCAGATTTTTGG + Intronic
1154049667 18:10942262-10942284 CAGAGGTTGGAACAGCTTAGAGG + Intronic
1154376164 18:13811778-13811800 CAGATGTTGGAGCAGATTTCTGG + Intergenic
1155250379 18:23948134-23948156 CACAGGATGGGGCAGGATTTGGG + Intronic
1155632237 18:27906968-27906990 CAGAGGTTGGGACAGTTTAGAGG - Intergenic
1156149294 18:34223717-34223739 CAGTGGCTGGGGAAGCTTCTGGG - Intronic
1156607306 18:38681091-38681113 CAGAGGTTGGAACAGCTTGAGGG - Intergenic
1156683755 18:39619818-39619840 CAGAGGTTGGAACAGTTTGTGGG - Intergenic
1157722973 18:49939608-49939630 CAGAGGTTGGAGCAGGATTCCGG - Intronic
1157931241 18:51825858-51825880 CAGAGGTGGGGCCAGGTGTTAGG - Intergenic
1158696752 18:59710404-59710426 CAGGGGTTGGGGGAACTTATAGG - Intergenic
1159012491 18:63071227-63071249 TAGAGTTTGGGGCAACTCTTCGG - Intergenic
1159180368 18:64894220-64894242 CAGAGGTTGGGGCAGTTTCAAGG - Intergenic
1159265601 18:66074548-66074570 CAGAGGTTGGAGCAGTTTGGAGG - Intergenic
1159325168 18:66905121-66905143 CAGAGGTTGGAACAGTTTGTAGG + Intergenic
1159525289 18:69581178-69581200 CAGGGGTTGGGGCATCTTGGAGG + Intronic
1159770997 18:72544589-72544611 CAGAGGTCAGCGCTGCTTTTGGG - Intronic
1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG + Intronic
1162794935 19:13082062-13082084 GAGAGGTGGGGGCAGCATCTGGG + Intronic
1163296655 19:16417120-16417142 CAGAGCCTGTGGCAGCTTTGTGG - Intronic
1163427642 19:17247967-17247989 AAGGGGGTGGGGCAGCCTTTGGG - Intronic
1164213825 19:23125322-23125344 CAGAGGTTGGAGCAGTTTGGAGG + Intronic
1165476184 19:36032387-36032409 CAGAGTTGGGGGCAGCCTTCAGG + Exonic
1165597787 19:37025188-37025210 AAGAGTGTGGGGAAGCTTTTAGG - Intronic
1165673437 19:37699510-37699532 AAGAGTGTGGGGAAGCTTTTAGG - Exonic
1166104608 19:40591054-40591076 CCGTGGTGGGGGCAGCTTTGTGG + Exonic
1167652832 19:50742448-50742470 CTGAGGTGGGGGCAGTTTTGTGG - Intergenic
1167981147 19:53276774-53276796 CTGAGGTCTGGGCAGCATTTGGG - Intergenic
1168413820 19:56156548-56156570 CAGAGGTGGGGGAAGATTTAAGG + Intronic
925981635 2:9181910-9181932 CTGAGGTGGGGACAGCTTTCAGG + Intergenic
928394746 2:30934841-30934863 CAGAGCTTGGGGCAGAGTTGGGG - Intronic
928444409 2:31320234-31320256 CAGGGATTGGGGCATCTTTGAGG - Intergenic
928474763 2:31615249-31615271 CAGAGGTTGGAGCAGGTTGGAGG + Intergenic
930419570 2:51134259-51134281 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
932318111 2:70799823-70799845 CAGAGATTGGAACAGCTTTGAGG - Intergenic
933673903 2:85036015-85036037 CAGGGGTAGGGGCAGGTGTTTGG + Intronic
934918698 2:98322763-98322785 CAGGGATTTGGGCAGCTTTGAGG - Intergenic
936392044 2:112084095-112084117 CTGAGGTTGTGGGAGCTTGTGGG - Intronic
936800388 2:116258660-116258682 CAGAGGTTGGGACAGTTTCAAGG - Intergenic
937223280 2:120353982-120354004 CAGAGGTGGGGCCAGCATTTAGG + Intergenic
938510531 2:131937446-131937468 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
939559387 2:143714930-143714952 CAGAGGTTGGAGCAGTTTGGAGG - Intronic
940330049 2:152464870-152464892 CAGAGATTAGGGCAATTTTTTGG - Intronic
940764292 2:157773018-157773040 AAGTGGTGGGGGCAGCTTATAGG + Intronic
941650889 2:168091465-168091487 CAGGACTTGGGGCAGCTTTCTGG - Intronic
942144562 2:173014054-173014076 CAGAGATTCGGGCAGAATTTTGG + Intronic
942700832 2:178708042-178708064 CAGAGGCTGGGGCAATTTGTGGG - Intronic
943154050 2:184150246-184150268 CAGAGGTTGGGACAGTTTGGAGG - Intergenic
943386606 2:187209843-187209865 CAGAGGTTGGAACAGTTTGTAGG + Intergenic
945709385 2:213277389-213277411 CAGAGGTTGGAACAGCTTGGAGG + Intergenic
946930225 2:224663431-224663453 CAGAGGTTGGCGCAGTTTGGAGG - Intergenic
947008624 2:225540183-225540205 CAGAGGTTGGAACAGTTTTGAGG - Intronic
947306066 2:228749015-228749037 CAGAGGTTGGGACAGAGTTCTGG - Intergenic
948254397 2:236555554-236555576 CAGAGCTGAAGGCAGCTTTTAGG - Intergenic
948561220 2:238854529-238854551 GAGGGGTTAGGGCAACTTTTTGG + Intronic
948899149 2:240947391-240947413 CTGAGGTAGGGGCAGCTGTCAGG - Intronic
1170725154 20:18919591-18919613 CAGAGGTTGGAACAGCTTGGAGG + Intergenic
1172796020 20:37538263-37538285 CAGAGGCTGGTGCAGCTTGAAGG + Intergenic
1173311953 20:41904643-41904665 CAAAGGTGGGGGCAGGTTATAGG - Intergenic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1174534055 20:51237217-51237239 CAGAAGTTGGGGGAGTCTTTTGG + Intergenic
1175962817 20:62645726-62645748 CAGTGGCTGGGGTCGCTTTTGGG + Intronic
1176018429 20:62950665-62950687 CAAAGGTGGGGGCACCTTTCGGG - Intergenic
1176524392 21:7854857-7854879 CAGAGGCTGGGAAAGCTATTCGG + Intergenic
1176888489 21:14285096-14285118 CAAATGTTGAGGCAGCTTTTTGG - Intergenic
1177098186 21:16865724-16865746 CTGATGTTTGGCCAGCTTTTTGG + Intergenic
1177570371 21:22878342-22878364 CAGAGGTTGGAACAGTTTTGAGG - Intergenic
1178658412 21:34484870-34484892 CAGAGGCTGGGAAAGCTATTCGG + Intergenic
1180958615 22:19752162-19752184 CCCAGGCTGGGGCAGGTTTTGGG - Intergenic
1182042202 22:27247011-27247033 CAGAGGTATGGGCAGAATTTAGG + Intergenic
1182422999 22:30257595-30257617 CACAGGTTGGGGCAGGGTCTTGG + Intergenic
1182623651 22:31630943-31630965 CAGAGGGGGCGGCAGCTTTAAGG - Intronic
1182686077 22:32122444-32122466 CACAGGTTGGGGGCGCTATTGGG + Intergenic
1184652459 22:45925448-45925470 AAGAGGGCGGGGCAGCTTTGGGG + Intronic
951683534 3:25320120-25320142 TAGAGGTTGGGGTGACTTTTGGG - Intronic
953835543 3:46339899-46339921 CAGAGGTTGGAGCAGTTTGGAGG - Intergenic
953864854 3:46575419-46575441 CAGAGCCTGGGCCAGGTTTTGGG - Intronic
954025547 3:47780745-47780767 CAGAGGCTGGGGAGCCTTTTCGG + Intronic
954335149 3:49911929-49911951 CAGAGGATGGGGCAGCTTCTGGG - Exonic
957534079 3:81478302-81478324 CAGAGTTTGGGGCTGCTTACTGG - Intergenic
958149310 3:89670043-89670065 CAGAGGTTGGAACAGCTTGGAGG + Intergenic
958175483 3:89990806-89990828 CAGAGGTTGGAACAGTTTTGAGG + Intergenic
958582627 3:96045849-96045871 CAGAGGTTGGAGCAGTTTTGAGG - Intergenic
961351714 3:126308414-126308436 CAGGGCTTGGGGTAGCCTTTGGG - Intergenic
961412313 3:126731300-126731322 CAGAGGTGTGGCCAGCTCTTGGG - Intronic
961813454 3:129535007-129535029 CAGAGATGTGGCCAGCTTTTTGG - Exonic
962339595 3:134570651-134570673 CAGAGGTTGGAACAGCTTGGAGG - Intronic
963433822 3:145242693-145242715 CAGAGGTTGGAGCAGTTTGGAGG - Intergenic
964123203 3:153207607-153207629 CTGAGGTTTGGGCAGTTTTAAGG + Intergenic
964150954 3:153523201-153523223 CAGAGGTTGGAACAGTTTTGAGG - Intergenic
964605865 3:158559383-158559405 CAGAGGTTGGAGCAGTTTAGAGG + Intergenic
964723103 3:159787448-159787470 CAGATGCTGGGGCAGCCTCTGGG - Intronic
964851548 3:161101503-161101525 TAGAGGTTGGGGCAGCAGTGGGG + Intronic
965044423 3:163557389-163557411 CAGAGGCTGGGGCAGAGTTCTGG - Intergenic
965649393 3:170918366-170918388 CAGAGGCTGGGGCAGTTTGGAGG + Intergenic
966446683 3:180008435-180008457 CAGAGGTTGGAACAGCTTGGAGG - Intronic
967559814 3:190904879-190904901 CAGAGGTTGGGACAGTTTGGAGG + Intergenic
967609049 3:191482501-191482523 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
967634479 3:191785014-191785036 CAGAGGTTGGAACAGTTTGTAGG - Intergenic
968387411 4:154356-154378 CAGAGGTTGGAACAGCTTGGAGG + Intronic
968488946 4:879806-879828 CTGAGGTGGAGGCAGCTCTTGGG + Intronic
969183740 4:5460640-5460662 CAGAGGCAGGGGCTTCTTTTAGG + Intronic
969341854 4:6547029-6547051 CTGGGGTTGGGGGAGCATTTGGG + Intronic
969564766 4:7971259-7971281 CAGAGACTGGGCCAGCTTTCTGG + Intronic
969707296 4:8818934-8818956 TAGAGGGTGGGGCAGCCTCTTGG + Intergenic
970222425 4:13824640-13824662 CAGAGGTTGGGACAGTTTGGAGG + Intergenic
970868256 4:20783238-20783260 CAGAGGTTGGAACAGCTTGGAGG - Intronic
971159468 4:24119215-24119237 CAAAGGTGGGGGCAGCATTTCGG - Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
972210199 4:36827108-36827130 CAGAGGTTGGAACAGCTTGGAGG + Intergenic
972254207 4:37335760-37335782 CAGAGGTAGGGGCATGGTTTGGG - Intronic
972930172 4:44062754-44062776 CAGAGGTTGGAACAGTTTGTGGG + Intergenic
974219555 4:58948671-58948693 CAGAGGTTGGAACAGTTTGTAGG - Intergenic
975038230 4:69710966-69710988 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
975311907 4:72912914-72912936 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
975403243 4:73961575-73961597 CAGAGGTTGGAACAGTTTTGAGG + Intergenic
977395851 4:96469543-96469565 CAGAGGTTGGAGCAGTTTGAAGG - Intergenic
977471291 4:97446962-97446984 CAGAGGTTGGAGCAGTTTGGAGG + Intronic
980448738 4:132944266-132944288 CAGAGGTTGGGACAGTTTGGAGG - Intergenic
980532670 4:134074505-134074527 CAGAGGTTAGGACAGTTTTGGGG - Intergenic
980720500 4:136688290-136688312 CAGAGGTTGGAGCAGTTTGGAGG - Intergenic
981016770 4:139981744-139981766 GAGAGGATGGGCCAGCTATTTGG + Intronic
981200476 4:141973730-141973752 CAGAGGTTGGGACAGATTGGAGG - Intergenic
981492710 4:145357212-145357234 CAGAGGCTGGGGCAGGTAGTAGG + Intergenic
981761272 4:148197963-148197985 TTGAGGTTGGGGCAGCTTTTTGG + Intronic
981787033 4:148491137-148491159 CAGAGTTTGGAGCATGTTTTGGG + Intergenic
982056604 4:151555996-151556018 AAAAGGTTGTGGCAGCTTTTTGG + Intronic
986137979 5:5000433-5000455 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
986202279 5:5589421-5589443 CAGAGATTGGTGCAGCTGTGGGG + Intergenic
986258807 5:6124688-6124710 CAGAGGTTGGAACAGTTTGTGGG - Intergenic
987260487 5:16197242-16197264 CAGAGGTTGGAGCAGTTTGGAGG - Intergenic
987659465 5:20854219-20854241 CAGAGGATGGAGCAGTTTGTAGG + Intergenic
988080580 5:26410092-26410114 CAGAGGTTGGGACAGTTTGGAGG + Intergenic
988316419 5:29635295-29635317 CTGAGGTTGGTGCAGCCTTCTGG - Intergenic
988427691 5:31082700-31082722 CAGAGTTGGGGGCAGCTTTATGG - Intergenic
988473295 5:31561301-31561323 AAGAGGATGGGGCATCTTTTGGG + Intergenic
989032906 5:37137421-37137443 CAGAGGTTGGAACAGTTTGTAGG - Intronic
989149108 5:38280700-38280722 CAGAGGTGTGAGCAGCTTTAAGG - Intronic
989535099 5:42553990-42554012 CTCAGGTGGGGGCAACTTTTGGG + Intronic
990005240 5:50937932-50937954 CAGAGGTTGGAGAAGCTTGGAGG + Intergenic
990595465 5:57308661-57308683 CAGAGGTTGGGACAGTTTAGAGG + Intergenic
990903730 5:60780454-60780476 CAGAGGTTGGAGCAGTTTGGAGG - Intronic
991399759 5:66240348-66240370 CAGCAGTTGGGGCAGGTTTTGGG + Intergenic
991409291 5:66330807-66330829 CAGAGGTTGGACCAGCTTGGAGG + Intergenic
991586977 5:68211567-68211589 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
992462127 5:76971013-76971035 AAAAGGATGGGGCAGCTTTCTGG + Intronic
992591423 5:78299928-78299950 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
993383242 5:87232377-87232399 CAGAGTTTGGAACAGCTTCTGGG + Intergenic
993481696 5:88431781-88431803 CAGAGGTTGGAACAGCTTAGAGG - Intergenic
993569645 5:89521619-89521641 CAGAGGTTGGAACAGTTTGTAGG - Intergenic
994474405 5:100249032-100249054 CAGAGGGTGGGGCAGTTTGGAGG + Intergenic
994580363 5:101633549-101633571 CAGAGGTTGGAGTAGTTTGTAGG - Intergenic
995429015 5:112054037-112054059 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
997116020 5:131126554-131126576 CAGAGGTTGGAACAGCTTGGAGG + Intergenic
998904481 5:146889788-146889810 CAGAAGTTAGGGCAGTTTTCGGG + Intronic
1001294491 5:170489457-170489479 CAGGGGTTGGGGCAGCCCTGGGG - Intronic
1001918281 5:175580098-175580120 CAAAGGTTGGGACATGTTTTAGG - Intergenic
1002167842 5:177359184-177359206 AAGAGGTAGAGGCAGGTTTTGGG - Intronic
1002271968 5:178078442-178078464 CAGAGGTGGGGGCCGTGTTTAGG - Intergenic
1003308185 6:4947173-4947195 GAGGGGATGGGGCAGGTTTTGGG + Intronic
1006062869 6:31438473-31438495 CAGAGGTTGGGACAGGTTAGAGG + Intergenic
1006094856 6:31649464-31649486 CAGAGGTTGGGGCTACTGTCTGG - Intronic
1006240302 6:32672168-32672190 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
1007504063 6:42320873-42320895 CAGAGATTGGGACAACTTTGTGG + Intronic
1008342572 6:50385271-50385293 CAGTGGTTGGGATAGGTTTTCGG + Intergenic
1008631598 6:53367341-53367363 CAGAGGTTGGGACAGTTTGGAGG - Intergenic
1008679884 6:53861010-53861032 CAGACACTGGGGCCGCTTTTAGG + Intronic
1010630295 6:78190490-78190512 CAGAGGTTGGAGCAGTTTGGAGG - Intergenic
1010645940 6:78387615-78387637 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
1011088522 6:83570060-83570082 CAGAGGTTGGGACAGTTTGGAGG + Intronic
1011492256 6:87904227-87904249 CAGAGGTTGGGGGAGGGTTAAGG + Intergenic
1011631498 6:89330140-89330162 CATAAGTTAGGACAGCTTTTTGG + Intronic
1014342064 6:120222912-120222934 CAGAGATTGAGGTAGGTTTTTGG - Intergenic
1014731050 6:125031759-125031781 CAGAGGTTGGAACAGCTTGGAGG - Intronic
1015751228 6:136561271-136561293 GAGAGGTTGGGGAAGGTTGTTGG - Intronic
1015890074 6:137961617-137961639 CAGAGGTTGGCAAAGTTTTTTGG - Intergenic
1016589405 6:145728294-145728316 CAGAGGTTGGGACAGTTTGGAGG + Intronic
1019357030 7:585828-585850 GAGAGGCGGGGGCAGCTTTGGGG - Intronic
1019503932 7:1381168-1381190 CAGAGCCTGGGGCAGCTCATGGG + Intergenic
1019624734 7:2010264-2010286 CAGAGGCTCGGGCAGCTCTGCGG - Intronic
1021400847 7:20208290-20208312 CAGAGGTTGGAACAGTTTTGAGG + Intronic
1022747888 7:33191075-33191097 CAGAGGTCAGGGGAGCTTTCTGG + Intronic
1024417564 7:49124916-49124938 CAGTGCTTGGGGCATCTTATCGG + Intergenic
1024487071 7:49931292-49931314 CAGAGGTTGGGACAGTTTGGAGG + Intronic
1024933586 7:54689911-54689933 AAATGGTTGAGGCAGCTTTTGGG + Intergenic
1025300465 7:57815905-57815927 CAGAGGTTGGAACAGTTTGTAGG - Intergenic
1027695545 7:81405368-81405390 CAGAGGTTGGAACAGCTTGGTGG - Intergenic
1028653230 7:93173786-93173808 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
1031529806 7:122862620-122862642 CAGAGGGTTGGGCAGGATTTAGG - Intronic
1032053058 7:128661706-128661728 CAGAGGTTGGAACAGTTTTGAGG + Intergenic
1032484224 7:132271535-132271557 CAGAGGCTGAGGCACCTCTTTGG + Intronic
1032841097 7:135714264-135714286 CAGGAGTTGGGCCAGCTTCTGGG - Intronic
1033716569 7:144008923-144008945 CAGAGGTTGGAACAGCTTGGAGG + Intergenic
1034554897 7:151844114-151844136 CAGGGGTTGGGGAAGCCCTTGGG + Intronic
1035132301 7:156666958-156666980 CAGATGCTGGGGCGGCTTTAGGG + Intronic
1038996431 8:32928156-32928178 CAGAGATTTGGGCAGCATTAAGG - Intergenic
1039202860 8:35116091-35116113 CAGAGGATGGGGCAGGCTTGTGG + Intergenic
1041588179 8:59545926-59545948 GAGAAGTTGGGGGAACTTTTTGG + Intergenic
1042029207 8:64456472-64456494 CAGATGGTGGGGCATCTATTTGG - Intergenic
1042175617 8:66034784-66034806 CAGAGGTGGGGGCAGGTGTCTGG + Intronic
1042338549 8:67654656-67654678 CATGGGTTGGGGCAGAATTTAGG + Intronic
1043834851 8:85034311-85034333 CAGAGGTTGGAACAGTTTGTGGG - Intergenic
1044125397 8:88453027-88453049 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
1045214282 8:100130953-100130975 CAGAGGTTGGGACAGTTTGGAGG - Intronic
1046294691 8:112202109-112202131 TACAGTTAGGGGCAGCTTTTCGG - Intergenic
1047976418 8:130134946-130134968 CAGATGTTGGGGCTGCTCTCTGG + Intronic
1049181608 8:141225899-141225921 CGGAGGCTGGGGCAGCTGTGGGG - Intronic
1049206790 8:141367294-141367316 CAGCGCTTGGGGCTCCTTTTGGG + Intergenic
1049903253 9:190246-190268 CAGAGGTTGGAACAGTTTTGAGG - Intergenic
1051637457 9:19193965-19193987 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
1051914939 9:22197425-22197447 CAGAGGTTGGGTCAGTTTGGAGG + Intergenic
1053746263 9:41200529-41200551 CAGAGGTTGGAACAGTTTTGAGG - Intergenic
1054481003 9:65664688-65664710 CAGAGGTTGGAACAGTTTTGAGG + Intergenic
1054682082 9:68230751-68230773 CAGAGGTTGGAACAGTTTTGAGG + Intergenic
1055083592 9:72291491-72291513 CAGAGGTTGGAACAGTTTGTAGG - Intergenic
1057991886 9:99779041-99779063 CAGAGGGTTTGGCAGCTTGTGGG - Intergenic
1059023133 9:110597748-110597770 CAGAGGTTGGGACAGTTTGGAGG - Intergenic
1060021438 9:120134759-120134781 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
1060600683 9:124875506-124875528 CAGTGGTGGAGGCAGCTGTTGGG + Intronic
1061019657 9:128005969-128005991 CAGAGGCAGGGCCAGCATTTTGG - Intergenic
1061111694 9:128576907-128576929 CAGAGGCAGGGGAAGCTCTTTGG + Exonic
1061609583 9:131737625-131737647 CAGCGGTTTGGGCAGCTCATGGG + Intronic
1061912027 9:133729994-133730016 CAGAGGTGGGAGCAGGTTTAGGG + Intronic
1061954327 9:133953698-133953720 CACAGGGTGGGGCACCTTTCCGG + Intronic
1062014698 9:134285194-134285216 CAGAGGTGAGGGGAGCTTTCCGG - Intergenic
1062044415 9:134418449-134418471 CAGAGGTTGGGGCAACCTCATGG - Intronic
1062598575 9:137310079-137310101 CAGGGGTTGGGGCAACTATGGGG - Intronic
1202782393 9_KI270718v1_random:11302-11324 CAGAGGTTGGAACAGTTTTGAGG - Intergenic
1186266156 X:7836208-7836230 CAGAGACAGGGGAAGCTTTTGGG + Intergenic
1186992331 X:15083782-15083804 CAGAGGTTGGGACAGTTTGGAGG + Intergenic
1187626805 X:21123738-21123760 CAGAGGTGGGGGCAGTCTTGTGG - Intergenic
1187894517 X:23967741-23967763 CAGAGGTTGGAGCAGTTTGAAGG - Intergenic
1188169817 X:26911024-26911046 CAGAGGTTGGAACAGCTTGGAGG + Intergenic
1189028939 X:37429657-37429679 CAGAGGTTGGGACAGTTTGGAGG - Intronic
1189078612 X:37944488-37944510 AAGGGGTTGGGGCAGTTTTGTGG - Intronic
1191094804 X:56662621-56662643 CAGAGGTTGGGACAGTTTGGAGG + Intergenic
1191116519 X:56858528-56858550 CAGAGGTTGGAACAGTTTTGAGG - Intergenic
1191183237 X:57583757-57583779 CAGATGTTGGTGCAGTTTTGTGG + Intergenic
1191211551 X:57890215-57890237 CAGAAGTTGGAACAGTTTTTAGG - Intergenic
1192174717 X:68878485-68878507 CTGGGGTAGGGGCAGGTTTTCGG + Intergenic
1193066292 X:77264068-77264090 CAGAGGTTGGAGCAGTTTGGAGG + Intergenic
1193344803 X:80393007-80393029 CAGAGGTTGTTGTAGCTTCTTGG - Intronic
1193655412 X:84190808-84190830 CAGAGGTTGGAACAGCTTGGAGG + Intergenic
1193840794 X:86405647-86405669 CAGAGGTTGGAACAGTTTTGAGG - Intronic
1194169381 X:90563431-90563453 CAGAGTTTGGAGCAGTTTTGAGG + Intergenic
1194372212 X:93088216-93088238 CAGAGGTTGGAACAGTTTGTAGG + Intergenic
1194484722 X:94472781-94472803 CAGAGGTTGGGACAGTTTGGAGG + Intergenic
1194778302 X:97992215-97992237 CAGAGGTTGGGACAGTTTGGAGG - Intergenic
1196853472 X:119961134-119961156 CAAGGGTGGGGGCAGCTTTAAGG - Intergenic
1197040843 X:121933451-121933473 CAGAGGTTGGAACAGCTTGAAGG - Intergenic
1198419190 X:136452056-136452078 CAGAGGTTAGGCCAGTCTTTGGG + Intergenic
1198438066 X:136636351-136636373 CAGGGGAAGGGGCAGCTTTAGGG + Intergenic
1198729185 X:139709074-139709096 CAGAGGATGGGGCAGGGTTTTGG - Intergenic
1198836182 X:140806977-140806999 CAGAGGTTGGAACAGCTTGGAGG - Intergenic
1199807530 X:151315180-151315202 CAAGGGTTGGGGCATCTTTCTGG - Intergenic
1200680266 Y:6202260-6202282 CAGAGGTTGGAACAGTTTGTAGG + Intergenic
1201452843 Y:14135086-14135108 CAGAGACAGGGGAAGCTTTTGGG - Intergenic
1201590105 Y:15605233-15605255 CAGAGGTTGGAACAGTTTTCAGG - Intergenic