ID: 1161429654

View in Genome Browser
Species Human (GRCh38)
Location 19:4224264-4224286
Sequence CCTTCTGTACAGTGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161429644_1161429654 25 Left 1161429644 19:4224216-4224238 CCCGGTGGCTTTGGGCATACCAC 0: 1
1: 0
2: 1
3: 20
4: 141
Right 1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 237
1161429645_1161429654 24 Left 1161429645 19:4224217-4224239 CCGGTGGCTTTGGGCATACCACT 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 237
1161429646_1161429654 6 Left 1161429646 19:4224235-4224257 CCACTGTTGCTCTCTGAGCCTCA 0: 1
1: 1
2: 10
3: 94
4: 518
Right 1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161429654 Original CRISPR CCTTCTGTACAGTGGGAGGC TGG Intronic
901068177 1:6504464-6504486 CCTCCTCCACAGTGGGGGGCTGG + Intronic
902600823 1:17539507-17539529 CCCCCTGTACTGTGGGGGGCCGG + Intergenic
903287534 1:22286148-22286170 CCATCTGTTAAATGGGAGGCAGG - Intergenic
904343498 1:29853195-29853217 ACTTCTGTCCCGGGGGAGGCTGG - Intergenic
904465707 1:30706112-30706134 CTTTCTGTGCAGTGAGCGGCAGG + Intergenic
904697745 1:32339667-32339689 TCATCTGTACAGTGAGAGGTTGG + Intergenic
905861738 1:41356691-41356713 CCTTCTGTACCATGGGAAGGAGG - Intergenic
906258250 1:44367150-44367172 CCTTCTGTCCAGTGAGGGGCAGG - Intergenic
906518295 1:46452478-46452500 CCCTCTGGACCATGGGAGGCAGG - Intergenic
907477687 1:54716436-54716458 CCTTCTGTAAAATGGGAGTGTGG - Intronic
907871063 1:58443275-58443297 CCTCCTGTACTGTGAGAGGCTGG - Intronic
908268325 1:62399659-62399681 CCCCTTGTACAGTGGGAGCCAGG - Intergenic
909504692 1:76375203-76375225 CCTTCTGTACAATGGAAGTAAGG - Intronic
910240220 1:85078517-85078539 CCTCCAGCAGAGTGGGAGGCTGG - Intronic
911454668 1:98108279-98108301 CTTTCAGTAAAGTGGGAGGATGG + Intergenic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
914747376 1:150510157-150510179 CCTTCTGTTCATTGGGGTGCTGG - Exonic
916010612 1:160702284-160702306 CCTCCTCCACAGTAGGAGGCGGG - Intronic
918636662 1:186782875-186782897 CCTTCTCTGCAGTGAGAGGCAGG + Intergenic
920300503 1:204985888-204985910 CCTTCGGGACAGAGGCAGGCTGG - Intronic
920713378 1:208316695-208316717 CCATCTGGAGAGTTGGAGGCAGG + Intergenic
921068833 1:211642482-211642504 CCTTGGGAACAGGGGGAGGCTGG + Intergenic
921696105 1:218213025-218213047 CCTTCTGCACAGTATGAAGCTGG + Intergenic
1063251826 10:4282331-4282353 CCATCAGGACTGTGGGAGGCAGG - Intergenic
1063459929 10:6208775-6208797 CCACCTGGACAGTGAGAGGCTGG - Intronic
1068164332 10:53308582-53308604 CTTTCTGCATAGTGGGAGGTTGG - Intergenic
1068223844 10:54080821-54080843 CCTTCTGTACTGTAGGAAGCTGG - Intronic
1068290496 10:54996032-54996054 CTTTCTGTGCAGTGGGGAGCAGG + Intronic
1069619393 10:69827280-69827302 CCTACTGGACAGAGGGAGCCGGG - Intronic
1070766882 10:79061812-79061834 CATTCTGTTCAGTGGGATTCTGG + Intergenic
1073051413 10:100669748-100669770 CCATCTGTACAGTGGGAAGCAGG - Intergenic
1074432633 10:113406888-113406910 GCTTCTGTGCAGTGTGGGGCTGG + Intergenic
1076450771 10:130555570-130555592 CCCTCTTGACAGTGGAAGGCAGG - Intergenic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1078109558 11:8381671-8381693 CTTGCTGTACAGTGAGGGGCTGG + Intergenic
1078924170 11:15859110-15859132 GCATCTGTATAGTGTGAGGCTGG - Intergenic
1081771554 11:45653257-45653279 CCATCTGAACAGTGGGAGTGAGG - Intronic
1082775308 11:57240206-57240228 CATTCTGTACAGTGGGGGCTGGG + Intergenic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1085205557 11:74730211-74730233 CCTTCTAGACAATGTGAGGCAGG + Intronic
1085410746 11:76289000-76289022 CCTTCTGTACACTGGGATCCTGG - Intergenic
1089539797 11:119182949-119182971 GCTGCTGGCCAGTGGGAGGCAGG - Intronic
1089565784 11:119370879-119370901 CCTTCTGGAGAGTTGGAGGGCGG + Intronic
1090823347 11:130364787-130364809 CCTTGTGTATGGTGGGAGGTGGG + Intergenic
1091018176 11:132073079-132073101 CCTTCTGTCCTGTGGGCTGCTGG + Intronic
1092168777 12:6360308-6360330 CTTTCTGTTGAGGGGGAGGCAGG + Intronic
1103135141 12:118500455-118500477 GCTGCTGTGCTGTGGGAGGCGGG + Intergenic
1104778377 12:131404522-131404544 CCTTCTGGACAGAGGCAGTCGGG - Intergenic
1105432773 13:20352202-20352224 CCTCCTGTACAGTGGGTGTGTGG + Intergenic
1105882143 13:24614532-24614554 CCTCCTGGACAGAGAGAGGCAGG + Intergenic
1107806217 13:44156239-44156261 CCTTCTGTTTTGTGGGAGGCAGG + Intronic
1108522091 13:51255769-51255791 GCTGCTGCACAGGGGGAGGCTGG + Intronic
1109213941 13:59566075-59566097 CCATCTCTAGAGTGGGAGGCAGG + Intergenic
1111937760 13:94573851-94573873 CCCTAAGCACAGTGGGAGGCTGG + Intergenic
1113063963 13:106355679-106355701 CCTTCTGTTATGTGGGATGCAGG + Intergenic
1113109940 13:106812232-106812254 CCTTCTGTACAGGGTGGGGCTGG + Intergenic
1113449883 13:110401162-110401184 CCTTCTGTTAATTGGGAGGTGGG + Intronic
1113517467 13:110914670-110914692 CCGGCTGTCCAGTGGGAGTCGGG - Intronic
1117424737 14:55581323-55581345 CCTTCTTTCCTGTGGGAGGAAGG + Intronic
1118798671 14:69168746-69168768 CTTTCTGTACAGAGGAAGGAAGG - Intergenic
1120182813 14:81363060-81363082 CCTGGTATACTGTGGGAGGCTGG - Intronic
1121579416 14:95015962-95015984 CCTTCTGTACAACGAGAAGCAGG - Intergenic
1122025328 14:98871791-98871813 CCTTCTGTACAATGGGAAGTGGG - Intergenic
1125200504 15:37097847-37097869 ACTTCTGTATGGTGGGGGGCGGG - Intronic
1127368206 15:58310839-58310861 GCTTCTGTGCGCTGGGAGGCTGG - Intronic
1130353166 15:83108548-83108570 CCTGCAGTGGAGTGGGAGGCAGG - Intronic
1132585457 16:704259-704281 CCTTCTCATCAGTGGGAGGTAGG + Intronic
1133495033 16:6309722-6309744 GCTTCCCTACAGAGGGAGGCTGG + Intronic
1133964841 16:10523237-10523259 CCTTCTGTGGATTGGGAGCCTGG - Intergenic
1134475162 16:14567268-14567290 CCTTCTGGAATCTGGGAGGCTGG + Intronic
1134596092 16:15497121-15497143 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1136282310 16:29221028-29221050 CCGTCTCTGCAGTGGGGGGCAGG - Intergenic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1140635040 16:76902335-76902357 GCTTCTCTAAAGTGGGAGTCAGG - Intergenic
1140889601 16:79273690-79273712 AGTTCTTTACAGTGGGAGGGAGG - Intergenic
1141681864 16:85549512-85549534 CCTGCTGCACAGGGGCAGGCTGG + Intergenic
1142086682 16:88186946-88186968 CCGTCTCTGCAGTGGGGGGCAGG - Intergenic
1143363281 17:6388504-6388526 CCTTCTGTACACCGAGAGGCTGG + Intergenic
1143445580 17:7007035-7007057 CGTGCTGCACAGTGGCAGGCAGG - Intronic
1151458321 17:74239750-74239772 CCTTCTGTCCCTTGGGAGGGAGG - Intronic
1152019450 17:77772785-77772807 CCTTGTGTAGGGTGGGAGACTGG + Intergenic
1153893537 18:9539620-9539642 CCGTCTGTAAAATGGTAGGCAGG - Intergenic
1156245242 18:35291222-35291244 CCTTCTGTCAGGTGAGAGGCAGG + Intergenic
1160322825 18:77912358-77912380 CCCTCTGTATACTGGGAGGCAGG - Intergenic
1160442580 18:78903672-78903694 TCTTCTGAGCAGTTGGAGGCAGG + Intergenic
1160506202 18:79427949-79427971 GCCTCTGTGCAGTGGGTGGCGGG + Intronic
1160598565 18:79994885-79994907 CCTTCGGTTCAGTGAGTGGCAGG - Intronic
1160881995 19:1325107-1325129 CCATCTGTAAAGTGGGACCCAGG - Intergenic
1160948519 19:1654607-1654629 CCATCTGGACAGTGGAAGGGGGG + Intergenic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1163568688 19:18067380-18067402 GTCTCTGGACAGTGGGAGGCTGG - Intronic
1164719462 19:30421807-30421829 TCTCGTGTACAGAGGGAGGCTGG - Intronic
1165144794 19:33724300-33724322 CCTTCTGCACAGTGAGAGGATGG - Intronic
1165387753 19:35521414-35521436 CCTCCTGTATAAAGGGAGGCAGG - Intergenic
1166966483 19:46532155-46532177 CCTGCTGTGCAGTGGGAAGTAGG - Intronic
1168659713 19:58156102-58156124 CTTTCTGCACTTTGGGAGGCTGG + Intergenic
925286479 2:2719402-2719424 CCTTCCTCACAGAGGGAGGCAGG - Intergenic
926320679 2:11746689-11746711 CCTGCTCCACAGCGGGAGGCTGG - Intronic
926347116 2:11957563-11957585 CTTGCAGTACAGAGGGAGGCTGG + Intergenic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
929903939 2:46029759-46029781 CATCCTGTACAGAGGGAGTCAGG + Intronic
930353672 2:50290640-50290662 TCTGCTGTACAGTGGGAGTGTGG - Intronic
932469533 2:71944844-71944866 CCATCTGTAGAATGGGATGCAGG - Intergenic
932563725 2:72892842-72892864 CCTTCTGCACACTCAGAGGCAGG - Intergenic
932880688 2:75499196-75499218 TCTTTTGTAAAGTGGGAGGAAGG + Intronic
933106014 2:78326430-78326452 TCTTCTGTACAGTGGTAGTCTGG - Intergenic
934504609 2:94880518-94880540 CCCACTGTACTGTGGGATGCTGG - Intergenic
934561883 2:95317778-95317800 CCGCCTGCACAGTGGCAGGCAGG + Intronic
934996046 2:98961555-98961577 CCTACTGGAGAGTGGGAGGAGGG - Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
938248463 2:129796476-129796498 CCTTCACTGCAGTGGGAAGCTGG - Intergenic
940667634 2:156628094-156628116 ACTTCTGTGCAGTGGGGTGCTGG + Intergenic
941360915 2:164550236-164550258 CATTCTGTTCAGTGGGAGAATGG - Intronic
941684989 2:168439121-168439143 ACTTCTGTACATTAGGAGGCAGG + Intergenic
946554103 2:220835820-220835842 TCATGGGTACAGTGGGAGGCTGG - Intergenic
948082350 2:235216595-235216617 CCCACTGTGGAGTGGGAGGCAGG + Intergenic
948468032 2:238161484-238161506 CCTTCTGTACTCTGGGACCCTGG - Intronic
948810364 2:240472193-240472215 CCAGCTGTACGCTGGGAGGCAGG + Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1172480632 20:35269400-35269422 TCCTCGGGACAGTGGGAGGCTGG - Intronic
1172625472 20:36344128-36344150 CCATCTGAACAGTGGGAGTGTGG + Intronic
1173108180 20:40158244-40158266 CCTGCTATACTGAGGGAGGCAGG - Intergenic
1173617144 20:44410712-44410734 TCTTCTGTAAAGTGGGGAGCAGG - Intronic
1174062984 20:47845597-47845619 CGGTCTGCACAGTGGGAGGTTGG + Intergenic
1175247119 20:57588923-57588945 CCATCTGTAAAGTGGGACTCAGG - Intergenic
1175889466 20:62309924-62309946 CCTTCTGCAGAGCGGGAGCCAGG - Intronic
1176312181 21:5157944-5157966 CCTTCTGTGCCTTGGGATGCCGG - Intergenic
1176725102 21:10425085-10425107 CTTTCTGTAAAGTGGGAAGGGGG + Intergenic
1176870351 21:14078883-14078905 CCTTCCGTACCGTGGGCGGGCGG + Intergenic
1177214153 21:18106924-18106946 CCTTCTGTACACTTGGGTGCAGG - Intronic
1177561144 21:22755807-22755829 CCTTCTTCACAGTGGCAGGAAGG + Intergenic
1178698514 21:34814763-34814785 CCTGCAGTCCAGTGGCAGGCAGG - Intronic
1178835486 21:36094041-36094063 CTTTCTGTGCAGTGAGAAGCGGG + Intergenic
1179844867 21:44104086-44104108 CCTTCTGTGCCTTGGGATGCCGG + Exonic
1179930552 21:44568455-44568477 CCTTGGGTGCTGTGGGAGGCTGG + Intronic
1180091599 21:45536386-45536408 CCATCTGGTCAGTGGGTGGCAGG + Intronic
1180676122 22:17587634-17587656 CGTTCTGTACAGGGGCAGGCAGG - Intronic
1181388037 22:22558783-22558805 CCTTTTCTTCAGTGGGATGCGGG + Intronic
1181410104 22:22712577-22712599 CCTGCTGCAGGGTGGGAGGCTGG + Intergenic
1182371098 22:29811596-29811618 CCTCCAGCACAGTTGGAGGCTGG + Intronic
1182627667 22:31659899-31659921 CCTGCTGTAGTTTGGGAGGCTGG - Intronic
1183177286 22:36233283-36233305 TCCTGTGTACAGAGGGAGGCTGG + Intronic
1183192113 22:36328279-36328301 CCTCCTGTACTGGGGGAGGGTGG - Intronic
1183747645 22:39700780-39700802 CGTTCTGTCCAGTGGGATGTGGG - Intergenic
1184162213 22:42703690-42703712 CCTTCTGCACAGTGCGGGGAAGG + Intronic
1184183343 22:42846413-42846435 CCCACAGTCCAGTGGGAGGCAGG - Intronic
1185287556 22:50009350-50009372 CCTTCTGCCCCGTGGGAGCCTGG - Intronic
949588150 3:5463936-5463958 CCCTCTGCTGAGTGGGAGGCAGG + Intergenic
949808630 3:7982191-7982213 CATTTTATACAGTGGCAGGCAGG - Intergenic
951576897 3:24123402-24123424 CCTTCTGTACCCTAGGAGGGAGG - Intronic
952171866 3:30815974-30815996 TCGTCTGTACAGTGGGAAGGGGG + Intronic
952954987 3:38551312-38551334 GCTTATGTCAAGTGGGAGGCTGG - Exonic
953052053 3:39353462-39353484 CCTGCTGTAGGGTGGGAGGAGGG + Intergenic
953557518 3:43958501-43958523 ACTTCTCCAGAGTGGGAGGCTGG + Intergenic
954353464 3:50065087-50065109 CCTTCTTCACAGTAGGAGGCAGG - Exonic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
954655695 3:52192826-52192848 CCTTCTATACAGTGGTAGATGGG - Intergenic
955432977 3:58869430-58869452 ACTTCTCTACAGTGGACGGCTGG + Exonic
955643872 3:61115440-61115462 CCAACTGTCCAGTGGGAGGAAGG + Intronic
961314329 3:126024246-126024268 CCTTCTGTAAAATGGGGAGCTGG + Intronic
961664881 3:128488849-128488871 CAGTCTGTACAATGGGAGGGAGG - Intronic
961959524 3:130840037-130840059 CCTGCTGTTAAGTGGGGGGCGGG + Intergenic
965192448 3:165548953-165548975 ACTTCTGTATAGTGGGTGGTGGG + Intergenic
966143850 3:176787690-176787712 CCATCTGCACACTGGGAGGGTGG - Intergenic
968830352 4:2930423-2930445 CCCTCTGCACAGTGGCAGCCTGG - Intergenic
969078390 4:4598945-4598967 CCTTTTTGTCAGTGGGAGGCTGG + Intergenic
969258590 4:6019849-6019871 CCTAGTGTTCAGTGGGAGGAAGG + Intergenic
969663983 4:8546413-8546435 CTTTGAGTAGAGTGGGAGGCAGG - Intergenic
973900401 4:55464267-55464289 GCTTTTGTACAATGGGATGCAGG - Intronic
974877106 4:67714408-67714430 CCCTCTGCACACTGGGAGGGAGG - Intergenic
978495085 4:109350409-109350431 CTCTCAATACAGTGGGAGGCAGG - Intergenic
979231638 4:118353566-118353588 CCGGCTGGAAAGTGGGAGGCAGG - Intergenic
979621623 4:122804809-122804831 CTTTCTGTACACTGGGAGGAAGG - Intergenic
979894647 4:126144976-126144998 CCTTCAGTTAAGAGGGAGGCAGG - Intergenic
984755136 4:183318980-183319002 CCTTCTATACTGTCAGAGGCAGG - Exonic
985619880 5:948641-948663 CCTTCTGAAGCGTGGGAGGCGGG + Intergenic
992089572 5:73304954-73304976 TCTTGAGTACAGAGGGAGGCAGG + Intergenic
992366092 5:76091447-76091469 CATTCTGGGCAGTGAGAGGCAGG - Intronic
992896540 5:81250660-81250682 ACTTCAGTAGAGTGGGAGGGTGG + Intronic
998083376 5:139294599-139294621 CCTGCAGTACAGTGCGAGGCGGG + Intronic
998352348 5:141509675-141509697 TCTTCTGTACAGTGGGACGTTGG + Intronic
998651125 5:144122821-144122843 CCATCTGCACACTGGGAGGATGG - Intergenic
1000131031 5:158299814-158299836 ACTTCTTTACAGTGGAAAGCAGG + Intergenic
1002133120 5:177093283-177093305 GCTTCTGCACAGTGGCGGGCGGG - Exonic
1002196152 5:177502695-177502717 CCTTCTTAACAGTGCAAGGCAGG - Intronic
1002645911 5:180654339-180654361 CTTTCTGTATGGTGGGCGGCCGG - Intergenic
1003119769 6:3309833-3309855 CCTGCTGTGCAGTGAGGGGCTGG - Intronic
1003463502 6:6354161-6354183 TCTTCTGTAAAGTGGGAGTAGGG - Intergenic
1004000689 6:11594359-11594381 CCTTCGGTCCAGAGAGAGGCTGG - Intergenic
1006563590 6:34935065-34935087 TCTTCTGGACAGTGATAGGCTGG + Intronic
1006812135 6:36826878-36826900 CCATCTGTAAAGTGGGGGGTGGG + Intronic
1007243491 6:40443564-40443586 CCTTTTGCAAAGTGGGAGGAAGG - Intronic
1007903113 6:45430318-45430340 ACTTGAGTACATTGGGAGGCTGG + Intronic
1007922959 6:45627231-45627253 CCGTGTGTACAGAGGAAGGCTGG - Intronic
1011642984 6:89432958-89432980 CCTTCTGAAGAGTGGGAGGAAGG - Intergenic
1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG + Intergenic
1013658578 6:112271150-112271172 TCTTCTGTAAAGTGGGTGGTTGG + Intergenic
1019338874 7:498817-498839 CCATCTGTACAATGGGAGAATGG - Intronic
1019434955 7:1017799-1017821 CCTTGTGTGCAGTGGGGGGCGGG - Intronic
1019693657 7:2432482-2432504 CCTTCTGATCAGTGGGGGACTGG - Intronic
1022310746 7:29194305-29194327 ACTGCTGGACAGGGGGAGGCGGG - Intronic
1023873832 7:44276431-44276453 CCCTTTGTGCAGTGGGTGGCGGG - Intronic
1025263849 7:57439905-57439927 CCTCCTCTCCAGTGGGAGCCAGG + Intergenic
1025615275 7:63112684-63112706 CCTACAGTACAGGAGGAGGCTGG - Intergenic
1025635384 7:63316204-63316226 CCTCCTCTCCAGTGGGAGCCAGG - Intergenic
1025647310 7:63431966-63431988 CCTCCTCTCCAGTGGGAGCCAGG + Intergenic
1026105328 7:67416523-67416545 CTCTTTGTGCAGTGGGAGGCTGG + Intergenic
1026909678 7:74084505-74084527 CCTTCTGTACATTTGGAAACTGG + Intronic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1027722314 7:81759979-81760001 CCATCTGTAAAGTGGGTGACAGG + Intronic
1027826576 7:83124062-83124084 ACTTCAGTACTTTGGGAGGCGGG + Intronic
1029021844 7:97372325-97372347 CCTTCTGTGCAGTGAGCAGCAGG + Intergenic
1029250365 7:99232243-99232265 CCATCTGTAAAGTGGGTGGCTGG - Intergenic
1032320984 7:130886538-130886560 TCTTCTCTGCAGTGGCAGGCTGG - Intergenic
1032440083 7:131935987-131936009 CCTAGTGTAGAGTGGGATGCAGG + Intergenic
1034612699 7:152386337-152386359 CTTTCTGTAAAGTGGGAAGGGGG - Intronic
1034855246 7:154539475-154539497 CCTGTTGTACGGTGGGGGGCAGG + Intronic
1035314727 7:157990773-157990795 CCTCCGATACAGTGGGAGGGAGG + Intronic
1037412484 8:18613288-18613310 CCATCTGCACATTGGGAGGAGGG + Intronic
1041016566 8:53597534-53597556 CCTGCTGTAAGTTGGGAGGCTGG + Intergenic
1041025279 8:53679232-53679254 CATTCAATACAATGGGAGGCTGG - Intergenic
1044014007 8:87028463-87028485 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1044475688 8:92623170-92623192 TTTTCTGTACAGTGTGAGGTAGG + Intergenic
1044754210 8:95444922-95444944 CCTTCTTTAGAGAGGAAGGCAGG + Intergenic
1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG + Intergenic
1047315752 8:123731546-123731568 CCATCAGTCCAGTGTGAGGCAGG + Intronic
1047484066 8:125312766-125312788 CCTTTTGTCCAGTGGCAGGATGG + Intronic
1047488026 8:125350441-125350463 CCTTGAGCACAGTGGGAGACAGG + Intronic
1048818312 8:138355008-138355030 CCTGCTGTAGGGTGGGAGGAAGG - Intronic
1048962753 8:139594104-139594126 CAGACTGTACAGTGAGAGGCAGG + Intergenic
1050545604 9:6706293-6706315 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1051875837 9:21792343-21792365 CCTTGTGCACAGTGGTAGGAAGG + Intergenic
1052374644 9:27705197-27705219 CCCTCTCTACAGTGAGAGTCAGG + Intergenic
1054990217 9:71316888-71316910 CCATCTGAAAAGTGGTAGGCAGG - Intronic
1055481163 9:76710376-76710398 TCTTCTGTATAGAGTGAGGCTGG + Exonic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG + Intergenic
1058298123 9:103334750-103334772 CCTTATGTACAGTGGAAGAAGGG - Intergenic
1058645553 9:107128468-107128490 GCTTCTGAACAGCGGAAGGCAGG - Intergenic
1058866496 9:109166669-109166691 CCATCTGTAAAGCGGGCGGCAGG + Intronic
1059049579 9:110909257-110909279 CTTTCTGTGCAGTGGGCAGCAGG + Intronic
1059723090 9:116980546-116980568 CCTTCTGTAAAATGGAAGGTTGG + Intronic
1060232368 9:121835097-121835119 CCCTCTGTAAAGTGAGGGGCTGG + Intronic
1060929447 9:127479665-127479687 CCATCTGCACACGGGGAGGCTGG - Intronic
1061353886 9:130088471-130088493 TCTTCTGTAGAGGGGGAGACAGG - Intronic
1061885143 9:133587587-133587609 CCTTCAGTGCAGTCAGAGGCTGG + Intergenic
1185577971 X:1188574-1188596 CTTTGAGTACAATGGGAGGCAGG + Intronic
1188537244 X:31211081-31211103 CTTTCTTTAAAGTGGGAGGAAGG + Intronic
1189060999 X:37753753-37753775 TCATCTGTACAATGGGAGGTGGG - Intronic
1189098093 X:38161010-38161032 CCTTCTGGAAAGTTGGAGCCTGG + Exonic
1190249105 X:48708717-48708739 CCTTTTGTACATTTGTAGGCAGG - Exonic
1190445007 X:50515203-50515225 CATTCTGTAGAGCAGGAGGCTGG + Intergenic
1193334217 X:80268770-80268792 TCTTCTGTAAAATGGGAGGTGGG + Intergenic
1197268511 X:124401369-124401391 CCTTCTGTACTGTGGGAAATGGG - Intronic
1197278353 X:124506147-124506169 CCTTCTGTACATTGTAAGTCTGG + Intronic
1198057376 X:133008351-133008373 CCTTCTGTGGAGGCGGAGGCAGG - Intergenic
1199887163 X:152031606-152031628 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1200011407 X:153123460-153123482 CCTCCGTTACTGTGGGAGGCAGG + Intergenic
1200028193 X:153276462-153276484 CCTCCGTTACTGTGGGAGGCAGG - Intergenic
1200159180 X:153996206-153996228 CCTTGAATAGAGTGGGAGGCAGG - Intergenic
1201567735 Y:15384378-15384400 CCCTGTGGACAGTGAGAGGCTGG + Intergenic