ID: 1161428493

View in Genome Browser
Species Human (GRCh38)
Location 19:4217410-4217432
Sequence CCGCGGCCTCGCACTTCCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161428493_1161428505 29 Left 1161428493 19:4217410-4217432 CCTGGGGAAGTGCGAGGCCGCGG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161428505 19:4217462-4217484 GTCCGCGAGGCCGAGGGCAGCGG 0: 1
1: 0
2: 1
3: 19
4: 335
1161428493_1161428502 16 Left 1161428493 19:4217410-4217432 CCTGGGGAAGTGCGAGGCCGCGG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161428502 19:4217449-4217471 GCTGCGAGAGCGTGTCCGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 30
1161428493_1161428497 -10 Left 1161428493 19:4217410-4217432 CCTGGGGAAGTGCGAGGCCGCGG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161428497 19:4217423-4217445 GAGGCCGCGGAGGCCGAGGCAGG 0: 1
1: 0
2: 7
3: 101
4: 823
1161428493_1161428506 30 Left 1161428493 19:4217410-4217432 CCTGGGGAAGTGCGAGGCCGCGG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161428506 19:4217463-4217485 TCCGCGAGGCCGAGGGCAGCGGG 0: 1
1: 0
2: 2
3: 20
4: 208
1161428493_1161428503 22 Left 1161428493 19:4217410-4217432 CCTGGGGAAGTGCGAGGCCGCGG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161428503 19:4217455-4217477 AGAGCGTGTCCGCGAGGCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1161428493_1161428499 -6 Left 1161428493 19:4217410-4217432 CCTGGGGAAGTGCGAGGCCGCGG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161428499 19:4217427-4217449 CCGCGGAGGCCGAGGCAGGCCGG 0: 1
1: 1
2: 0
3: 75
4: 1068
1161428493_1161428504 23 Left 1161428493 19:4217410-4217432 CCTGGGGAAGTGCGAGGCCGCGG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161428504 19:4217456-4217478 GAGCGTGTCCGCGAGGCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161428493 Original CRISPR CCGCGGCCTCGCACTTCCCC AGG (reversed) Exonic