ID: 1161431626

View in Genome Browser
Species Human (GRCh38)
Location 19:4235813-4235835
Sequence CAGTTACAAGAGGCTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1154
Summary {0: 1, 1: 3, 2: 37, 3: 197, 4: 916}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161431626 Original CRISPR CAGTTACAAGAGGCTGAGGT GGG Intronic
900686407 1:3950956-3950978 CAGCTACAAGAGGCTGAGCAGGG + Intergenic
901118908 1:6874310-6874332 CACTTGCAAGAGGTCGAGGTGGG - Intronic
901249063 1:7759035-7759057 CAGCTACTGGAGGCTGAGGTGGG + Intronic
901260651 1:7868338-7868360 CAGTTGCAGGAGGATGAGCTTGG + Intergenic
901394480 1:8971089-8971111 CAGTAGCAAGAGGCTCAGGTGGG + Intronic
901399779 1:9007846-9007868 CAGCTACAGGAGGCGGAGGCAGG - Intronic
901480616 1:9522421-9522443 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
901503228 1:9666975-9666997 CAGCTACAGGAGGCTGAGGCAGG - Intronic
901535628 1:9881279-9881301 CTGTAATAAGAGGCGGAGGTGGG - Intronic
901590823 1:10340820-10340842 GTGTTACAAGAGGCAGAGATAGG + Intronic
901814762 1:11787835-11787857 GAGTCACAAGAGGTTAAGGTGGG - Exonic
901906440 1:12416069-12416091 CAGCTACGGGAGGCTGAGGTAGG + Intronic
902506775 1:16943819-16943841 CAGGTAGAAGAGGCCGAGCTAGG - Intronic
902516660 1:16993325-16993347 TAGTCCCAGGAGGCTGAGGTGGG - Intronic
902789875 1:18760475-18760497 CTGATACAATTGGCTGAGGTGGG - Intergenic
902807230 1:18868717-18868739 CAGGAACAAGACGCTAAGGTTGG + Intronic
902891859 1:19450030-19450052 TACTCACAGGAGGCTGAGGTGGG + Intronic
902946041 1:19839912-19839934 CAGCTACTCGAGGCTAAGGTGGG + Intergenic
903477680 1:23631050-23631072 CAGACTCAGGAGGCTGAGGTGGG + Intronic
903897167 1:26614880-26614902 CACTTAGCAGAGGCAGAGGTGGG + Intergenic
903909366 1:26711218-26711240 CAGCTACGAGAGGCTGAGGCAGG - Intronic
903941465 1:26934769-26934791 CAGCTACTGGAGGCTGAGGCAGG - Intronic
904032832 1:27543829-27543851 CAGCTACAGGAAGCTGAGGCAGG + Intronic
904177473 1:28640955-28640977 CAGTCCCAGGAGGCTGAGGCAGG + Intronic
904332366 1:29768483-29768505 CAGGGAGAAGAGGCTGAGGCAGG + Intergenic
904540170 1:31227516-31227538 CAGTTACAGCAGAATGAGGTGGG + Intronic
904620189 1:31770545-31770567 CTGCTAGAAGAGGCTGAGGCTGG + Intergenic
904854314 1:33485519-33485541 CAGCTACAGGGGGCTGAGGCAGG - Intronic
905228665 1:36497004-36497026 CAGCTACTACAGGCTGAGGTAGG - Intergenic
905365818 1:37450910-37450932 CAGCTACAAGAGACTGCGGACGG + Intergenic
906128370 1:43441517-43441539 CAGCTAGAAGAGGGTGAGGTGGG + Exonic
906261163 1:44391616-44391638 AAGTTACAAGGAGCTGAGGGTGG - Intergenic
906332513 1:44898802-44898824 CAGCTACAGGAGGCTGAGGCAGG - Intronic
906611126 1:47204230-47204252 TAGTTACCAGAGGCTGAGAAAGG + Intergenic
906768143 1:48455492-48455514 CAGCTACTTGAGGCTGAGGTAGG - Intronic
906799509 1:48723919-48723941 CAGTGAGTAGGGGCTGAGGTAGG + Intronic
906888661 1:49682290-49682312 CAGGTACAGGAGGCTGAGGCAGG + Intronic
906988568 1:50713046-50713068 CAGCTACAGGAGGCTGAGGTGGG + Intronic
907010899 1:50961777-50961799 CACTCTCAGGAGGCTGAGGTGGG - Intronic
907041545 1:51265210-51265232 CAGCTACTCGAGGTTGAGGTGGG + Intronic
907054610 1:51353686-51353708 CAGCTACTGGGGGCTGAGGTGGG - Intergenic
907071768 1:51541997-51542019 GATACACAAGAGGCTGAGGTGGG - Intergenic
907117282 1:51979927-51979949 CAGCTACAGGAGGCTGAGGCAGG + Intronic
907177491 1:52538533-52538555 CAGTCTCAGGAGGCTGAAGTGGG + Intronic
907839982 1:58147502-58147524 CAGCTACTCGAGGCTGAGGCAGG + Intronic
907843203 1:58176611-58176633 CTGTTATAAAAGGCTGAGTTTGG - Intronic
908233617 1:62129825-62129847 CAGCTACAGGAGGATGAGGCAGG + Intronic
908375974 1:63541674-63541696 CAGCCTCAGGAGGCTGAGGTAGG - Intronic
909610796 1:77549934-77549956 TAAATAAAAGAGGCTGAGGTGGG - Intronic
909646494 1:77922707-77922729 CAGCTACGGGAGGCTGAGGCAGG - Intronic
910377084 1:86584115-86584137 TGGTTACCAGAGGCTGGGGTGGG + Intergenic
911137732 1:94459156-94459178 CAGCTACTTCAGGCTGAGGTAGG - Intronic
911199283 1:95028317-95028339 CAGCTACTGGAGGCTGAGGTGGG - Intronic
911776125 1:101815198-101815220 CAGTTTTGGGAGGCTGAGGTGGG + Intronic
912329554 1:108805781-108805803 CACCTACTTGAGGCTGAGGTGGG + Intronic
912355955 1:109054233-109054255 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
912620627 1:111153135-111153157 TGGTTACAAGAGGCTGGGATGGG - Intronic
913663538 1:121026769-121026791 CTAATTCAAGAGGCTGAGGTGGG + Intergenic
914014930 1:143810048-143810070 CTAATTCAAGAGGCTGAGGTGGG + Intergenic
914162892 1:145151167-145151189 CTAATTCAAGAGGCTGAGGTGGG - Intergenic
914245289 1:145881171-145881193 CAGCTACAGGAGACTGAGGCAGG + Intronic
914653549 1:149718587-149718609 CTAATTCAAGAGGCTGAGGTGGG + Intergenic
914789943 1:150868784-150868806 CAGCTACAGGAGGCTGAGGCAGG + Intronic
915163754 1:153936913-153936935 CAGCTACTTGAGACTGAGGTGGG - Intronic
915738971 1:158103620-158103642 CAGTTACAGGAGGCTTTGCTGGG - Intergenic
916532510 1:165670957-165670979 CAGCTATAGGAGGCTAAGGTGGG + Intronic
916774003 1:167940487-167940509 AAATTCCAGGAGGCTGAGGTGGG - Intronic
916985298 1:170184818-170184840 GAGTTACCAGAGGCTGGGGAGGG - Intergenic
917133453 1:171765004-171765026 TGGTTACCAGAGGCTGAGGAGGG + Intergenic
917571133 1:176266661-176266683 CAGCTACCTGAGGCTGAGGTAGG - Intergenic
917838313 1:178958179-178958201 TACTCACAGGAGGCTGAGGTGGG - Intergenic
918034480 1:180854286-180854308 CAGTTACAAAGGGGAGAGGTTGG + Intronic
918068273 1:181116661-181116683 CAGCTATAGGGGGCTGAGGTGGG - Intergenic
918190574 1:182170180-182170202 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
918302922 1:183220327-183220349 CAGGTACAAGAGTCAGAGATGGG + Intronic
918824521 1:189306142-189306164 TGGTTACCAGAGGCTGAGGATGG - Intergenic
919070976 1:192754513-192754535 CTGCTTCATGAGGCTGAGGTAGG + Intergenic
919456101 1:197820796-197820818 TAGTTACCAGAGGCTGAGAAGGG + Intergenic
919523716 1:198621301-198621323 CAGTTATAAAAGGCTGAACTGGG + Intergenic
919706423 1:200680624-200680646 CAGCTACGTGGGGCTGAGGTGGG + Intergenic
919729631 1:200904842-200904864 CAGCTACTAGAGGCTGAGGAAGG - Intronic
920163606 1:204018991-204019013 CTGCCTCAAGAGGCTGAGGTTGG + Intergenic
920320496 1:205118104-205118126 CACTTACAAGCAGTTGAGGTGGG - Intronic
920411618 1:205765952-205765974 CAGCTACTCGAGGCTGAGGTGGG + Intergenic
920422826 1:205847127-205847149 TAGTTACAGGAGGCTGAGGTGGG - Intronic
920423630 1:205854610-205854632 TAGTTACAGGAGGCTGAGGTGGG + Intergenic
921003714 1:211070708-211070730 CAGCTACAGGAGGCTGAGACAGG + Intronic
921124491 1:212165000-212165022 CACATACAAGATCCTGAGGTGGG - Intergenic
921657042 1:217752136-217752158 CAGCTACTTGAGGCTGGGGTGGG - Intronic
921869963 1:220129516-220129538 CAGTTACCAGAGGCTGGGAAGGG - Intronic
922000445 1:221472599-221472621 CAGCTACTCGGGGCTGAGGTAGG - Intergenic
922865102 1:228852883-228852905 GCATTTCAAGAGGCTGAGGTGGG + Intergenic
923204347 1:231743387-231743409 CAGCTAGAAGTGGCAGAGGTGGG + Intronic
923695296 1:236243115-236243137 CAATAGCAAGAGGCTGAGGCAGG - Intronic
923711426 1:236390439-236390461 CAGCTACAGGAGGCTGAGGCAGG + Intronic
923756120 1:236792727-236792749 CAGCTACTGGAGGCAGAGGTGGG - Intergenic
923840689 1:237668300-237668322 CAGACAAAAGAGGCTGAGATAGG - Intronic
924122728 1:240818763-240818785 CAGTTACCAGAGGCTGGGATAGG + Intronic
924621027 1:245660925-245660947 CAGCTACAGGAGGTTGAGGCAGG - Intronic
924705342 1:246496712-246496734 CAGCTACTCAAGGCTGAGGTAGG + Intronic
924724525 1:246656816-246656838 CAGCTACAGGAGGCTAAGGTGGG + Intronic
1062846640 10:712190-712212 GGGTTGCAGGAGGCTGAGGTGGG + Intergenic
1063478583 10:6350283-6350305 CAGGAAGAAGAGGCTGAGGTAGG - Intergenic
1063725913 10:8637404-8637426 CAGCTACCAGAGGCTGAGGTGGG + Intergenic
1063735173 10:8745312-8745334 TAGTTACCAGAGGCTGGGGGTGG - Intergenic
1063777124 10:9275795-9275817 TAGTTACAAGTGGCTATGGTGGG - Intergenic
1064178257 10:13094368-13094390 CAGCTACTAGAGGCTGAGGTAGG - Intronic
1064203113 10:13300568-13300590 CAGTGACAAGTGGCTGGGCTGGG + Intronic
1064476227 10:15691681-15691703 TAGTTACCAGAGGCTGGGGAGGG + Intronic
1064836716 10:19540299-19540321 CATTTAAGAGAGGCTGAGTTGGG - Intronic
1065073755 10:22055055-22055077 TGGTTACCAGAGGCTGAGGAGGG - Intergenic
1065137032 10:22681561-22681583 CATACTCAAGAGGCTGAGGTAGG + Intronic
1065271592 10:24038861-24038883 GAGTCCCAAGAGGCTGAGGCAGG - Intronic
1065274492 10:24072272-24072294 CACTTTTAGGAGGCTGAGGTGGG - Intronic
1065356352 10:24845868-24845890 CAGCTTCAGGGGGCTGAGGTGGG - Intergenic
1065514122 10:26507383-26507405 CAGCTACAGGTGGCTGAGGCGGG + Intronic
1065578393 10:27147245-27147267 CACTTTTGAGAGGCTGAGGTGGG + Intronic
1065768969 10:29059051-29059073 TAGTCCCAGGAGGCTGAGGTGGG + Intergenic
1066363794 10:34756565-34756587 CAGCTACTTGAGGCTGAGGCAGG - Intronic
1066373865 10:34839902-34839924 CAGCTACCTGAGGCTGAGGCAGG - Intergenic
1066572502 10:36788873-36788895 CACTTTCAGGGGGCTGAGGTGGG - Intergenic
1067401470 10:45978103-45978125 CACTTTTAAGAGGCTGAGGCGGG + Intronic
1067869821 10:49947680-49947702 CACTTTTAAGAGGCTGAGGCGGG + Intronic
1069049476 10:63777509-63777531 CATTTAAGGGAGGCTGAGGTAGG + Intergenic
1069108565 10:64414134-64414156 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1069327442 10:67248671-67248693 CACTTTCAGGAGGCTGAGGCTGG - Intronic
1069715235 10:70516378-70516400 CACCTGTAAGAGGCTGAGGTGGG - Intronic
1069865585 10:71500979-71501001 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1069927529 10:71861209-71861231 CAGCTACAGGAGGCTTAGGTGGG + Intergenic
1069928661 10:71868578-71868600 CTGTTAAAAGAGGATGAGCTGGG + Intergenic
1070122606 10:73593263-73593285 CAGTTACTCCAGGCTGAGGTGGG + Intronic
1070205825 10:74260176-74260198 CAGTTACAAGTGGCTGATTTTGG - Intronic
1070291665 10:75120381-75120403 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1070350822 10:75590857-75590879 CAGCTGCAGGAGGCTGAGGCAGG - Intronic
1070542510 10:77426486-77426508 CAGTTATAAGAGGTTGAGCTGGG + Intronic
1070553358 10:77509230-77509252 CAGCTACTGGAGGCTGAGGCAGG - Intronic
1070639327 10:78155381-78155403 CAGTTGCTAGGGGCTGAAGTGGG - Intergenic
1070793643 10:79204324-79204346 CAGTACCAAGAGGCTGAGAAGGG - Intronic
1071270540 10:84002732-84002754 CAGTTTTAAGCTGCTGAGGTTGG + Intergenic
1071589927 10:86863089-86863111 CAGCTACTTGAGGCCGAGGTAGG - Intronic
1071698726 10:87905587-87905609 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1072050202 10:91696531-91696553 TAGTTACCAGAGGCTGGGGAAGG + Intergenic
1072125442 10:92441569-92441591 CACTTTTGAGAGGCTGAGGTGGG + Intergenic
1072130015 10:92484942-92484964 CGTACACAAGAGGCTGAGGTGGG + Intronic
1072535431 10:96359280-96359302 GGGTTACATGAGGCTGAGGCTGG + Exonic
1072649473 10:97283308-97283330 CATCTTCAGGAGGCTGAGGTGGG + Intronic
1073158863 10:101372366-101372388 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1073181414 10:101585712-101585734 CAGCTATAAGAGGTTTAGGTGGG - Intronic
1073198724 10:101717301-101717323 CAGCTACAGGAGGCTGTGGTGGG - Intergenic
1073240819 10:102056737-102056759 CAGCTACCAGAGGCAGAGGCAGG - Intergenic
1073246716 10:102095954-102095976 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1073848121 10:107583135-107583157 CACTTGCAGGGGGCTGAGGTGGG - Intergenic
1074107582 10:110400068-110400090 CAGTTACAATAGGAGGAGCTGGG + Intergenic
1074281038 10:112051834-112051856 CTATTGCAAGAGGCTGAGGTGGG - Intergenic
1074311410 10:112326258-112326280 TGGTGACATGAGGCTGAGGTAGG - Intergenic
1075152138 10:119943476-119943498 CAGCTACAGGAGGCTGAGGCAGG + Exonic
1075773193 10:124958303-124958325 CAGGTATGTGAGGCTGAGGTGGG + Intronic
1076095106 10:127727293-127727315 CGGTTACCAGAGGCTGAGAAGGG + Intergenic
1076831664 10:132997941-132997963 CAGTTGCCAGGGGTTGAGGTGGG - Intergenic
1078086489 11:8236300-8236322 CCGATGCAGGAGGCTGAGGTAGG - Intronic
1078705390 11:13738931-13738953 CAGTTACTAGAGGTGGGGGTGGG + Intergenic
1078995352 11:16692182-16692204 CAGCTACTAGGGGCTGAGGCAGG - Intronic
1079025995 11:16948155-16948177 TGGTTACCAGAGGCTGGGGTGGG + Intronic
1079036937 11:17028069-17028091 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1079049527 11:17141381-17141403 CAGCTACTCGGGGCTGAGGTAGG - Intronic
1079486508 11:20940890-20940912 CACTTTTGAGAGGCTGAGGTGGG + Intronic
1080071889 11:28099308-28099330 TGGTTACCAGAGGCTGAGGAGGG + Intronic
1080304479 11:30821523-30821545 GAGTTGGAAGAGGCTCAGGTTGG - Intergenic
1080421673 11:32116486-32116508 CATTTTGAAGAGGCTGAGCTGGG + Intergenic
1080511785 11:32982002-32982024 CAGCTACTTGAGTCTGAGGTGGG - Intronic
1080928233 11:36781017-36781039 CAGTTACAAGGAGCTGAGGAGGG - Intergenic
1081263063 11:40985011-40985033 CAGTGAGAGGAGGCTGAGGCAGG - Intronic
1081320246 11:41683323-41683345 AAGTTAGATGAGGCTGAGGCAGG - Intergenic
1081328783 11:41778872-41778894 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1082949929 11:58803209-58803231 AAGTTACCAGAGGCTGAGAAGGG + Intergenic
1083058443 11:59845558-59845580 CAGTTAGGAGAGGCTGGGTTGGG - Intergenic
1083298366 11:61727433-61727455 CTGTTAGGAGACGCTGAGGTGGG - Intronic
1083486671 11:62987352-62987374 CTGCTCCAAGAAGCTGAGGTGGG + Intergenic
1084056270 11:66635651-66635673 CACTTTTGAGAGGCTGAGGTGGG + Intronic
1084124601 11:67090844-67090866 CAGTCCCAGGAGGCTGAGGTGGG + Intergenic
1084724631 11:70933345-70933367 TAGTTACCAGAGGCTGGGGGAGG + Intronic
1084975835 11:72797555-72797577 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
1084977168 11:72807893-72807915 TAGTCTCAGGAGGCTGAGGTGGG + Intergenic
1085824188 11:79825941-79825963 CAGTTACAAGTGGCAGAGTGAGG + Intergenic
1085830988 11:79900837-79900859 TAGTTACTAGAGGCTGGGGAGGG + Intergenic
1085992132 11:81861919-81861941 TGGTTACTAGAGGCTGAGGGGGG + Intergenic
1086092319 11:83017223-83017245 CAGCTACTAGAGGGTGAAGTGGG + Intronic
1086562851 11:88188158-88188180 CATATTCAGGAGGCTGAGGTGGG - Intergenic
1087386714 11:97480494-97480516 TAGTTATTAGAGGCTGGGGTAGG + Intergenic
1087557629 11:99742188-99742210 CATTCACAAGAGACTGAGCTGGG - Intronic
1088190968 11:107227911-107227933 AATTTTCAGGAGGCTGAGGTGGG + Intergenic
1088210539 11:107450439-107450461 AGCTTTCAAGAGGCTGAGGTGGG + Intronic
1088216562 11:107516910-107516932 CAGCTACTAGAGGCTGAGGTGGG + Intronic
1088343134 11:108791623-108791645 CAGTTGCCAGGGGCTGAGGATGG - Intronic
1089530807 11:119127965-119127987 CAGCTACAAGAGGCTGAGGCAGG - Intronic
1090725440 11:129521701-129521723 TGGTTACCAGAGGCTGAGGGTGG - Intergenic
1091024343 11:132128611-132128633 CAGGTACAAGAGGCTGATAAGGG + Intronic
1091129848 11:133136553-133136575 GGCTTACAAGAGGCAGAGGTGGG + Intronic
1091454517 12:596808-596830 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1092153329 12:6266280-6266302 CACTTTTAGGAGGCTGAGGTGGG + Intergenic
1092349278 12:7742397-7742419 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1092393247 12:8100522-8100544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1092395954 12:8126745-8126767 TAAGTGCAAGAGGCTGAGGTAGG + Intronic
1092396169 12:8128704-8128726 CAGTTTCTAGAGGGAGAGGTGGG + Intronic
1092496244 12:8998080-8998102 CACTTTTGAGAGGCTGAGGTGGG + Intronic
1093298221 12:17417691-17417713 TGGTTACAAGAGGTTGAGGATGG - Intergenic
1093464378 12:19435237-19435259 CAGCTATGGGAGGCTGAGGTGGG - Intronic
1093532100 12:20177831-20177853 TAGTTACCAGAGGCTGGGGAGGG + Intergenic
1093650315 12:21635765-21635787 CAAAGACAGGAGGCTGAGGTGGG + Intronic
1093810971 12:23491671-23491693 CAGCTACTGGAGGGTGAGGTGGG - Intergenic
1093953006 12:25185024-25185046 TAGTCTCAGGAGGCTGAGGTGGG + Intronic
1093992083 12:25601284-25601306 CAGTTACCAGAGGCTGGGAAGGG + Intronic
1094035675 12:26067875-26067897 CGGCTACAGGAGGCTGAGGTAGG - Intronic
1094442480 12:30493921-30493943 CGGTTACCAGAGGCTGAGAAGGG - Intergenic
1094559891 12:31542345-31542367 TAGTTACCAGAGGCTGAGAAGGG + Intronic
1094635643 12:32225115-32225137 TGGTTATCAGAGGCTGAGGTGGG - Intronic
1094705296 12:32908841-32908863 CAGCTACCAGAGGCTGATGCAGG - Intergenic
1094724023 12:33093822-33093844 TAGTTACCAGAGACTGAGGAGGG - Intergenic
1095208310 12:39463541-39463563 TAGTTACTGGAGGCTGAGGTTGG - Intergenic
1095266923 12:40171616-40171638 CAGTTGAAAGAGGATGAGTTAGG - Intergenic
1095501445 12:42843978-42844000 GTATTTCAAGAGGCTGAGGTAGG - Intergenic
1095507404 12:42911910-42911932 CAGTTTTGGGAGGCTGAGGTGGG + Intergenic
1095558473 12:43537179-43537201 CAGTTATGGGAGGCTGAGGTGGG - Intronic
1096209401 12:49752007-49752029 CACTTCTGAGAGGCTGAGGTGGG - Intronic
1096249406 12:50018951-50018973 CAGTGTCAGGAGGCTGAGGCCGG - Intronic
1096287229 12:50310871-50310893 CAGCATCGAGAGGCTGAGGTGGG + Intergenic
1096301497 12:50432022-50432044 CAGCTACTGGAGGCTGAGGCAGG + Intronic
1096337722 12:50769390-50769412 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1096545280 12:52334768-52334790 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1097448338 12:59704086-59704108 CAGTTACTAGGGTCTGAGGCAGG + Intronic
1097801472 12:63919162-63919184 CAGTCCCAGGAGACTGAGGTGGG - Intronic
1097803317 12:63938906-63938928 GCATTTCAAGAGGCTGAGGTGGG + Intronic
1097810363 12:64012662-64012684 CAGCTATGAGAGGCTGAGGTGGG - Intronic
1098009431 12:66034575-66034597 CTGCTACTTGAGGCTGAGGTGGG - Intergenic
1098110394 12:67115381-67115403 CAGCTAGGGGAGGCTGAGGTAGG + Intergenic
1098232558 12:68387243-68387265 GCCTTACAAGAGGCTGAGGCAGG + Intergenic
1098339575 12:69438020-69438042 CAGGTACAGGAGGCTGAGGCAGG + Intergenic
1098349599 12:69544458-69544480 CACTTTGAGGAGGCTGAGGTGGG + Intronic
1099205647 12:79723123-79723145 CAGCTACAGGAGGTTGAGGTGGG + Intergenic
1099392657 12:82099797-82099819 TTGTTTCAGGAGGCTGAGGTGGG - Intergenic
1099659729 12:85541561-85541583 TATTTACAAGAGGCAGAGGAAGG - Intergenic
1099779965 12:87182199-87182221 CAGTTCCATGTGGCTGAGGAAGG - Intergenic
1099814438 12:87626803-87626825 TGGTTACCAGAAGCTGAGGTGGG - Intergenic
1101208722 12:102514568-102514590 CAGCTACCAGGGCCTGAGGTGGG + Intergenic
1101752148 12:107590579-107590601 CAGTTCCAACAGGCTGGTGTGGG + Intronic
1101793694 12:107953731-107953753 CAGGAACAAGAAGCTGAGGACGG - Intergenic
1102153517 12:110705419-110705441 CAGGTTCGGGAGGCTGAGGTGGG + Intergenic
1102212392 12:111136865-111136887 CAGTCTCAAGTGGCTGAGGCAGG + Intronic
1102260355 12:111439670-111439692 CAGCTACAGGAGGCTGAAGCAGG - Intronic
1102315919 12:111887424-111887446 CAGTTTTGAGAGGCTGAGGCAGG + Intronic
1102322740 12:111951982-111952004 CACTTTTGAGAGGCTGAGGTGGG + Intronic
1102336194 12:112082458-112082480 TACTGGCAAGAGGCTGAGGTGGG + Intronic
1102366643 12:112342343-112342365 CAGGCTCAGGAGGCTGAGGTGGG + Intronic
1102473128 12:113171236-113171258 CAGTTACCAGGGGCTGCGGGAGG + Intronic
1102786740 12:115611198-115611220 CTGCTCCAGGAGGCTGAGGTGGG + Intergenic
1102922018 12:116798678-116798700 CAGATTCAGGAGGCTGAGGCGGG - Intronic
1102961375 12:117095630-117095652 CGCTTTCAAGAGGCTGAAGTGGG + Intronic
1102970200 12:117160402-117160424 CAGTTACCAGATGCTGATGCTGG + Intronic
1103461508 12:121108369-121108391 CAGTTCCAAGAGGCCTAGCTTGG + Intergenic
1103603831 12:122072019-122072041 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1103739722 12:123083104-123083126 CAGCTACAGGAGGCTGTGGTGGG + Intronic
1103789680 12:123460770-123460792 CAGCTACAGAAGGCTGAGGCAGG - Intronic
1103983054 12:124749260-124749282 CACTTAGAAGAGGCTGAGGTGGG - Intergenic
1104204742 12:126627745-126627767 TAGTTACCACAGGCTGAGGAGGG + Intergenic
1104442428 12:128805006-128805028 CTGTTAAAAGAGGCTGATGTTGG - Intronic
1104443351 12:128813300-128813322 AAAGTACAGGAGGCTGAGGTGGG - Intronic
1104805460 12:131586660-131586682 CACTTACAGGAGGCCCAGGTAGG + Intergenic
1105491189 13:20890201-20890223 CACTTTGGAGAGGCTGAGGTGGG + Intronic
1105710377 13:23002406-23002428 AAGTTACAGGAGACTGAGGGAGG - Intergenic
1106280200 13:28260280-28260302 CAGCTACGTGAGGCTGAGGCAGG + Intronic
1106426802 13:29638349-29638371 TAAACACAAGAGGCTGAGGTGGG - Intergenic
1106523356 13:30518083-30518105 CACTTATGGGAGGCTGAGGTGGG + Intronic
1106723654 13:32462419-32462441 TAGTTACCAGAGGCTGAGGAGGG + Intronic
1106792518 13:33169986-33170008 TGGTTACCAGAGGCTGAGGAGGG + Intronic
1106860428 13:33901517-33901539 CAGTTACCAGAGGCTGGGAAGGG + Intronic
1107013565 13:35691290-35691312 GCCTTATAAGAGGCTGAGGTTGG + Intergenic
1107219193 13:37961154-37961176 TGGTTACCAGAGGCTGGGGTAGG - Intergenic
1107323459 13:39213952-39213974 CAGTTACCAGAGGCTGGGAGAGG - Intergenic
1107512942 13:41103230-41103252 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1107644628 13:42481005-42481027 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
1107707964 13:43125693-43125715 CAGTTACCAGAGGCTGGGAAGGG + Intergenic
1107953696 13:45488205-45488227 TAGATACCAGAGGCTGGGGTGGG + Intronic
1108214545 13:48171630-48171652 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
1108360745 13:49666146-49666168 CAGTAACAAGAGGAGGGGGTGGG + Intronic
1108664394 13:52615511-52615533 TAGTTACCAGAGGCTGAGAAGGG + Intergenic
1108674792 13:52727155-52727177 CAGTTACTCGAGGCTGAGGCAGG + Intronic
1108944241 13:56001992-56002014 CAGTTCCACGTGGCTGAGGAAGG + Intergenic
1108980464 13:56505617-56505639 TAGTTGCCAGAGGCTGAGGGAGG - Intergenic
1109423240 13:62140651-62140673 CAGCTACTAGAGGCTGAGACAGG + Intergenic
1109922934 13:69092970-69092992 AAGTTACATGAGGCTCAGGGTGG + Intergenic
1110250858 13:73378856-73378878 CAGAGACAGGAGGCTGAGTTGGG - Intergenic
1110332013 13:74283969-74283991 CAGCTACGGGAGGCTGAGGTAGG - Intergenic
1110574733 13:77042309-77042331 CAGCTACTTGGGGCTGAGGTGGG + Intergenic
1110865832 13:80395149-80395171 TAGTTACCAGAGGCTGAGAATGG - Intergenic
1110899725 13:80806085-80806107 TGGTTACCAGGGGCTGAGGTGGG + Intergenic
1110918199 13:81049304-81049326 CAGTTACAAGAGGAGCAAGTTGG + Intergenic
1110972913 13:81788926-81788948 TGGTTACTAGAGGCTGAGATGGG + Intergenic
1111026074 13:82526538-82526560 TGGTTACCAGAGGCTGAGGTTGG - Intergenic
1111032061 13:82614248-82614270 CATTTCTGAGAGGCTGAGGTGGG + Intergenic
1111154068 13:84298977-84298999 CAGCTACAGGAGGCTGAGGAAGG - Intergenic
1111205705 13:85007648-85007670 TGGTTACAAGAGACTGAGGAGGG - Intergenic
1111250195 13:85591576-85591598 CACTTAAAGGAGGCTGAGGCAGG - Intergenic
1111299686 13:86331758-86331780 CAGCTACAGGAGGCTGAGACAGG - Intergenic
1111375635 13:87376335-87376357 TGGTTACAAGAGGCTGGGGGAGG + Intergenic
1111542971 13:89692286-89692308 CAGTTACCAGAGGCTGGGGAAGG + Intergenic
1112025621 13:95408353-95408375 CAGCTATGGGAGGCTGAGGTGGG - Intergenic
1112148619 13:96730843-96730865 TAGCTACAGGAAGCTGAGGTGGG - Intronic
1112181969 13:97091914-97091936 CATTTACCAGAGGCTGGGGAGGG + Intergenic
1112268325 13:97946387-97946409 CATACACAGGAGGCTGAGGTAGG - Intergenic
1112396411 13:99036651-99036673 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1112472273 13:99699878-99699900 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1112479473 13:99761028-99761050 CGGTTACCAGAGGCTGAGAAGGG - Intronic
1112599126 13:100838023-100838045 CAGAGAGAAGAGGCTGAGCTAGG + Intergenic
1112732996 13:102387841-102387863 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1112833265 13:103479491-103479513 CAGCTACTTGAGGCTGAGGCAGG + Intergenic
1112950724 13:104993138-104993160 CAGCTACTGGAGGCTGAGATGGG + Intergenic
1112988594 13:105482619-105482641 CAGTTCCAGGAGGCTGAGGCAGG - Intronic
1113123667 13:106952840-106952862 CAGCTACTCAAGGCTGAGGTGGG + Intergenic
1113733749 13:112661323-112661345 CAGTTACCAGGGGCTGGGGAGGG - Intronic
1113818369 13:113192009-113192031 CACTTTCGGGAGGCTGAGGTGGG + Intronic
1114291141 14:21289393-21289415 CAGCTACTCGAGGCTGAGGTGGG + Intronic
1114326403 14:21593548-21593570 CAGTGCTAGGAGGCTGAGGTGGG + Intergenic
1114492079 14:23109018-23109040 CACCTGCAGGAGGCTGAGGTAGG - Intergenic
1114539309 14:23443063-23443085 CAGGTAACAGAGGCTGAGGTGGG - Intergenic
1114563536 14:23610816-23610838 CTGTTACAAGTGTCTTAGGTTGG - Intergenic
1114631722 14:24163550-24163572 CAGTAACCAGAGGGAGAGGTGGG + Intronic
1115181472 14:30631239-30631261 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1115408547 14:33046860-33046882 CAGCTACTAGAGGCTGAGGCAGG + Intronic
1115493288 14:33979700-33979722 CAGCTAATGGAGGCTGAGGTGGG - Intronic
1116254549 14:42534490-42534512 CAGCTAGGAGAGGCTGAGGCAGG + Intergenic
1116840274 14:49813715-49813737 CAGCTACAGAAAGCTGAGGTGGG - Intronic
1116899312 14:50346760-50346782 CAGCTACTGGAGGCTGAGGCAGG - Intronic
1117133588 14:52710315-52710337 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1117575967 14:57098091-57098113 CAGTTGCAAGACCCTGAGGCTGG - Intergenic
1118273993 14:64369281-64369303 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1118888089 14:69883294-69883316 TGGTTACCAGAGGCTGAGGAAGG - Intronic
1118934222 14:70271529-70271551 CAGCTACTCGAGGCTGAGGTAGG + Intergenic
1119043220 14:71294505-71294527 CAGCTACTGGAGGCTGAGGCAGG - Intergenic
1119464806 14:74848439-74848461 CAGTGCTAGGAGGCTGAGGTGGG + Intronic
1120210406 14:81628545-81628567 CACTTCCAGGAGGATGAGGTTGG - Intergenic
1121549518 14:94788115-94788137 TAGTTAAAAGAGGCAGAGCTGGG - Intergenic
1121742709 14:96265324-96265346 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1121855848 14:97269601-97269623 CAGTTCCATGTGGCTGAGGAGGG + Intergenic
1122496177 14:102157148-102157170 CAGCTACAAGAGGCTGAGGTGGG + Intronic
1122496511 14:102159856-102159878 CAGTTTTGGGAGGCTGAGGTGGG + Intronic
1122700946 14:103588728-103588750 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1122730220 14:103791231-103791253 CAGCTACAGTAGGCTGAGGCAGG - Intronic
1123187700 14:106536326-106536348 CGGTTACAACAAGCTGAGGATGG - Intergenic
1124111372 15:26792083-26792105 CAGCTACATGAGGCTGAGGCAGG + Intronic
1124799073 15:32811892-32811914 CACTTTTGAGAGGCTGAGGTGGG - Intronic
1125293913 15:38181181-38181203 CGATTACCAGAGGCTGGGGTTGG + Intergenic
1125434721 15:39632422-39632444 CACTTTGGAGAGGCTGAGGTGGG - Intronic
1125575856 15:40755078-40755100 CAGTGTCGTGAGGCTGAGGTGGG - Exonic
1125636443 15:41192724-41192746 TAGCTACTCGAGGCTGAGGTGGG - Intronic
1125718823 15:41835452-41835474 CAGGGAGAAGAGGCAGAGGTTGG - Intronic
1125826274 15:42679125-42679147 CAGATGCAAGAGGCTGAGACAGG - Intronic
1126130508 15:45336864-45336886 CACTTTGAAGAGGCTGAGGCAGG + Intergenic
1126151523 15:45527541-45527563 CACTTACAGGAGGTTGAGGCAGG - Intergenic
1126155582 15:45562798-45562820 CAACTCCAGGAGGCTGAGGTGGG + Intergenic
1126473581 15:49042914-49042936 CAGCTTCAGGAGGCTGAGGCAGG + Intronic
1126625488 15:50682462-50682484 CAGCTACTAGAGGCTGAGGCAGG + Intronic
1126998405 15:54473515-54473537 TAGTTATAAGAGGCTGAGAAGGG - Intronic
1127200681 15:56646316-56646338 CAGTCTCAGGAGGCTGAGGCAGG + Intronic
1127244809 15:57160802-57160824 TAGTCACAGGAGACTGAGGTGGG - Intronic
1128572969 15:68749042-68749064 CCTATTCAAGAGGCTGAGGTGGG + Intergenic
1128884409 15:71273368-71273390 CAGTTACCAGAGGCTGAGGAGGG + Intronic
1129204840 15:74031024-74031046 AAAGTACAGGAGGCTGAGGTGGG - Intronic
1129549035 15:76428615-76428637 CGGTTACCAGAGGCTGAGGAGGG + Intronic
1129795562 15:78373558-78373580 CAGCTATAGGAGGCTGAGGCAGG - Intergenic
1129972593 15:79792997-79793019 CAGCTACAGGAGGCGGAGGTTGG - Intergenic
1130020432 15:80226180-80226202 CAGTAAAAAGAGAATGAGGTGGG + Intergenic
1130292251 15:82613497-82613519 CAGTTACTTGGGGCTGAGGTGGG - Intronic
1130565894 15:84994848-84994870 TAGCTACTAGAGGCTGAGGCAGG + Intronic
1130685317 15:86032011-86032033 CAGTTACAAGACAATGAGGCTGG - Intergenic
1130856997 15:87848616-87848638 CGGTGACCAGAAGCTGAGGTAGG - Intergenic
1131154475 15:90066587-90066609 CAGCTATAGGAGGCTGAGGCAGG - Intronic
1131603205 15:93871210-93871232 TAGTTACCAGAGGCTGTGGTAGG - Intergenic
1131604015 15:93881438-93881460 CAGCTACCAGAGGCTCAAGTGGG - Intergenic
1131772160 15:95750200-95750222 TAGTTACAAGAGACTGGGGAGGG + Intergenic
1132036166 15:98486826-98486848 CAGCTAGAAGGGGCTGAGGTGGG + Intronic
1132150956 15:99458457-99458479 CACTTTGAGGAGGCTGAGGTAGG + Intergenic
1132255866 15:100374869-100374891 TAGTCTCAGGAGGCTGAGGTGGG - Intergenic
1132778728 16:1611384-1611406 CGGCTACAGGAGGCTGAGGGAGG + Intronic
1133159540 16:3901285-3901307 CAGCTTCAGGAGGCTGAGGCTGG + Intergenic
1133338406 16:5021267-5021289 CAGCTACTTGGGGCTGAGGTGGG - Intergenic
1133778103 16:8913860-8913882 CAGCTACTTGAGGCTGAGGTGGG - Intronic
1133788635 16:8992142-8992164 CAACTACAGGAGGCTTAGGTGGG + Intergenic
1133940498 16:10305216-10305238 CATTTTTAGGAGGCTGAGGTGGG + Intergenic
1134041487 16:11072231-11072253 CAGATACTACAGGCTGAGGTGGG - Intronic
1134139768 16:11707834-11707856 CAGTTTTGAGAGGCTGAGGCAGG + Intronic
1134225120 16:12383875-12383897 TAGTTACCAGAGGCTGAGAAGGG - Intronic
1134257018 16:12620974-12620996 CTACTCCAAGAGGCTGAGGTGGG - Intergenic
1135020467 16:18958537-18958559 CAGCTACAGGAGGCTGAAGCAGG + Intergenic
1135330881 16:21558610-21558632 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1135390669 16:22090700-22090722 CATTTCCAAGAGCCTAAGGTAGG + Intergenic
1135589759 16:23696405-23696427 CAGTTACAACTGGTGGAGGTGGG - Intronic
1135666542 16:24340284-24340306 CAGCTATAGGAGGCTGAGGTAGG + Intronic
1135711892 16:24724630-24724652 CAGCTACTTGAGGCTGAGGTGGG + Intergenic
1135720748 16:24815739-24815761 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1135896671 16:26411540-26411562 TAGTTACCAGGGGCTGTGGTGGG + Intergenic
1136115234 16:28090381-28090403 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
1136314847 16:29447906-29447928 CAACTACTTGAGGCTGAGGTGGG + Intronic
1136328289 16:29549642-29549664 CAACTACTTGAGGCTGAGGTGGG + Intergenic
1136341777 16:29648725-29648747 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
1136442974 16:30289665-30289687 CAACTACTTGAGGCTGAGGTGGG + Intergenic
1137229317 16:46548489-46548511 CAGTTACAAAAGAATTAGGTAGG + Intergenic
1137423150 16:48353389-48353411 CAGCTACTTGAGGCTGAGATGGG + Exonic
1137816691 16:51404872-51404894 CAGCTACTGGAGGCTGAGGCAGG - Intergenic
1137912303 16:52390413-52390435 CAGTTACCAGAGGATCAGGAGGG + Intergenic
1138188549 16:54995867-54995889 CAGTGAAAACAGGCTGAGCTGGG - Intergenic
1138890600 16:61139757-61139779 TAGTTACCAGAGGCTGAGAAGGG - Intergenic
1139425469 16:66877248-66877270 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1139457907 16:67097119-67097141 CAGCTACTCGAGGCTTAGGTGGG + Intronic
1139648573 16:68349772-68349794 TAGTCCCAGGAGGCTGAGGTGGG + Intronic
1139807024 16:69575493-69575515 GTTTTACAGGAGGCTGAGGTGGG + Intronic
1140061483 16:71573925-71573947 CACTTTCAGGAGGCTGAGGTGGG - Intronic
1140338118 16:74130841-74130863 TGGTTACCAGAGGCTGAGGCTGG + Intergenic
1140464334 16:75167709-75167731 CAGCTACTCCAGGCTGAGGTGGG - Intronic
1141061778 16:80879871-80879893 TAGTTGCAGGAGGCTGAGGTGGG + Intergenic
1141071651 16:80961868-80961890 TGGTTACCAGAGGCTGAGGGTGG + Intergenic
1141583808 16:85019469-85019491 CACTTTTAAGAGGCTGAGGCGGG + Intergenic
1143207481 17:5154843-5154865 CCTATACAGGAGGCTGAGGTGGG - Intronic
1143943794 17:10571644-10571666 CAGTTTAAAGAGGCAGAGCTAGG + Intergenic
1144284114 17:13756090-13756112 CAGCTGAAAGTGGCTGAGGTTGG - Intergenic
1144754338 17:17670023-17670045 CAGTTACAGAATGCTGAGGACGG - Intergenic
1144786274 17:17833736-17833758 CACTTTTGAGAGGCTGAGGTGGG + Intronic
1144833053 17:18142430-18142452 CAGTCACAAGGGCCTGGGGTTGG - Intronic
1144847490 17:18227498-18227520 CAGCTTCAGGAGGCTGAGATGGG - Intronic
1144887662 17:18474685-18474707 CATTAACAACAGGCTGAGGCTGG - Intergenic
1145036657 17:19545600-19545622 CTATTTCCAGAGGCTGAGGTGGG - Intronic
1145144554 17:20469615-20469637 CATTAACAACAGGCTGAGGCTGG + Intergenic
1145176006 17:20701017-20701039 CATTAACAACAGGCTGAGGCTGG + Intergenic
1145372731 17:22320593-22320615 CAGGTACTGGAGGCTGAGGCAGG + Intergenic
1145791316 17:27629157-27629179 CATTAACAACAGGCTGAGGCTGG - Intronic
1145806880 17:27740698-27740720 CATTAACAACAGGCTGAGGCTGG - Intergenic
1145864066 17:28228825-28228847 TAGATACAGGAGGCTGAGGAAGG - Intergenic
1146084125 17:29811811-29811833 GCATTTCAAGAGGCTGAGGTAGG - Intronic
1147858625 17:43502534-43502556 CAGCTACTTGAGGCTGAGGCAGG - Intronic
1148064926 17:44862186-44862208 CACTTTTGAGAGGCTGAGGTGGG + Intronic
1148242072 17:46006414-46006436 TGGTTACCAGAGGCTGAGGAGGG + Intronic
1148713948 17:49702230-49702252 CAGCTACTCGGGGCTGAGGTGGG - Intronic
1149039447 17:52170681-52170703 GAGTTTCAAGAGGCTGATGGGGG + Intergenic
1149240962 17:54648569-54648591 CAGTTACCAGAGGCTGGGAAAGG + Intergenic
1149243455 17:54678201-54678223 CACTTTGAGGAGGCTGAGGTGGG - Intergenic
1149524780 17:57346716-57346738 GCTATACAAGAGGCTGAGGTGGG - Intronic
1149828464 17:59850565-59850587 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
1150048695 17:61937785-61937807 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
1150195545 17:63294360-63294382 CAGCTACAGGAGGCTGAAATGGG + Intronic
1150377411 17:64693335-64693357 CAGCTAGAGGAGGCTGAGGCAGG - Intergenic
1150518579 17:65841477-65841499 CAGTTACCAGAGGCTGGGAAGGG + Intronic
1151128870 17:71875210-71875232 CAGTTACCAGAGGCTGGGAAGGG + Intergenic
1151313131 17:73306386-73306408 CAGCTACTCAAGGCTGAGGTGGG + Intronic
1151337981 17:73451390-73451412 CAGCTACTGGAGGCTGAGGCAGG + Intronic
1151464748 17:74277271-74277293 CAGCTACGGGAGGCTGAGGCAGG + Intronic
1151472036 17:74324636-74324658 CTCTTTCGAGAGGCTGAGGTGGG + Intergenic
1151599666 17:75098450-75098472 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1151651105 17:75470222-75470244 AACTTTTAAGAGGCTGAGGTGGG + Intronic
1151761783 17:76108258-76108280 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1151856398 17:76725292-76725314 CAGTTACAGGAGGCTGAGGCAGG + Intronic
1152072883 17:78142763-78142785 CTGATTCAGGAGGCTGAGGTGGG - Exonic
1152550933 17:81029794-81029816 TAGCCACTAGAGGCTGAGGTGGG - Intergenic
1152635265 17:81428265-81428287 CAGACACAAAAGGCTGAGGCGGG - Intronic
1152866397 17:82726338-82726360 CAGTCACAGGAGCCTGAGGGGGG - Intronic
1153288723 18:3480007-3480029 CAGATACTTGTGGCTGAGGTAGG - Intergenic
1153645085 18:7188263-7188285 TGGTTACTAGAGGCTGGGGTTGG - Intergenic
1154041633 18:10861582-10861604 TAGTTACCAGAGGCTGGGGAAGG + Intronic
1154183510 18:12158635-12158657 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1155357256 18:24965176-24965198 CCTATTCAAGAGGCTGAGGTAGG + Intergenic
1155462856 18:26103135-26103157 CAGCTACTTGAGGCTGAGGCAGG - Intergenic
1155620110 18:27768695-27768717 TAGTTCCAGGAGGCTGAGGAAGG - Intergenic
1156205698 18:34883421-34883443 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1156677014 18:39539608-39539630 TAGCTACAGGAGGCTGAGGCAGG - Intergenic
1156752539 18:40476744-40476766 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1157372564 18:47129825-47129847 CACTTTTGAGAGGCTGAGGTGGG + Intronic
1157760602 18:50261501-50261523 CTGTTCAAGGAGGCTGAGGTGGG - Intronic
1158144669 18:54298700-54298722 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1158907810 18:62030896-62030918 CAGCTACTCGAGGCTGAGGTGGG + Intergenic
1159588344 18:70303677-70303699 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1159679834 18:71335578-71335600 TAGTTACCAGAGGCTGGGATGGG - Intergenic
1160878512 19:1308994-1309016 CACTCGCGAGAGGCTGAGGTGGG - Intergenic
1161095428 19:2387631-2387653 CAGCTATGGGAGGCTGAGGTGGG + Intergenic
1161217075 19:3099890-3099912 CAGTTACAAGAGGCAGAGGTAGG - Intronic
1161383470 19:3978689-3978711 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1161431626 19:4235813-4235835 CAGTTACAAGAGGCTGAGGTGGG + Intronic
1161508010 19:4654453-4654475 CAGCTACCCGGGGCTGAGGTGGG - Exonic
1161531009 19:4789628-4789650 CAGTTACCAGTGGCTGCGGGTGG + Intergenic
1161867066 19:6840889-6840911 CAGCTACTCGAGGCTGAAGTGGG - Intronic
1161884438 19:6982914-6982936 CAGCTACTCAAGGCTGAGGTGGG + Intergenic
1161910114 19:7187191-7187213 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1161915319 19:7224055-7224077 CAGCTACTGGAGGCTGAGGTGGG - Intronic
1162149305 19:8633588-8633610 CACTTCCAAGAGCCAGAGGTGGG - Intergenic
1162173333 19:8809022-8809044 CACTTTTGAGAGGCTGAGGTGGG - Exonic
1162368538 19:10264556-10264578 CAGCTATGGGAGGCTGAGGTAGG + Intergenic
1162448653 19:10740620-10740642 CACTTTTAAGAGGCCGAGGTGGG - Intronic
1162616149 19:11802063-11802085 CACTTTCAGGAGGCTGAGGCAGG - Intronic
1162853102 19:13446835-13446857 CAGCTACTGGAAGCTGAGGTGGG - Intronic
1162882741 19:13672139-13672161 CAGCTACTAGGGGCTGAGGCAGG + Intergenic
1163330956 19:16637391-16637413 TAGTCCCAGGAGGCTGAGGTGGG + Intronic
1163598131 19:18232249-18232271 CAGCTACTCGAGACTGAGGTGGG + Intronic
1163776041 19:19218349-19218371 CACTTTCGGGAGGCTGAGGTGGG + Intronic
1164580439 19:29431829-29431851 CAGATGGAAGAGGCTGAGTTTGG + Intergenic
1164772763 19:30824317-30824339 CATTTGCCAGAGGTTGAGGTAGG + Intergenic
1164876868 19:31697051-31697073 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1165221565 19:34320830-34320852 TACTTGGAAGAGGCTGAGGTGGG - Intronic
1165368647 19:35387827-35387849 GATATACAGGAGGCTGAGGTGGG - Intergenic
1165530082 19:36391576-36391598 TAGCTACTCGAGGCTGAGGTGGG - Intronic
1165582591 19:36880664-36880686 CAGCTACCAGAGGCTGAGGTGGG + Intronic
1165881082 19:39044178-39044200 CAGCTACACAAGGCTGAGGCAGG + Intergenic
1166098875 19:40559041-40559063 CAGCTACTCGAGGCTGAAGTGGG - Intronic
1166116825 19:40661461-40661483 CAGTAACAGGAAGCTGAGGTGGG - Intergenic
1166168235 19:41007735-41007757 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1166327510 19:42060163-42060185 CAGTAACAAGGGGTTGAGTTGGG - Intronic
1166825161 19:45604230-45604252 CAGCTACCAGAGGCTGAGACAGG - Intergenic
1167291339 19:48626700-48626722 CAGCTACAGGAGGGTGAGGCAGG + Intronic
1167340126 19:48910576-48910598 CAGTTACTCGGGGCTGAGGCAGG + Intronic
1167561649 19:50229526-50229548 CAGCTACTTGAGGCTGAGGTGGG + Intronic
1167745536 19:51349557-51349579 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
1167968596 19:53170455-53170477 TGGTTACAAGAGGGTGGGGTTGG - Intronic
1167974487 19:53213765-53213787 CACTTTCGGGAGGCTGAGGTGGG + Intergenic
1168080115 19:54003967-54003989 CAGCTACTCGAGGATGAGGTGGG - Intronic
1168719272 19:58545894-58545916 CTGGTACATGAGGCTGAGGGGGG + Exonic
925313622 2:2905682-2905704 CACTTCCTGGAGGCTGAGGTGGG + Intergenic
925569044 2:5289278-5289300 CAGAGACATGCGGCTGAGGTGGG + Intergenic
925799330 2:7582617-7582639 CAGTTACCATAGGATGAGGTAGG - Intergenic
926024049 2:9524376-9524398 CAGCTAGAGGAGGCTGAGGTGGG + Intronic
926179252 2:10626066-10626088 CAGCTGCATGGGGCTGAGGTAGG + Intronic
926181125 2:10644134-10644156 CAGCTACAGGAGGTTGAGGTAGG + Intronic
926833499 2:16990897-16990919 CAGTTACCAGAGGCTGGGAAGGG - Intergenic
926885192 2:17590852-17590874 CAGTTAAAAGATACTGAGTTAGG - Intronic
927800902 2:26098382-26098404 CACTTTTGAGAGGCTGAGGTGGG - Intronic
928656412 2:33456148-33456170 CAGTTAAAAGAAGTTGAGTTGGG + Intronic
929075312 2:38075455-38075477 CAGTCCCCAGAGGCTGGGGTAGG - Intronic
929100923 2:38312595-38312617 CAGCTACGGGAGGCTGAGGCAGG + Intronic
929157504 2:38801350-38801372 CAACTGCCAGAGGCTGAGGTGGG - Intronic
929188165 2:39116737-39116759 CAGTCTCAGGAGGCTGAGGTGGG + Intronic
929295878 2:40245947-40245969 TAGTTATAAGAAGCTGAGCTAGG + Intronic
929434397 2:41916834-41916856 CAGCTACTAGAGGCTGTGGCCGG - Intergenic
929836770 2:45409108-45409130 CAGCTACTTGGGGCTGAGGTGGG + Intronic
929928227 2:46232488-46232510 CACTTTCAGGAGGCTGAGGCGGG - Intergenic
930060704 2:47286100-47286122 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
930291021 2:49492380-49492402 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
930705418 2:54500655-54500677 CTACTACAGGAGGCTGAGGTGGG - Intronic
930782275 2:55234361-55234383 CAACTACAGGAGGCTGAGGTGGG - Intronic
931469759 2:62526926-62526948 TAGTTACACGAGGGTGAGGCAGG - Intergenic
931682329 2:64761272-64761294 CAGCTACAGGAAGCTGAGGCAGG + Intergenic
932163617 2:69485770-69485792 CAGTTACTGGAGACTGAGGCAGG - Intronic
932199375 2:69812231-69812253 CAGCTACTCGAGGCTGAGGTGGG - Intronic
932228887 2:70065959-70065981 GAATTTCAGGAGGCTGAGGTGGG + Intergenic
932401842 2:71486201-71486223 CACTTGGAAGAGGATGAGGTTGG - Intronic
932427955 2:71654977-71654999 CAGCTACAGGAGGCTAAGGTGGG + Intronic
932592026 2:73073326-73073348 CAGTTACAGGAGGCTGCTGTGGG - Intronic
932636593 2:73394461-73394483 CAGTTACTGGAGGCTGAGGCAGG - Intronic
932650589 2:73551546-73551568 CAGCTACTCGAGGCTGAGGCAGG - Intronic
933174650 2:79161386-79161408 TAGTTACCAGAGGCTGAGACGGG + Intergenic
933298332 2:80515553-80515575 CAGTTGCCAGAGGCTGACATTGG + Intronic
933836592 2:86250871-86250893 CAGTTTCAAGAGACTGAGCTGGG - Intronic
933867414 2:86534308-86534330 CAGGTACGGGAGGCTGAGGTAGG - Intronic
934711631 2:96518932-96518954 CAGTCCTAGGAGGCTGAGGTGGG + Intergenic
934996688 2:98968125-98968147 CAGTTACCAGAGGCTGGGAATGG - Intergenic
935365103 2:102280627-102280649 CTCTTAGAAGAGGCTGAGCTGGG + Intergenic
935647243 2:105349341-105349363 CAGCTACAGGAGGCTGAAGCAGG - Intergenic
935728715 2:106046876-106046898 CAGCTACTAGGGGCTGAAGTGGG + Intergenic
936047213 2:109197101-109197123 CAGCTAGTAGAGGCAGAGGTTGG + Intronic
936099192 2:109560220-109560242 CAGTTAAAAAAGGCAGTGGTTGG - Intronic
936789354 2:116132906-116132928 CAGCTATGGGAGGCTGAGGTAGG - Intergenic
937003456 2:118489639-118489661 CGGTTACCAGAGGCTGGGGTGGG + Intergenic
937124467 2:119464632-119464654 CTTGTACAAGAGGCTGAAGTGGG + Intronic
937510969 2:122594489-122594511 CAGCAACTGGAGGCTGAGGTGGG + Intergenic
938225873 2:129615785-129615807 CAGTTACCAGAGTCTGGGGAGGG + Intergenic
938275552 2:130018017-130018039 CACTTTTAAGAGGCTGAGGCAGG + Intergenic
938326500 2:130408714-130408736 CACTTTTAAGAGGCTGAGGCAGG + Intergenic
938363438 2:130712741-130712763 CACTTTTAAGAGGCTGAGGCAGG - Intergenic
938885720 2:135645888-135645910 CAGTTAGAAGAAACTGAGATAGG + Intronic
939133448 2:138265796-138265818 CAGTTACCAGAGGCTGAGCAGGG + Intergenic
939153638 2:138500781-138500803 CAGCTACGGGAGGCTGAGTTGGG + Intergenic
939360910 2:141171352-141171374 CAGTTACCAGGGACTGGGGTGGG - Intronic
939488496 2:142847669-142847691 TGGTTACCAGAGGCTGAAGTAGG + Intergenic
939734981 2:145833084-145833106 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
939751403 2:146051652-146051674 CAGCTACTGGAGGCTGAGGTAGG + Intergenic
940317456 2:152340072-152340094 CCTACACAAGAGGCTGAGGTGGG + Intronic
940464751 2:154013858-154013880 CAGTGAGAAGAGGCTGTGGGTGG + Intronic
940760062 2:157728565-157728587 CAGTTACGCCAGACTGAGGTGGG + Intergenic
941144764 2:161831033-161831055 CAGCTACAAGATTCTGAGGTAGG + Intronic
942383255 2:175415617-175415639 CAGCTACTTGAGGCTGAGGTGGG - Intergenic
942736770 2:179123189-179123211 CAGTTACATTAAGCTGATGTAGG - Intronic
942858780 2:180585004-180585026 CAGTTAGAAGTGACTGAAGTTGG - Intergenic
943068629 2:183115327-183115349 CAGGAACAAGAGAGTGAGGTGGG + Intergenic
943145876 2:184044275-184044297 CAGCTATAGGAGGCTGAGGTGGG - Intergenic
943342177 2:186694283-186694305 CTGTTGGATGAGGCTGAGGTCGG - Exonic
943961713 2:194272735-194272757 TAGTTACTCGAGGCTGAGGCAGG + Intergenic
944486201 2:200208365-200208387 CAGTTACCAGAGCCTGGAGTGGG + Intergenic
944606184 2:201353697-201353719 CACCTACAGGAGGCTGAGGCGGG - Intronic
944624069 2:201552105-201552127 TAGTTACTCAAGGCTGAGGTGGG - Intronic
944703996 2:202270651-202270673 CTGCTGCAGGAGGCTGAGGTGGG + Intronic
944771621 2:202920264-202920286 CAGCTACAGGAGTCTGAGGCAGG - Intronic
944842791 2:203640475-203640497 TGGTTACCAGAGGCTGGGGTTGG - Intergenic
945525145 2:210878845-210878867 CAGTTACAAGAGGCTGAGGCAGG + Intergenic
945588792 2:211701642-211701664 CAGCTACCGGAGGCTGAGGCAGG + Intronic
945691181 2:213038170-213038192 CAGCTACGGGAGGCTGAGGCAGG - Intronic
945874443 2:215263693-215263715 CAGTGTTAAGAGGCAGAGGTGGG - Intergenic
946260076 2:218481765-218481787 CAGCTACTCGAGGCTGAGGTGGG - Intronic
946277311 2:218641356-218641378 CAGCTACTCGAGGCTGAGGCAGG - Intronic
946906319 2:224419760-224419782 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
946956058 2:224931212-224931234 CAGTTAGAAATGGCTGAGGGAGG + Intronic
947391550 2:229644453-229644475 GGATTACAGGAGGCTGAGGTAGG - Intronic
947580351 2:231312293-231312315 GAGTTCCAAGAGGTTGAAGTTGG + Intronic
947730826 2:232430442-232430464 CAGCTACCCGAGGCTGAGGCAGG - Intergenic
948504232 2:238417348-238417370 GAGACTCAAGAGGCTGAGGTGGG - Intergenic
948912824 2:241013242-241013264 TGGTTACCAGGGGCTGAGGTGGG - Intronic
1168848996 20:963899-963921 CAGGCACACGAGGCTGCGGTGGG - Intronic
1169133694 20:3182683-3182705 CAGCTACAGGAAGCTGAGGTGGG - Intergenic
1169203901 20:3729672-3729694 CAGTGCTAACAGGCTGAGGTGGG + Intergenic
1169361268 20:4951270-4951292 CAAAAACAAGACGCTGAGGTGGG + Intronic
1169420497 20:5455211-5455233 TAGCTACTCGAGGCTGAGGTGGG - Intergenic
1169446359 20:5674751-5674773 CAGTCCCAGGAGGCTGAGGTAGG - Intergenic
1169752707 20:9010968-9010990 CAGTTCCACGTGGCTGAGGGAGG - Intergenic
1169791096 20:9411760-9411782 CAGATGCATGAGGCTGAGGTGGG - Intronic
1170238796 20:14139233-14139255 CAGTTATGGGAGGCTGAGGCGGG - Intronic
1171122316 20:22578043-22578065 GAGTTTGAAGAGGCTGAGGCCGG - Intergenic
1171768657 20:29303780-29303802 CAGTTACAAGGGGATGGGGGAGG - Intergenic
1171998866 20:31755647-31755669 CAGCTACTAGAGACTGAGGCAGG + Intronic
1172069967 20:32249494-32249516 CAGTTACCACAGGTTGAGGTAGG - Intergenic
1172275715 20:33677904-33677926 GTGCTTCAAGAGGCTGAGGTGGG - Intronic
1172321227 20:33996535-33996557 CAGTTACATGACCCTGAGGCAGG - Intronic
1172800128 20:37570211-37570233 CAGTTACCAGAGGCTGGGAAGGG - Intergenic
1173068302 20:39736372-39736394 AATTCACAAGAGGCAGAGGTAGG - Intergenic
1173596106 20:44259203-44259225 CAGATACAAAAGGATGAAGTAGG - Intronic
1174169646 20:48607996-48608018 CAGCTACCGGAGGCTGAGGCAGG + Intergenic
1174322579 20:49753710-49753732 CAGTCCCAGGAGGCTGAGGTGGG - Intergenic
1175066350 20:56291826-56291848 TAGTTCCAGGAGGCTGAGGTGGG - Intergenic
1175085803 20:56457766-56457788 CACTTTAAGGAGGCTGAGGTGGG + Intronic
1175377145 20:58535855-58535877 CAATTCCAGGAGGCTGAGGCAGG - Intergenic
1175502452 20:59460156-59460178 CAGGGAGAAGAGACTGAGGTTGG + Intergenic
1175727725 20:61331257-61331279 CAGTGAGAACAGGCTGAGGGAGG - Intronic
1175790601 20:61737876-61737898 CAGAGACAGGAGGCTGTGGTTGG + Intronic
1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG + Intergenic
1177098443 21:16868779-16868801 TGGTTACCAGAGGCTGAGGGTGG + Intergenic
1177808617 21:25900873-25900895 CAGCTACTAGAGGCTTAGGCAGG + Intronic
1178041344 21:28643564-28643586 CAGCTACTGGAGGCTTAGGTGGG + Intergenic
1178134891 21:29615838-29615860 AAGTTACGGGAGACTGAGGTTGG - Intronic
1178141786 21:29692683-29692705 CAGCTACCACAGGCTGAGGCAGG - Intronic
1178524081 21:33310850-33310872 CTACTTCAAGAGGCTGAGGTGGG + Intergenic
1178637270 21:34315054-34315076 CAGCTATAGGAGGCTGAGGCGGG + Intergenic
1178860169 21:36282304-36282326 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1179458674 21:41518255-41518277 CAGTGACAAGAGGGTCAAGTTGG - Intronic
1179775880 21:43661758-43661780 CAGTTACACGGGGCTTAGGCAGG - Intronic
1180245134 21:46542058-46542080 TATTTATAAGAGGCTGAGGCAGG - Intronic
1180719479 22:17896740-17896762 CAGTTACTAGTGGCTCTGGTCGG - Exonic
1180873538 22:19162357-19162379 CAGCAACCAGAGGCTGAGGTGGG - Intergenic
1180946151 22:19694774-19694796 CAGCTTCAGGAGGCTGAGGTGGG - Intergenic
1181186053 22:21104706-21104728 CAGCTACCATAGACTGAGGTGGG - Intergenic
1181461287 22:23087350-23087372 CAGCTACTCGAGGCTCAGGTGGG + Intronic
1181567269 22:23746702-23746724 CAGTCCCAGGAGGCTGAGGTGGG - Intronic
1181760023 22:25051923-25051945 CACTAACATGAGGCTGAAGTAGG - Intronic
1182239148 22:28900857-28900879 CAGCTTTAGGAGGCTGAGGTGGG + Intronic
1182448287 22:30402627-30402649 CTGTTGTAAGAGGCTGAGCTTGG - Intronic
1182637473 22:31740170-31740192 CAGCTACAGGAAGCTGAGGCAGG - Intronic
1182671997 22:32004176-32004198 CATATTCAGGAGGCTGAGGTGGG - Intergenic
1182799635 22:33021160-33021182 GAGCTGCAAGAGGCAGAGGTGGG - Intronic
1183593785 22:38797446-38797468 CAGCTACAGGAGGCTGAGACAGG - Intergenic
1183769546 22:39912304-39912326 TAGCTACAGGAGGCTGAGGCAGG + Intronic
1183791512 22:40074397-40074419 CACTTTCGGGAGGCTGAGGTAGG + Intronic
1183867320 22:40714169-40714191 GAATTTCAAGAGGCAGAGGTGGG - Intergenic
1184171494 22:42762375-42762397 CACTTATAGGAGGCTGAGGCAGG + Intergenic
1184215308 22:43062905-43062927 CACTTACAATAGCCTGAAGTTGG + Intronic
1184219708 22:43091856-43091878 CAGTTACCAGGGGCTGGGGAAGG - Intergenic
1184431428 22:44443426-44443448 GAGATACAAGAGGCAGAGGGCGG + Intergenic
1184713393 22:46266538-46266560 CATTTATGGGAGGCTGAGGTGGG + Intergenic
1184733637 22:46385204-46385226 CAGCTACTTGAGGCTGAGGTGGG - Intronic
949896838 3:8774048-8774070 CAGTTCCCAGAGGCAGAAGTGGG - Intronic
950011483 3:9727226-9727248 CAGTGAGAAGAGGCTAAGTTGGG + Intronic
950065284 3:10107397-10107419 CAGCTACGGGAGGCTGAGGCAGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950518467 3:13482100-13482122 CAGTTACAAGAGGCGGAGTTGGG + Intronic
950760852 3:15224382-15224404 GCTATACAAGAGGCTGAGGTGGG - Intronic
951171031 3:19541855-19541877 CAGTTTCATGAGTCTGAGCTTGG + Intergenic
951193062 3:19792601-19792623 CGGTTACCAGAGGCTGAGAAGGG + Intergenic
952282176 3:31934518-31934540 CAGCTTCAGGAGGCTGAGGCAGG - Intronic
952282831 3:31939845-31939867 CAGCTACAGGAGGCTGAGGCAGG - Intronic
952283141 3:31942421-31942443 CAGCTACAAGAGGCTGAGAGAGG + Intronic
952309089 3:32170858-32170880 CAGCTACTCGGGGCTGAGGTGGG + Intergenic
952509773 3:34041365-34041387 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
952832442 3:37576442-37576464 CAGTTACAACAGTGTGAGGTGGG + Intronic
952882277 3:37992215-37992237 CAGTTACCAGAGGCCCAGGCAGG - Intronic
953135049 3:40175027-40175049 CAGCTACTGGAGGCTGAGGCAGG + Intronic
953756941 3:45654718-45654740 CAGCTACTCAAGGCTGAGGTGGG + Intronic
953938015 3:47063363-47063385 TACTTGCAAGAGGCTGAGGCAGG + Intronic
954016580 3:47697205-47697227 CTGAAACGAGAGGCTGAGGTGGG + Intronic
954173987 3:48828606-48828628 CAGCTACTCCAGGCTGAGGTGGG + Intronic
954362625 3:50130290-50130312 CAGTTTCAAGAGGCTGAAGAAGG - Intergenic
954567824 3:51613651-51613673 CAGCTACGGGAGGCTGAGGCAGG + Intronic
956118447 3:65941901-65941923 CAGCTTCAGGAGGCTGAGGTGGG - Intronic
956506937 3:69951207-69951229 CAGCTACGGGAGGCTGAGGTGGG - Intronic
956799689 3:72745952-72745974 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
957565285 3:81877454-81877476 TAGCTACAGGAGGCTGAGGCAGG - Intergenic
957767757 3:84648214-84648236 CAGTTACACATGGCTGGGGTTGG + Intergenic
957789773 3:84925220-84925242 CAGTTAGCAGAGGCTGAGAGAGG + Intergenic
957888707 3:86326559-86326581 TGGTTACCAGAGGCTGAGGAGGG + Intergenic
958056694 3:88421526-88421548 CAACTACTTGAGGCTGAGGTAGG - Intergenic
958851975 3:99338332-99338354 TAGTTACCAGAGGCTGAGGGTGG - Intergenic
959254976 3:103998163-103998185 CTGTTACTAGAGGCTGAGGAGGG + Intergenic
959759002 3:109935610-109935632 TGGTTACAAGAGGCTGGGGTAGG - Intergenic
959854063 3:111127675-111127697 CAGCTACTGAAGGCTGAGGTGGG - Intronic
959943674 3:112105709-112105731 CAGTTACGGGAGGCTGAGGCAGG + Intronic
960075538 3:113480765-113480787 CGGCTACTAGAGGCTGAGGGAGG + Intronic
960120255 3:113942025-113942047 CAGCTACGGGAGGGTGAGGTGGG - Intronic
960416059 3:117386313-117386335 TGGTTACTAGAGGCTGAGATGGG + Intergenic
960467425 3:118014457-118014479 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
960805785 3:121582815-121582837 CAGCTATGGGAGGCTGAGGTGGG - Intronic
961231495 3:125316003-125316025 TAGTTACTAGAGGCTGAGAAGGG - Intronic
961475524 3:127143872-127143894 CAGTTACCAGAGGCTGGGAAGGG - Intergenic
961755655 3:129125778-129125800 CGAGTACAAGAGGCTGAGTTGGG - Intronic
961843048 3:129734569-129734591 CAGCTACTTGAGGCTGAGGTGGG + Intronic
961902685 3:130228577-130228599 CAGTTATCAGAGGCTGAGAAGGG - Intergenic
962605356 3:137028306-137028328 TGGTTACCAGAGGCTGAGGAGGG + Intergenic
962624202 3:137209384-137209406 GAGATACAAGAGGCTAAGGGAGG - Intergenic
962791779 3:138817838-138817860 GAGTCACCAGAGGCTGAAGTGGG + Intronic
962823575 3:139077304-139077326 CAGTTACTAGAGGCTGGGAAGGG + Intronic
962996199 3:140631224-140631246 CAGATATAAGAGGCAGAGGCAGG + Intergenic
963089129 3:141465651-141465673 AAGTTAGAGGAGGGTGAGGTTGG - Intergenic
963230569 3:142905185-142905207 CTGTTACATGAGGCTGAAGTTGG + Intergenic
963438074 3:145297434-145297456 GAGTTACAAGGGCCTGAGGGTGG + Intergenic
963618363 3:147572472-147572494 CAGCTACACAAGGGTGAGGTGGG - Intergenic
963757006 3:149245228-149245250 TAGCTACGGGAGGCTGAGGTAGG - Intergenic
964066268 3:152583646-152583668 CAGTCACAAGGGGCAGGGGTGGG + Intergenic
964534821 3:157708523-157708545 GACTTACAAGAGGGGGAGGTGGG + Intergenic
964758325 3:160109514-160109536 CAGCTACTAAAGGCTGAGGCAGG - Intergenic
964821603 3:160776712-160776734 CAGTTACAGGAGGCTGAGGCAGG - Intronic
965096344 3:164232143-164232165 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
965179367 3:165382236-165382258 CAGCTACAGGAGGCTAAGGAAGG - Intergenic
965444199 3:168754189-168754211 CAGCTACTCGAGGCTGAGGTAGG - Intergenic
965584599 3:170306308-170306330 TAGTCCCAGGAGGCTGAGGTGGG + Intergenic
965725338 3:171710172-171710194 CAGCTACTCGAGGCTGAGGCAGG - Intronic
965788777 3:172365034-172365056 CAGTTTCAAGACACTGAGGAAGG - Intronic
965815132 3:172628403-172628425 CAGCTACTGGAGGCTGAGGCAGG + Intergenic
965935525 3:174105429-174105451 CAGATGGCAGAGGCTGAGGTGGG + Intronic
966439523 3:179928403-179928425 CATTTACAAATGGCTGAGGGTGG + Intronic
966728025 3:183125795-183125817 TAGTCCCAAGAGGATGAGGTGGG - Intronic
967071928 3:185969962-185969984 GATTCCCAAGAGGCTGAGGTGGG - Intergenic
967159543 3:186723429-186723451 CAGATACCAGAGGCTGAGCGGGG - Intronic
967307250 3:188070830-188070852 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
968110707 3:196044478-196044500 CAGCAACTCGAGGCTGAGGTGGG + Intronic
968811647 4:2802280-2802302 CAGCTATAGGAGGCTGAGGCAGG + Intronic
968860877 4:3168762-3168784 CAGCTACTCGGGGCTGAGGTGGG + Intronic
968881482 4:3302526-3302548 CAGTCACAAGAGGCTGGGAGGGG - Intronic
969143107 4:5097022-5097044 AACTCACAAGAGGCAGAGGTAGG + Intronic
970058502 4:12002330-12002352 TAGGTACAAGAGGCTGGGGGTGG + Intergenic
970296755 4:14639000-14639022 CAGCTACAGGAGGCAGGGGTGGG + Intergenic
970585895 4:17513934-17513956 CAGCTACTGGAGGCTGAGGCTGG - Intergenic
970599234 4:17627715-17627737 CAGGCACAGGAGGCTGAGGCAGG + Exonic
970888658 4:21016722-21016744 CAGCTACTGGAGGCTGAGGCAGG - Intronic
971298018 4:25417234-25417256 CAGCTATGAGAGGCTGAGGCAGG - Intronic
971566162 4:28144318-28144340 GTGTTACAAGAAGCTGAGCTCGG - Intergenic
972857953 4:43130819-43130841 GTGCTACGAGAGGCTGAGGTGGG + Intergenic
973286857 4:48428026-48428048 CACTTACGGGAGGCTGAGGTGGG + Intergenic
973758116 4:54094713-54094735 CAGTAACAATGGCCTGAGGTGGG - Intronic
973955204 4:56056679-56056701 CAGTTACTTGGGGCTGAGGTGGG + Intergenic
974050538 4:56937650-56937672 CTACTCCAAGAGGCTGAGGTGGG - Intergenic
974056679 4:56990335-56990357 CATATTCAAGAGGATGAGGTAGG - Intronic
974060319 4:57027417-57027439 CAGCTACTTGAGGCTGAGATGGG - Intronic
974625742 4:64427381-64427403 CAGTTACAGGAGGCCGAGGTGGG - Intergenic
974717715 4:65691859-65691881 CAGCTACAGGAGGTTGAGGCAGG + Intergenic
975161317 4:71127972-71127994 CAGCTACTTGAGGCTGATGTGGG + Intergenic
975535844 4:75449209-75449231 TAGTCTCAGGAGGCTGAGGTGGG - Intergenic
975741833 4:77436733-77436755 TGGTTACTAGGGGCTGAGGTGGG - Intergenic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
975811769 4:78177197-78177219 CATTTCCAGGAGGCTGAGGCAGG - Intronic
975853200 4:78594885-78594907 GAGATTCAGGAGGCTGAGGTGGG + Intronic
976151423 4:82096349-82096371 CAGTTACCAGAGGCTGGGAAGGG + Intergenic
976183063 4:82417436-82417458 CAGTTACCAGAGACTGGGGAGGG - Intergenic
976236470 4:82902218-82902240 TAGTCCCATGAGGCTGAGGTGGG - Intronic
976240653 4:82953100-82953122 CACCTACAGGAGGCTGAGATGGG - Intronic
976586139 4:86799441-86799463 CAGCTACTCGAGGCTGAGGCAGG - Intronic
976625785 4:87180237-87180259 CTGTTACCAGAGTCTAAGGTAGG + Intronic
976725287 4:88210299-88210321 CAGCCACTGGAGGCTGAGGTGGG - Intronic
976790982 4:88878174-88878196 CAGCTACAGGAGGCTGAGGCAGG + Intronic
977087540 4:92621547-92621569 CAGCTATAGGAAGCTGAGGTGGG + Intronic
977149799 4:93496543-93496565 AAGTTACCAGAGGTTGGGGTTGG - Intronic
977394540 4:96454601-96454623 TGGCTACAAGAGGCTGGGGTGGG + Intergenic
977604689 4:98971778-98971800 CAGCTACATGAGGCTGAGTCAGG - Intergenic
978056540 4:104275625-104275647 CACTTATAGGAGGCTGAGGCAGG + Intergenic
978233010 4:106423703-106423725 CAGCCTCAGGAGGCTGAGGTGGG + Intergenic
978361845 4:107939047-107939069 CAGCTACTCGAGGCTGAGGCAGG + Intronic
978529654 4:109701206-109701228 CACTTCCAGGAGGCTGAGGCAGG - Intronic
979464822 4:121024027-121024049 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
979722719 4:123920873-123920895 CAGTTACCAGAGGTTGGGGGAGG - Intergenic
980115053 4:128671474-128671496 CAGCTAAAAGAGGCTGGGGGTGG + Intergenic
980276807 4:130663255-130663277 CTACTCCAAGAGGCTGAGGTGGG + Intergenic
980298741 4:130959528-130959550 CACTTTTGAGAGGCTGAGGTGGG - Intergenic
980384714 4:132073297-132073319 TAATTACAAGAGGTTGGGGTGGG + Intergenic
980828932 4:138106330-138106352 CAGTTATAAGATTCCGAGGTTGG + Intergenic
980843299 4:138293118-138293140 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
980944804 4:139308860-139308882 CACTTGGGAGAGGCTGAGGTGGG - Intronic
981156823 4:141447518-141447540 CAGCTACAGGAGGCTGGAGTGGG + Intergenic
981250857 4:142598860-142598882 CTGCTGCTAGAGGCTGAGGTAGG + Intronic
981414832 4:144480682-144480704 CAGTTACCAGAGGCTGGGAAGGG + Intergenic
982044953 4:151435279-151435301 TAGTTACCAGAGGCTGAGAGAGG - Intronic
982063090 4:151624379-151624401 CAGGTACAAGAGGCACACGTGGG - Intronic
982746480 4:159108828-159108850 CAGTTACTCGAGGCTGACGCAGG - Intronic
982914786 4:161193792-161193814 CTACTCCAAGAGGCTGAGGTAGG - Intergenic
983225661 4:165084064-165084086 CACTTTTAAGAGGCTGAGGTGGG - Intronic
983249862 4:165331190-165331212 CAGCTACGAGGGGCTGAGGTGGG + Intronic
983556674 4:169065254-169065276 CAGCTACAGGAGGCTGAGGCTGG + Intergenic
983583126 4:169328811-169328833 TAGGAACAAGAGGCTGAGGCAGG + Intergenic
983653183 4:170053708-170053730 CACACACAGGAGGCTGAGGTGGG - Intergenic
983864829 4:172753272-172753294 CAGTTCCACATGGCTGAGGTGGG - Intronic
983946760 4:173594945-173594967 CAGCTACAGGAGGATGAGGCAGG - Intergenic
983990233 4:174109252-174109274 CATTTACAATAGGCTTTGGTTGG - Intergenic
984873151 4:184345108-184345130 CAGTTGCATGAGGCAGAGGTAGG + Intergenic
984978730 4:185256735-185256757 CAGCTACTTGGGGCTGAGGTGGG - Intronic
985147972 4:186914028-186914050 CACTTTGAGGAGGCTGAGGTGGG + Intergenic
985816081 5:2129203-2129225 CAGTTGCAAGAGGCAGAGATAGG + Intergenic
985955630 5:3263408-3263430 CAGTTATTTGGGGCTGAGGTGGG + Intergenic
986141511 5:5034722-5034744 CAGCTACTAGGGGCTGATGTGGG + Intergenic
986378496 5:7159413-7159435 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
986866606 5:11996511-11996533 CAGCTACCAGAGGCTGAGAAGGG - Intergenic
987124654 5:14800836-14800858 CAGCTACCCGAGGCTGAGGTGGG - Intronic
987189061 5:15454760-15454782 TAGTTACCAGAGGCTGAGAAGGG - Intergenic
987334752 5:16888924-16888946 CACTTTTGAGAGGCTGAGGTGGG + Intronic
987335013 5:16891173-16891195 CAGCTACTTGAGGCTGAGGCAGG + Intronic
987358908 5:17088988-17089010 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
987363784 5:17130258-17130280 CACTTACAGGAGGCCCAGGTGGG - Intronic
987912118 5:24161259-24161281 TAGTTACCAGAGGCTGAGAAGGG + Intronic
988306998 5:29505603-29505625 CCTATACAAGAGGCTGAGATAGG + Intergenic
988318199 5:29659018-29659040 TAGTTTCAGGAGGCTGAGGCAGG + Intergenic
988575335 5:32417666-32417688 CAGCAACAGAAGGCTGAGGTTGG + Exonic
988643161 5:33064275-33064297 CAGTAGAAGGAGGCTGAGGTGGG - Intergenic
988662261 5:33284448-33284470 CAGCTAGAAGTGGCTGAGCTGGG - Intergenic
991087885 5:62664920-62664942 CAGTTACTCGAGGCTGAGGTAGG + Intergenic
991518799 5:67470738-67470760 TGGTTACAAGAGGCTGAGGGTGG - Intergenic
991907515 5:71526797-71526819 CAGCTACAGGAGGCTGAGGCAGG - Intronic
991959338 5:72028402-72028424 TGGTTACCAGAGTCTGAGGTGGG - Intergenic
991962901 5:72063500-72063522 CAGTCACATGAGGTAGAGGTGGG + Intergenic
992255750 5:74919439-74919461 AAGTTACAGGAGGTCGAGGTGGG + Intergenic
992759286 5:79937407-79937429 CATCTACAGGAGGCTGAGGCAGG - Intergenic
992810974 5:80388193-80388215 TAGCTACAGGAGGCTGAGGTGGG + Intergenic
993266839 5:85737316-85737338 TGGTTACAAGAGGCTGGGATTGG - Intergenic
993431353 5:87836030-87836052 AAGTTACCAGAGGCTGTTGTTGG - Intergenic
993948868 5:94149177-94149199 CAGTTACTAGAGGCTGGGAAGGG + Intergenic
994092312 5:95820237-95820259 CAGCCACGGGAGGCTGAGGTGGG + Intronic
994166543 5:96615172-96615194 CAATTACAATAGCCTGTGGTTGG - Intronic
994748900 5:103713926-103713948 CAGTTAAAAGAGGCTAAGGCAGG + Intergenic
994877217 5:105439619-105439641 CAGTTACCAGAGGTTGGGGAGGG + Intergenic
995171893 5:109124113-109124135 CAGCTACAAAAGGCTGAGGTGGG + Intronic
995234966 5:109818250-109818272 CAGTTACAGGAGGCTGAGGCAGG - Intronic
995237663 5:109848660-109848682 CAGTAAAAGGATGCTGAGGTGGG - Intronic
995340990 5:111059373-111059395 CAGTTGCAGGAGGATGAGGCAGG - Intergenic
995340996 5:111059401-111059423 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
995455363 5:112346335-112346357 CAGCTACAGGAGGCTGAGGCAGG - Intronic
995540595 5:113182482-113182504 GACTTTCAGGAGGCTGAGGTAGG + Intronic
995590119 5:113690614-113690636 CAGTGACAGGAGGCTGAGGCAGG + Intergenic
995604648 5:113839314-113839336 CAGTTACCAGCGGCTGGGGTGGG + Intergenic
995817587 5:116189311-116189333 TAGCCACTAGAGGCTGAGGTGGG - Intronic
995855195 5:116584432-116584454 GAGAAACAAGAGTCTGAGGTGGG - Intergenic
996728373 5:126692860-126692882 CAGCTACTTGGGGCTGAGGTGGG - Intergenic
996759157 5:126969777-126969799 CTGCTACAGGAGGCTGGGGTGGG + Intronic
996931141 5:128889700-128889722 CAGTTACCAGAGGCTGAGAAGGG - Intronic
997138475 5:131352556-131352578 CAGTTATAAAAGACTGAGGTAGG - Intronic
997149837 5:131481336-131481358 CTGCTCCAAGAGGCTGAGGTGGG - Intronic
997326186 5:133023657-133023679 CAGCTAAAGGAGGCTGAGGCAGG + Intronic
998444674 5:142189324-142189346 CAGCTACTAGAGGCTGAGGCGGG + Intergenic
998465185 5:142337928-142337950 AAGAAAAAAGAGGCTGAGGTGGG + Intergenic
998529819 5:142874134-142874156 CCTTAAAAAGAGGCTGAGGTGGG + Intronic
998662426 5:144254676-144254698 CAGTTGCCAGAGGCTGTGGGAGG - Intronic
999136293 5:149321791-149321813 CACTTATAGGAAGCTGAGGTGGG + Intronic
999274736 5:150322209-150322231 CAGCTACAGGAGGTTGAGGTTGG + Intronic
999377606 5:151097723-151097745 CAGTCTCGAGAGGCTGAGGTGGG - Intergenic
999720219 5:154394026-154394048 CTGCTCCAAGAGGCAGAGGTGGG + Intronic
1000120881 5:158196875-158196897 CAGGAACAAGGGGCTGAGGGAGG - Intergenic
1000199545 5:158994360-158994382 GAGTTAAAAGAGGCTGAGGTTGG - Intronic
1000393385 5:160748229-160748251 CAGTTTCAAGATGCTGGGGAGGG - Intronic
1000445208 5:161310872-161310894 CAGCTACTGGAGGCTGAGGCAGG - Intronic
1000446098 5:161323133-161323155 CAGCTACTAGAGTCTGAGGCAGG - Intronic
1001069250 5:168569936-168569958 CAGTTACAGGAGGCTGAGGCAGG + Intronic
1001307658 5:170587308-170587330 CTACTCCAAGAGGCTGAGGTGGG + Intronic
1001328278 5:170745023-170745045 GCTTTGCAAGAGGCTGAGGTGGG - Intergenic
1001607639 5:172973944-172973966 CAGTTCTGGGAGGCTGAGGTGGG - Intergenic
1001745255 5:174087674-174087696 TACTTGCAGGAGGCTGAGGTGGG + Intronic
1001819935 5:174702565-174702587 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1001954553 5:175839529-175839551 CACTTTTGAGAGGCTGAGGTGGG - Intronic
1002020090 5:176358600-176358622 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1002258652 5:177978693-177978715 CAGTTCCCACAGGCTGGGGTGGG - Intergenic
1002294489 5:178222756-178222778 CAGTCAGGACAGGCTGAGGTTGG + Intronic
1002560244 5:180076805-180076827 CAGATAAAAGAGGCTCAGGTGGG - Intergenic
1003236605 6:4300761-4300783 CAGTGATGACAGGCTGAGGTGGG - Intergenic
1003573368 6:7270516-7270538 CAGCTACGGGAGGCTGAGGCAGG + Intronic
1004313054 6:14562864-14562886 TAGTTACCAGAGGCTGGGGTGGG + Intergenic
1004325717 6:14672393-14672415 CAGCTACAAAAGGCTCATGTTGG - Intergenic
1004420519 6:15465337-15465359 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1004455418 6:15787401-15787423 CAGTTTCTAGAGGCTGGGGGTGG + Intergenic
1004573198 6:16867903-16867925 CAGCTCCAGGACGCTGAGGTAGG + Intergenic
1004616116 6:17291019-17291041 CTGTCACAAGAGGCTGTCGTGGG - Intronic
1005291017 6:24378838-24378860 CAGCTACCTGAAGCTGAGGTGGG + Intergenic
1005636967 6:27762040-27762062 CAGCTACGGGAGGCTGAGGCAGG - Intergenic
1005661953 6:28007397-28007419 CAGTCTCAGGAGGCTGAGGCAGG - Intergenic
1006608861 6:35280247-35280269 GAGTTGGAAGAGGCTGAGGCAGG + Intronic
1006749814 6:36369792-36369814 TAATTGCAAGAGGCTGAAGTGGG + Intronic
1006812688 6:36830295-36830317 CAGCTCCGAGAGGCTGAGGATGG - Intronic
1007011739 6:38424948-38424970 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1007041934 6:38730345-38730367 CAGGCACAAGATGCTGAGATAGG - Intronic
1007349577 6:41259167-41259189 CAGTTCCATGTGGCTGAGGAGGG - Intergenic
1007595527 6:43048877-43048899 CAGCTACTGGAGGCTGAGGCAGG - Intronic
1007863327 6:44938019-44938041 TAGTGACAGGAGGCTGAGGCAGG - Intronic
1008630073 6:53356175-53356197 GCTCTACAAGAGGCTGAGGTGGG - Intergenic
1008702632 6:54119516-54119538 TGGTTACCAGAGGCTGTGGTTGG + Intronic
1009308030 6:62116773-62116795 TAGTTACCAGAGGCTGAGAGGGG - Intronic
1009674081 6:66794252-66794274 TAGTTACAAGAGGCTAGGTTGGG + Intergenic
1010100977 6:72108129-72108151 CAGTTACAGAAGGGTGAGGTAGG - Intronic
1011203115 6:84859807-84859829 CGGTTACCAGAAGCTGAGGATGG + Intergenic
1012209886 6:96506692-96506714 TAGCTACAGGAGGCTAAGGTGGG - Intergenic
1012712280 6:102622417-102622439 CAGCTACCAGAGGCTGAGGTGGG + Intergenic
1012744784 6:103072077-103072099 AAGTTACAAGAGGCTGAGAAGGG + Intergenic
1013354284 6:109333579-109333601 TAGCTTCAGGAGGCTGAGGTTGG - Intergenic
1013363595 6:109417800-109417822 CAGTAACAAGAGTCCAAGGTTGG - Intronic
1013601066 6:111705496-111705518 TAGTCCCAGGAGGCTGAGGTAGG - Intronic
1014246362 6:119073984-119074006 TAGCTCCAAGAGGCTGAGGAAGG + Intronic
1015607502 6:134973722-134973744 CAGTTCCGGGAGGCTGAGGCAGG + Intronic
1015836400 6:137425051-137425073 GATATGCAAGAGGCTGAGGTGGG - Intergenic
1015956765 6:138606947-138606969 CACTTTCAGGAGGCTGAGGCAGG - Intronic
1016405672 6:143727117-143727139 CAGTTACGAGAGGCTGGGAAGGG - Intronic
1017438084 6:154436597-154436619 CAGCTACTAGAGGCTGAGATGGG - Intronic
1017450341 6:154548982-154549004 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1017498148 6:154999650-154999672 AAGTTACAAGAAACTGAGGCCGG - Intronic
1017636220 6:156445693-156445715 AATTTAAAGGAGGCTGAGGTGGG - Intergenic
1017941636 6:159058392-159058414 CAGCTATAGGAGGCTGAGGAAGG - Intergenic
1018048669 6:159988399-159988421 CAGCTACGGGAGGCTGAGGCAGG + Intronic
1018318472 6:162581645-162581667 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1018770269 6:166964522-166964544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1019217786 6:170454759-170454781 AAGAGAAAAGAGGCTGAGGTGGG - Intergenic
1019681041 7:2349842-2349864 CTGTCACAGGAGGCTGAGGCAGG - Intronic
1019767045 7:2859141-2859163 CAGCTACAGGAGGCTGAGGCTGG + Intergenic
1019807882 7:3141933-3141955 CAGCCTCAGGAGGCTGAGGTGGG + Intronic
1019890469 7:3942018-3942040 CAGCTACGGGAGGCTGAGGCAGG - Intronic
1020034564 7:4957231-4957253 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1021281221 7:18720791-18720813 TAGTCCCAGGAGGCTGAGGTGGG - Intronic
1021385875 7:20029287-20029309 TAGTGTCAGGAGGCTGAGGTGGG - Intergenic
1021720668 7:23501459-23501481 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1021806081 7:24357419-24357441 CAGGTACAAAAGCCTGAGCTGGG - Intergenic
1021806582 7:24362844-24362866 CAGCTACTTGAGGCTGAGGCAGG - Intergenic
1022144684 7:27525140-27525162 ATGTTTCTAGAGGCTGAGGTGGG + Intergenic
1022177307 7:27884242-27884264 CAGTTACTCGGGGCTGAGGCAGG - Intronic
1022545431 7:31183472-31183494 CACCTACTTGAGGCTGAGGTGGG - Intergenic
1022795880 7:33731090-33731112 CACTGACAAGAGTCTGAGGGTGG - Intergenic
1023412870 7:39904806-39904828 TAGTCCCAGGAGGCTGAGGTGGG + Intergenic
1023925574 7:44667056-44667078 CAGATACAAGAGGTTGGGGTGGG - Intronic
1023991067 7:45129095-45129117 CAGTTGCCAGAGGCTGGGGACGG - Intergenic
1024336103 7:48206974-48206996 TAGTTACCAGAGGCTGAGAAGGG - Intronic
1024368578 7:48552974-48552996 TAGTTACCAGAGGCTGGGGAGGG - Intronic
1024874987 7:54011570-54011592 CAGTTACCAGAGGCTGGGAAGGG + Intergenic
1024886289 7:54146429-54146451 CAGTTACTGGGGGCTGAGGCAGG + Intergenic
1025040779 7:55643545-55643567 CAGCTATAGGAGGCTGAGGCAGG - Intergenic
1025070266 7:55892164-55892186 CAGCTACAGGAGGCTGAGGCTGG + Intronic
1025619717 7:63157449-63157471 CAGCTACTTGAGGCTGAGGTGGG + Intergenic
1025715460 7:63951768-63951790 CAGGTTCAAGAGGCTGAGGAAGG + Intergenic
1025970032 7:66314399-66314421 CAGCTGCAGGAGGCTGAGGTGGG + Intronic
1025978549 7:66388948-66388970 CACTTCAAAGAGGCTGCGGTGGG + Intronic
1026124101 7:67564288-67564310 CAGTTACCAGAGGCTGGGAAGGG + Intergenic
1026150014 7:67779973-67779995 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1026282310 7:68932771-68932793 GCGCTTCAAGAGGCTGAGGTGGG + Intergenic
1026462644 7:70628677-70628699 CAGTTACAGGAGGTTGAGACTGG + Intronic
1026607227 7:71826549-71826571 CTGGTACAAGAGGCTAGGGTTGG - Intronic
1026818687 7:73531895-73531917 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1027204140 7:76083650-76083672 CGCTTCAAAGAGGCTGAGGTGGG + Intergenic
1027248158 7:76380913-76380935 CAGCTACTTGAGGCTGAGGCAGG + Intergenic
1027849512 7:83431515-83431537 TAGTGACGAGAGGCTGAGGCAGG - Intronic
1028569291 7:92268587-92268609 CAGCTACGGGAGCCTGAGGTGGG - Intronic
1028926013 7:96357868-96357890 CAGCTTCCGGAGGCTGAGGTGGG - Intergenic
1029200070 7:98833530-98833552 CAGCTACCTGAGGCTGAGGCAGG - Intergenic
1029212174 7:98918006-98918028 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1029247091 7:99209892-99209914 CAGCTACTTGAGGCTGAGGTGGG + Intergenic
1029571249 7:101371087-101371109 CATTTCCAAGAGGCAGTGGTGGG - Intronic
1029653217 7:101907871-101907893 CACTTTGAGGAGGCTGAGGTGGG + Intronic
1029793291 7:102867812-102867834 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1030186749 7:106769858-106769880 CAGCTACTCGGGGCTGAGGTGGG + Intergenic
1030232121 7:107219662-107219684 TAGTTACCAGAGGCTAAGGGGGG + Intronic
1030646015 7:112062789-112062811 CAGCTACTCGAGGCTGAGGCAGG - Intronic
1030683040 7:112452272-112452294 TAGCTACAGGAGGCTGAGGAGGG - Intronic
1031046031 7:116888721-116888743 CTGTTTTGAGAGGCTGAGGTTGG + Intronic
1031399203 7:121311370-121311392 GAGTTACCAGAGGCTGAGGATGG + Intergenic
1031892772 7:127314294-127314316 TGGTTACCAGAGGCTGAGGAGGG + Intergenic
1031968594 7:128046703-128046725 CACTTAACGGAGGCTGAGGTGGG - Intronic
1032190119 7:129760248-129760270 CACTTAAGAGAGGCTGAGGCAGG - Intergenic
1032761354 7:134946492-134946514 TAGTTACCAGAGGCAGAGGGTGG - Intronic
1032830409 7:135619228-135619250 CAGTTGCGGGAGGCTGAGGTGGG + Intronic
1033103527 7:138498130-138498152 CAGGATCAAGAGGCTGAAGTGGG - Intronic
1033164627 7:139029247-139029269 CACTTTTGAGAGGCTGAGGTGGG - Intronic
1033209268 7:139448579-139448601 CAGCTACTCGAGGCTGAGGCAGG + Intergenic
1033411376 7:141120851-141120873 CAGGGATCAGAGGCTGAGGTGGG + Intronic
1033486779 7:141797900-141797922 TAGTTACCAGAGGCTGGGGGCGG - Intergenic
1033733507 7:144200494-144200516 CAGCCCCAGGAGGCTGAGGTGGG - Intergenic
1033749543 7:144350479-144350501 CAGCCCCAGGAGGCTGAGGTGGG + Intergenic
1033812118 7:145027661-145027683 TGGTTACCAGAGGCTGGGGTGGG + Intergenic
1034113808 7:148564148-148564170 CAGGTACAAGGAACTGAGGTAGG - Intergenic
1036125334 8:6057052-6057074 CACTTTTGAGAGGCTGAGGTGGG - Intergenic
1036147748 8:6270228-6270250 CAGCTACTGGAGGCTGAGGCAGG + Intergenic
1036542143 8:9726275-9726297 CAGCTACTTGGGGCTGAGGTGGG + Intronic
1036652165 8:10651611-10651633 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1037444396 8:18950539-18950561 TGGTTACCAGAGGCTGGGGTAGG - Intronic
1037943173 8:22969996-22970018 CAGGTACAGTAGGCTGACGTGGG - Intronic
1038098951 8:24350423-24350445 CAGATACTCGGGGCTGAGGTAGG - Intronic
1038290991 8:26249763-26249785 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1038307474 8:26417612-26417634 CTGGTACAGGAGGCTGAGGCAGG + Intronic
1038576708 8:28710672-28710694 CAGCTACTAGAGGCTGAGGTGGG - Intronic
1038621583 8:29148519-29148541 CAGTTGGTAGAGGCTGAGGTGGG - Intronic
1038861513 8:31393426-31393448 CAGGTACAAGACCCTGAGGTAGG + Intergenic
1038946453 8:32366357-32366379 TAGTTACTAGAGGCTGAGATGGG - Intronic
1039323350 8:36457410-36457432 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1039400419 8:37264431-37264453 TAGTTACCAGAGGCTGAGAAGGG + Intergenic
1039966157 8:42285441-42285463 CAGCTACTTGAAGCTGAGGTGGG + Intronic
1040012208 8:42671424-42671446 CACTTTGAAGAGGCTGAGGCAGG - Intergenic
1040362140 8:46676061-46676083 CAGCTACCAGAGGCTGAGAAGGG + Intergenic
1040434701 8:47379257-47379279 AAGTTAGAAGAGGCTGGGCTTGG + Intronic
1040445733 8:47491736-47491758 CTGCTCCAAGAGGCTGAGGCAGG + Intronic
1040517863 8:48148952-48148974 CAGCTACTCGGGGCTGAGGTTGG + Intergenic
1040563111 8:48542151-48542173 CAGTTACAGGAGGCCAAGGCAGG + Intergenic
1040743059 8:50604302-50604324 CAGCTACAGGGGGCTGAGGTGGG + Intronic
1040949795 8:52925931-52925953 AGGTTAGAAGAGGCTGAAGTTGG + Intergenic
1041236253 8:55805768-55805790 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1041686497 8:60649488-60649510 CAGCTACAGGAGGCTGATGCAGG + Intergenic
1042099558 8:65260090-65260112 CAGTTGCCAGAGGCTGAGAAGGG - Intergenic
1042251903 8:66764580-66764602 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1042598479 8:70474235-70474257 CAGCTACAGGAAGCTGAGGCAGG - Intergenic
1042722109 8:71837361-71837383 CAGTTACCAGAGGCTGGGAAAGG + Intronic
1042778526 8:72464155-72464177 CAGCTACTGGAGGCTGAGGCAGG - Intergenic
1042923366 8:73941483-73941505 CAGCTATGAGAGGCTGAGGCAGG + Intronic
1043389053 8:79773638-79773660 CAGGCACAAGAGGCTCAGGAAGG - Intergenic
1043475340 8:80600336-80600358 CAGCTACAGGGGACTGAGGTGGG - Intergenic
1044005928 8:86937092-86937114 CAGTTCCACATGGCTGAGGTAGG + Intronic
1044270523 8:90237566-90237588 CAAATATCAGAGGCTGAGGTGGG - Intergenic
1044360568 8:91278915-91278937 TAGTTACCAGAAGCTAAGGTGGG - Intronic
1044963832 8:97556666-97556688 CAGCTACATGAGGCTGAGGCAGG + Intergenic
1045400316 8:101809656-101809678 CAGCTACAGGAGGCTGAGGCAGG - Intronic
1045512642 8:102824811-102824833 CAGCTACTCGAGGCTGAGGCAGG - Intergenic
1045532450 8:102997748-102997770 TAGTTACAAGAGGCTGAGAAGGG - Intergenic
1046652843 8:116857859-116857881 CAGCTACTTGAGGCTGAAGTGGG + Intronic
1047003049 8:120592291-120592313 CAGCTAAAGGAGGCTGAGGCAGG - Intronic
1047072814 8:121366018-121366040 TAGTTACCAGAGGCTGGGGAGGG + Intergenic
1047601977 8:126434724-126434746 CAGTTAAAAGAGGAAGAGGAAGG + Intergenic
1047742464 8:127817778-127817800 CAGCTACTAGAGGCTGAGATGGG + Intergenic
1048732417 8:137458245-137458267 CAGGTAGAAGAGGCTGATTTTGG + Intergenic
1049705079 8:144038013-144038035 CAGCTACGCGAGGCTGAGGCAGG + Intronic
1049719389 8:144108602-144108624 CAGCCACAGCAGGCTGAGGTTGG - Exonic
1049971443 9:825480-825502 CCAGTACAGGAGGCTGAGGTGGG + Intergenic
1049981131 9:904828-904850 CAGCTACTCGAGGCTGAGGCAGG + Intronic
1050535170 9:6624684-6624706 CAGTTAAAAAAGGCTCAGGTTGG + Intronic
1050572514 9:6956083-6956105 TGGTTACCAGAGGCTGAGGAGGG + Intronic
1051010961 9:12413522-12413544 GAGTCCCAAGAGGCTGAGGTAGG + Intergenic
1051077167 9:13252735-13252757 CTGCTCCAAGAGGCTGAGGCAGG + Intronic
1051216298 9:14801518-14801540 TGGTTACTAGAGGCTGAGGGTGG - Intronic
1051371538 9:16363371-16363393 CAGTTATGTGAGGATGAGGTGGG - Intergenic
1051577498 9:18633475-18633497 CAGCTACTTGAGGCTGAGGCAGG + Intronic
1051670662 9:19506600-19506622 CAGCTACTGGAGGCTGAGGCAGG - Intergenic
1051709710 9:19919160-19919182 GAGTTAGAAGAGGTTGTGGTGGG + Intergenic
1051801593 9:20940396-20940418 CAGCTACTTGAGGCTGAGGCAGG - Intronic
1052456411 9:28705026-28705048 CAGATACAGGAGGCTGAGGTGGG - Intergenic
1052976087 9:34411299-34411321 TAGCTACATGAGGCTGAGGCAGG + Intronic
1053201687 9:36156273-36156295 TGGTTACAGGAGGCTGACGTGGG + Intronic
1053372998 9:37578188-37578210 CAGTTACCAGAGGCTGGGAGGGG + Intronic
1053520888 9:38778188-38778210 CCGCTACAGGAGGCTGAGGCAGG + Intergenic
1053707918 9:40773708-40773730 CAGCTACTCTAGGCTGAGGTGGG - Intergenic
1054193044 9:62002181-62002203 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1054645365 9:67586510-67586532 CAGCTACAGGAGGCTGAGGCAGG - Intergenic
1054802614 9:69365689-69365711 TAGTAACCAGAGGCTGAGATGGG - Intronic
1055038654 9:71845473-71845495 CAGCTACAGGAGGCTGAGCTGGG - Intergenic
1055625356 9:78171436-78171458 CAGTTTCATGAGCTTGAGGTGGG + Intergenic
1055660503 9:78498811-78498833 CAGCTACTGGAGGCTGAGGCAGG + Intergenic
1056103649 9:83325436-83325458 TAGCTATAGGAGGCTGAGGTGGG - Intronic
1056162601 9:83911653-83911675 CAGCTACTGGAGGCTGAGGCGGG - Intronic
1057342497 9:94215182-94215204 TAGTTGTCAGAGGCTGAGGTGGG - Intergenic
1057616628 9:96596745-96596767 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1057839349 9:98473005-98473027 CAGGTACAAGAGGCTCAGAGAGG + Intronic
1057980415 9:99655992-99656014 TAGTTACCAGAGGCTGAGAAGGG + Intergenic
1058403507 9:104644294-104644316 TAGTTACCAGAGGCTGGGGAGGG + Intergenic
1058412149 9:104745986-104746008 CAGTTTCCTGAGGCTGAGGAGGG - Intergenic
1058679879 9:107431521-107431543 CAGTGACAAGAGGGAGAGGAGGG - Intergenic
1058732148 9:107860643-107860665 CAGCTACAGGAGGCTGAGGCAGG + Intergenic
1058789671 9:108430123-108430145 AAGCTACTGGAGGCTGAGGTGGG + Intergenic
1059133362 9:111778520-111778542 CAGTTTTGAGAGGCTGTGGTGGG + Intronic
1059844234 9:118254381-118254403 TGGTTACAAGAGGCTGAGGAGGG - Intergenic
1060178494 9:121515260-121515282 CAGTTCCAAGTGGCTGGGGAAGG + Intergenic
1060746509 9:126137290-126137312 CAGTTATAGGAGGCTGAGGTGGG - Intergenic
1060844462 9:126825054-126825076 GCTATACAAGAGGCTGAGGTGGG - Intronic
1060907569 9:127321243-127321265 CAGCTACTAGAGGCTGAGGCAGG - Intronic
1060934054 9:127505734-127505756 CAGGAACAAGAAGCTGAGGAGGG + Exonic
1061298157 9:129688308-129688330 CACTTTTAGGAGGCTGAGGTGGG - Intronic
1061568225 9:131458614-131458636 CAGCTACTAGAGGCTGAGGTGGG - Intronic
1061673822 9:132204168-132204190 GAGTTCCAAGAGGCTGAGCTGGG + Intronic
1061756831 9:132819910-132819932 AAGAAACCAGAGGCTGAGGTGGG + Intronic
1061965217 9:134009968-134009990 CGGTTGCCAGAGGCTGGGGTTGG - Intergenic
1062266227 9:135687691-135687713 CTGGGACAAGATGCTGAGGTTGG - Intergenic
1062351268 9:136140389-136140411 CAGCTACTTGAGGCTGAGGTGGG - Intergenic
1185850747 X:3484167-3484189 CAGTTATGGGAGGCTGAGGTGGG - Intergenic
1185985831 X:4832042-4832064 CAGTTACCAGAGGCTGGGAAGGG + Intergenic
1186550374 X:10498357-10498379 CAGTTTTAAGAGGCCAAGGTAGG - Intronic
1187462975 X:19504006-19504028 CACAAACAGGAGGCTGAGGTAGG + Intronic
1187479744 X:19644197-19644219 CAGTTACCAGAGGCTGGGAAGGG + Intronic
1188077307 X:25794036-25794058 CAGCTACGGGAGGCTGAGGCAGG + Intergenic
1188218869 X:27514865-27514887 TGGTTACTAGAGGCTGAGGAGGG + Intergenic
1188344937 X:29052575-29052597 TGGTTACCAGAGGCTGAGGTGGG - Intronic
1188536071 X:31198328-31198350 GCGTTTCAGGAGGCTGAGGTGGG - Intronic
1188724570 X:33566417-33566439 TAGTTACCAGAGGCTGAGGAGGG - Intergenic
1189078944 X:37948610-37948632 TAGTTACCAGAGGCTGAGGCGGG - Intronic
1189422449 X:40868201-40868223 TGGTTACAAGAGGCTGGGGAGGG - Intergenic
1189481439 X:41395087-41395109 CAGCTACTTGAGGATGAGGTGGG - Intergenic
1190049678 X:47140453-47140475 CACTTACATGTGGCTGAGGCGGG - Intergenic
1190386459 X:49886495-49886517 CAATATCAGGAGGCTGAGGTGGG - Intergenic
1190532326 X:51392045-51392067 TGGTTACCAGAGGCTGAGATGGG + Intergenic
1190918902 X:54831359-54831381 TGGTTACCAGAGGCTGAGGGAGG - Intergenic
1192171247 X:68856265-68856287 CAGTTACTAGAGCCTGTGTTTGG - Intergenic
1192395120 X:70772461-70772483 CAGATATGGGAGGCTGAGGTGGG + Intronic
1192688905 X:73338482-73338504 CAGTTACTAGAGACTGAGAAAGG + Intergenic
1193093430 X:77520143-77520165 TAGTTACCAGAGGCTGAGAAGGG + Intronic
1193106855 X:77686037-77686059 CAGTTACAAGAAGCTGGGAAAGG + Intronic
1193379304 X:80800426-80800448 CAGCTATCAGAGGCTGAGGTGGG + Intronic
1193600644 X:83505468-83505490 CAGTTACTAGAGGATGTGATTGG + Intergenic
1193858065 X:86629765-86629787 TAGTCTCAGGAGGCTGAGGTGGG + Intronic
1193881589 X:86929477-86929499 TAGTTACCAGAGGCTGGGGAAGG + Intergenic
1194107166 X:89784780-89784802 TGGTTACAAGAGGCTGAGAAGGG + Intergenic
1194565606 X:95484384-95484406 TATTTACCAGAGGCTGAGGAAGG + Intergenic
1194730019 X:97441700-97441722 CAGCTACTGGAGGCTGAGGCAGG + Intronic
1194800090 X:98262444-98262466 CAGAAACAAGAGGTTGGGGTGGG + Intergenic
1195724261 X:107897988-107898010 CAGAAAAAAGAGGCTGAGTTTGG - Intronic
1196357113 X:114808126-114808148 CAGTTACCAGAGGCTGGGAAGGG - Intronic
1196374762 X:115020938-115020960 AAGTTACCAGAGGCTGGGGAGGG - Intergenic
1196412410 X:115433986-115434008 CAGTCACAAGAGGCTGATTGAGG - Intergenic
1196622969 X:117844890-117844912 TGGTTACCAGAGGCTGGGGTGGG + Intergenic
1196754058 X:119142661-119142683 CAGCTACAGGAGGCTGAGGCAGG + Intronic
1196932305 X:120694423-120694445 TAGTTACCAGAGGCTGGGGGTGG - Intergenic
1197814933 X:130488164-130488186 CATTTACAAGAGGCTGGGAAGGG + Intergenic
1197927435 X:131661858-131661880 CAGATACTTGAGGCTGAGGTGGG - Intergenic
1197952462 X:131912612-131912634 GGGTTACCAGAGGCTGGGGTGGG + Intergenic
1197984534 X:132253643-132253665 TAGTCCCAGGAGGCTGAGGTGGG + Intergenic
1198134383 X:133732974-133732996 CAGCTTTACGAGGCTGAGGTGGG - Intronic
1198143362 X:133828662-133828684 CAGTTATGAGAGCCTGGGGTGGG + Intronic
1198459993 X:136853890-136853912 CAGCTACGGGAGGCTGAGGTAGG + Intronic
1198632126 X:138652160-138652182 CAGTTCAAAGAGTCAGAGGTGGG - Intronic
1198860465 X:141063729-141063751 CAGTTACCAGTTGCTGAGGAGGG + Intergenic
1198902225 X:141523661-141523683 CAGTTACCAGTTGCTGAGGAGGG - Intergenic
1199371553 X:147055847-147055869 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1199644510 X:149893284-149893306 CAGATTCAGGAGGCTGAGGCAGG + Intergenic
1199734745 X:150675235-150675257 TAGTTACCAGAGACTGAGGAGGG + Intergenic
1200010550 X:153117335-153117357 CAAATACAGGAGGCTGAGGCAGG - Intergenic
1200029050 X:153282587-153282609 CAAATACAGGAGGCTGAGGCAGG + Intergenic
1200098533 X:153675637-153675659 CAGCTACTCGAGGCTGAGGCGGG - Intronic
1200159357 X:153997659-153997681 CAGCTACCTGAGGCTGAGGCAGG + Intergenic
1200415079 Y:2901079-2901101 CAGCTACTAGAGGCTGAGGCAGG + Intronic
1200420780 Y:2964915-2964937 CAACTACTTGAGGCTGAGGTGGG + Intronic
1200459125 Y:3432642-3432664 TGGTTACAAGAGGCTGAGAAGGG + Intergenic
1201224199 Y:11801201-11801223 TAGTTACCAGAGGCTGGGGTTGG + Intergenic
1201279465 Y:12328730-12328752 AAGTTACAAGAGGCTGGGCATGG - Intergenic
1201320947 Y:12697997-12698019 CAGTTTTGGGAGGCTGAGGTGGG + Intergenic
1202110343 Y:21410719-21410741 CTGTTACAGGAGGCTGAGGCAGG - Intergenic
1202328232 Y:23716269-23716291 AATTGACAAGAGACTGAGGTGGG - Intergenic
1202542538 Y:25953783-25953805 AATTGACAAGAGACTGAGGTGGG + Intergenic