ID: 1161430419

View in Genome Browser
Species Human (GRCh38)
Location 19:4229290-4229312
Sequence CTCCCCCGCCCCCACCCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 1, 2: 10, 3: 87, 4: 733}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161430414_1161430419 -9 Left 1161430414 19:4229276-4229298 CCTTTCACAGCCTCCTCCCCCGC 0: 1
1: 0
2: 5
3: 58
4: 596
Right 1161430419 19:4229290-4229312 CTCCCCCGCCCCCACCCTCGGGG 0: 1
1: 1
2: 10
3: 87
4: 733
1161430411_1161430419 11 Left 1161430411 19:4229256-4229278 CCAGCAGGTCTCCACTTCTCCCT No data
Right 1161430419 19:4229290-4229312 CTCCCCCGCCCCCACCCTCGGGG 0: 1
1: 1
2: 10
3: 87
4: 733
1161430412_1161430419 0 Left 1161430412 19:4229267-4229289 CCACTTCTCCCTTTCACAGCCTC No data
Right 1161430419 19:4229290-4229312 CTCCCCCGCCCCCACCCTCGGGG 0: 1
1: 1
2: 10
3: 87
4: 733
1161430413_1161430419 -8 Left 1161430413 19:4229275-4229297 CCCTTTCACAGCCTCCTCCCCCG No data
Right 1161430419 19:4229290-4229312 CTCCCCCGCCCCCACCCTCGGGG 0: 1
1: 1
2: 10
3: 87
4: 733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161430419 Original CRISPR CTCCCCCGCCCCCACCCTCG GGG Intergenic