ID: 1161431765

View in Genome Browser
Species Human (GRCh38)
Location 19:4236672-4236694
Sequence CTGTGGATGTCTCACCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161431765_1161431779 24 Left 1161431765 19:4236672-4236694 CCTCCTGGGTGAGACATCCACAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1161431779 19:4236719-4236741 TCGTAAGAGAGGTGGCTCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1161431765_1161431780 25 Left 1161431765 19:4236672-4236694 CCTCCTGGGTGAGACATCCACAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1161431780 19:4236720-4236742 CGTAAGAGAGGTGGCTCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 98
1161431765_1161431777 22 Left 1161431765 19:4236672-4236694 CCTCCTGGGTGAGACATCCACAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1161431777 19:4236717-4236739 ATTCGTAAGAGAGGTGGCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1161431765_1161431775 13 Left 1161431765 19:4236672-4236694 CCTCCTGGGTGAGACATCCACAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1161431775 19:4236708-4236730 CCAGGAAGGATTCGTAAGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 111
1161431765_1161431773 -1 Left 1161431765 19:4236672-4236694 CCTCCTGGGTGAGACATCCACAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1161431773 19:4236694-4236716 GGGGCTAGTGTGGTCCAGGAAGG 0: 1
1: 0
2: 1
3: 24
4: 224
1161431765_1161431776 16 Left 1161431765 19:4236672-4236694 CCTCCTGGGTGAGACATCCACAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1161431776 19:4236711-4236733 GGAAGGATTCGTAAGAGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 197
1161431765_1161431772 -5 Left 1161431765 19:4236672-4236694 CCTCCTGGGTGAGACATCCACAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1161431772 19:4236690-4236712 CACAGGGGCTAGTGTGGTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 198
1161431765_1161431778 23 Left 1161431765 19:4236672-4236694 CCTCCTGGGTGAGACATCCACAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1161431778 19:4236718-4236740 TTCGTAAGAGAGGTGGCTCTGGG 0: 1
1: 0
2: 1
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161431765 Original CRISPR CTGTGGATGTCTCACCCAGG AGG (reversed) Intronic
900138629 1:1129296-1129318 CTGTGAATGACCCAGCCAGGGGG + Intergenic
900358501 1:2276267-2276289 CTGTGGCTGGCTACCCCAGGTGG + Intronic
900748098 1:4374931-4374953 CTGAGGCTTTCTCCCCCAGGAGG + Intergenic
903150573 1:21405152-21405174 CTGTGGTGGTCTCACCCTTGTGG + Intergenic
904266426 1:29320818-29320840 CAGTGGAGGCCTCACCCAGGCGG - Exonic
905886495 1:41494741-41494763 CTGTGGATCTCTGGCCCAGCTGG + Intergenic
906987127 1:50695401-50695423 CAGTGGATGTCTATCCAAGGTGG - Intronic
908823968 1:68115936-68115958 TTTTGTATGTCTCACCCTGGAGG + Intronic
910061149 1:83094146-83094168 TGATGCATGTCTCACCCAGGTGG + Intergenic
912233439 1:107822153-107822175 CTGTGGAACTCTCACCCACCAGG - Intronic
915565893 1:156712518-156712540 CTGTGGCTGGCTCTCCCAGCTGG - Intergenic
918142599 1:181732074-181732096 CTGTGGATGGCTGCCCCAGCAGG + Intronic
920515826 1:206584142-206584164 CAGTGGATTTCCCTCCCAGGAGG - Intronic
921883552 1:220280425-220280447 CTGTGAAGGTTTCACCAAGGGGG - Intergenic
922208952 1:223472372-223472394 CTCTGCAAGTCTCAGCCAGGAGG - Intergenic
922614484 1:226953594-226953616 CTGTGAAGGTCTCACTCAGCAGG + Intronic
923304555 1:232676045-232676067 CTGTGGAACTCTCACCCACCAGG - Intergenic
923851189 1:237797097-237797119 CTGTGTAAGACTCACTCAGGAGG + Intronic
924775026 1:247110664-247110686 CCATGGATGTCTCACGCAGGGGG - Exonic
1063277848 10:4590719-4590741 ATGTGGATCTAACACCCAGGAGG + Intergenic
1063440147 10:6066440-6066462 CTGAAGCTGTCTAACCCAGGCGG + Intergenic
1063591730 10:7401620-7401642 CTGTGGATGTCTGAACCAGAGGG - Intronic
1068766914 10:60774391-60774413 CTGTGGATCTTCCACCTAGGTGG - Intergenic
1071329862 10:84548606-84548628 CTGTGGTTCTGTCTCCCAGGGGG - Intergenic
1071353561 10:84770314-84770336 CTATTGATGTGGCACCCAGGGGG - Intergenic
1071571548 10:86700073-86700095 CTGTGTGTGTCCCACCCAAGAGG + Intronic
1073385720 10:103126838-103126860 GTCTTGATGTATCACCCAGGAGG + Intronic
1074929033 10:118104400-118104422 ATGTGGATGTCAAACGCAGGAGG - Intergenic
1077096862 11:802700-802722 CTGGCGAGGCCTCACCCAGGGGG + Exonic
1078524276 11:12088722-12088744 CCTGGGATGGCTCACCCAGGTGG + Intergenic
1079127583 11:17730027-17730049 CTGTGGATGTGTCAGCCTGCAGG - Intergenic
1079383921 11:19962135-19962157 CTCTGGATCTCTCAGCCAGTAGG - Intronic
1083341578 11:61961835-61961857 TTGTGGATGTCACTCCCAGTTGG + Intronic
1083436712 11:62648033-62648055 CTGGGGATGTCTGAGACAGGCGG + Exonic
1085325390 11:75602419-75602441 CTGTGGATGTTCCACCCATAGGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1090166804 11:124558092-124558114 CTTTGGAAGTCTCACTCAGTAGG - Intergenic
1090989707 11:131804930-131804952 CTGTGGCTGTATCATCCAGAAGG - Intronic
1092945200 12:13447867-13447889 GTGTGTATGTCTGACACAGGGGG - Intergenic
1094827957 12:34286984-34287006 GGGTGCATGTCTCACCCATGGGG + Intergenic
1094830215 12:34296712-34296734 CTGTGCATGTGTCAACCACGGGG + Intergenic
1094832750 12:34307927-34307949 CAGTGAGTGTCGCACCCAGGGGG + Intergenic
1094834934 12:34317874-34317896 CGGTGCATGTCACACCCAAGTGG - Intergenic
1094836129 12:34322923-34322945 CAGTGCGTGTCTCACCCATGAGG - Intergenic
1099579359 12:84423167-84423189 CAGTGGTTGTCTCTTCCAGGAGG + Intergenic
1103573273 12:121858779-121858801 CTGAAGATGTCCCACCCAAGGGG + Intronic
1104475691 12:129068795-129068817 CTGTGGATGACTGATCCAGGGGG - Intergenic
1111027187 13:82543778-82543800 CTGTGGTTGTCTCTCCAAGTTGG - Intergenic
1113146359 13:107212478-107212500 CTGTGGCTGTGTGCCCCAGGAGG + Intronic
1113428885 13:110231847-110231869 TTGTGGATTTCTCACCTAGGAGG + Intronic
1113821284 13:113215315-113215337 CTATGGAGGTCTCATCCATGTGG + Intronic
1114725043 14:24927299-24927321 ATGTGGATTGCTCACCCAGGAGG - Intronic
1117289455 14:54318510-54318532 CTCTGAATTTCTCACCAAGGAGG + Intergenic
1118228643 14:63927302-63927324 CTGTGGATGGCTGAGGCAGGAGG + Intronic
1118258702 14:64227270-64227292 TTGCAGATGTCTCACCCATGAGG - Intronic
1118472446 14:66087398-66087420 GTGTGGATGACTCACAGAGGAGG - Intergenic
1119955513 14:78794351-78794373 CTGTCGCTCTGTCACCCAGGTGG - Intronic
1121301671 14:92876688-92876710 CTGTGGATGTCTCATGTAAGTGG + Intergenic
1122088174 14:99321096-99321118 GTGTGGATGTCACAACCACGTGG + Intergenic
1122578859 14:102758794-102758816 ATGTGGACTTCTCACACAGGGGG - Intergenic
1123133462 14:106006916-106006938 CTGTGGCTGACCCTCCCAGGGGG - Intergenic
1123161113 14:106278672-106278694 CTGTGGATGCTGCAGCCAGGAGG - Intergenic
1123482111 15:20641589-20641611 CTGTGGATGCTGCAGCCAGGAGG - Intergenic
1126682283 15:51213994-51214016 CTGCAGATGCCTCACACAGGTGG - Intronic
1127761733 15:62146320-62146342 CTGTGGAGGTCACAGGCAGGAGG - Intergenic
1128232469 15:66045300-66045322 CTGTGGCTGTAGAACCCAGGAGG + Intronic
1129683539 15:77671728-77671750 CCCTGGAAGTCTCACCCAGGAGG - Intronic
1131826793 15:96328385-96328407 CTATGGAAGTCTCATTCAGGAGG + Intronic
1132087924 15:98923125-98923147 CTGGCTATGTCTCTCCCAGGAGG - Intronic
1133327946 16:4953473-4953495 CTGAGGCAGTCTGACCCAGGGGG - Intronic
1143627376 17:8118260-8118282 CTCTGGCTGGCTCACCCAGATGG + Exonic
1144082054 17:11772407-11772429 CTCTGGATCTCTCACCTAGAGGG + Intronic
1145956489 17:28858383-28858405 TTGTGGATGTCTCAGACAAGTGG + Exonic
1149814336 17:59707905-59707927 CCCTGGATGTCTCACGCTGGCGG + Intronic
1157320545 18:46630729-46630751 CTGTGAATGTCTCACCAAAAGGG + Intronic
1158401069 18:57121982-57122004 CTGTGGGTCTTTCACCCAGCTGG - Intergenic
1161431765 19:4236672-4236694 CTGTGGATGTCTCACCCAGGAGG - Intronic
1161548324 19:4895907-4895929 CTGTGGTTGTCTCAACTTGGGGG - Intronic
1162126748 19:8503566-8503588 CTGTGGCTCTCTAGCCCAGGAGG - Intergenic
1163719333 19:18891240-18891262 CAGTGGATGTGCCACCCATGGGG - Intronic
1165888937 19:39099135-39099157 CTGCGGATGCCTCACCCACATGG - Exonic
1166275546 19:41751062-41751084 CTGGGGATGGCTCAGCCTGGTGG - Intronic
1166326479 19:42053993-42054015 CTGTGGATGTCTCACCACGTTGG - Intronic
1166998891 19:46733253-46733275 CAGGGGATGTCTGACCCACGTGG - Intronic
1168126722 19:54288065-54288087 CTGTGGGTTTGTCACGCAGGGGG - Intergenic
927242345 2:20930020-20930042 GTGTTGCTCTCTCACCCAGGTGG + Intergenic
928078726 2:28289171-28289193 CTGTGGGTGTCTCTCCCAGAAGG + Intronic
928402261 2:30987674-30987696 CTGTAGAAGTTTCACCCAGCAGG - Intronic
928803773 2:35125870-35125892 CTGTTTGTGTCTCACCCAGTTGG - Intergenic
930581426 2:53216911-53216933 TTGGGGAGGTCTCACCCAGTTGG + Intergenic
932291232 2:70581736-70581758 CTGTGGATGTCACACAGAGATGG + Intergenic
933082387 2:78006965-78006987 TTGTTTCTGTCTCACCCAGGTGG + Intergenic
935049899 2:99516446-99516468 CTGTGGATATCTGACCAAGATGG - Intergenic
936607084 2:113969473-113969495 CTGTGGCTGCCTCTCCCAGGAGG - Intergenic
942323202 2:174753837-174753859 CTGTGGGTCACACACCCAGGAGG + Intronic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
946158680 2:217822938-217822960 CTGTCCCTGTCTTACCCAGGAGG + Intronic
947523047 2:230863224-230863246 ATGTGGATGCTTCACCCAGGTGG + Intergenic
948196839 2:236103029-236103051 CTGGAGATGTGGCACCCAGGAGG - Intronic
948434765 2:237945556-237945578 ATGGGGATGACTCACGCAGGGGG - Intergenic
948601288 2:239108850-239108872 CTGTGGCTGCCGCACCCTGGGGG - Intronic
1168805585 20:670515-670537 CTGTGGATGTAGCACCCACTAGG + Intronic
1169760862 20:9092404-9092426 CTAAGGATGTCTCACCCAACAGG - Intronic
1172663353 20:36582623-36582645 CTGTGGATGTGTCACCTTGAGGG - Intronic
1177244028 21:18498721-18498743 CTGTGTATGTCTTATCGAGGTGG - Intergenic
1179712190 21:43269656-43269678 CTGAGGATGCCTCCACCAGGGGG - Intergenic
1183413532 22:37669600-37669622 TTGTGGTTGCCTCTCCCAGGAGG + Intergenic
950472509 3:13194784-13194806 CTGCGGATGTCTGAGCCTGGAGG - Intergenic
950503605 3:13379372-13379394 CTGTGGGTGACTCACCCCAGAGG - Intronic
951532615 3:23711941-23711963 CTGGGGATGTCTCATGGAGGAGG - Intergenic
953286087 3:41611280-41611302 ATGCAGAGGTCTCACCCAGGGGG + Intronic
953559236 3:43971887-43971909 CTGTGGGTGTCTCACTCTGGGGG - Intergenic
956148374 3:66215094-66215116 CAGAGTATCTCTCACCCAGGCGG - Intronic
961219928 3:125191749-125191771 CTGTGGATGTCTGATACAGGAGG - Intronic
961537950 3:127581255-127581277 CTGTGGATGACAGCCCCAGGCGG + Intronic
963113535 3:141706558-141706580 ATGTGGACTTGTCACCCAGGAGG - Intergenic
967893665 3:194381036-194381058 CTTTGGGAGGCTCACCCAGGTGG + Intergenic
968611497 4:1559180-1559202 CTGAGGGTGTCACACCAAGGGGG + Intergenic
968823338 4:2873964-2873986 CTGTGGAAGTCTGAGGCAGGAGG + Intronic
968861106 4:3170831-3170853 CTTTGGTTGTCTCAGGCAGGAGG + Intronic
969480575 4:7444974-7444996 CTGTGGTTGCAACACCCAGGTGG + Intronic
970825937 4:20274667-20274689 CTGTGGATTTCACACTCAGAAGG - Intronic
979044928 4:115851467-115851489 CTTGGGAGGTTTCACCCAGGAGG - Intergenic
981424326 4:144585944-144585966 GTCTTGCTGTCTCACCCAGGCGG + Intergenic
985663968 5:1172261-1172283 CTGTGGTGGGGTCACCCAGGTGG - Intergenic
991407884 5:66319671-66319693 CTGTGACTGTCTGACCGAGGAGG - Intergenic
991505971 5:67324736-67324758 CTGTGGGTGTCTCTCCCAGAAGG + Intergenic
997205001 5:132043055-132043077 GTTGGGAGGTCTCACCCAGGAGG + Intergenic
999274297 5:150318799-150318821 CTGTGGATGACACAGCAAGGAGG + Intronic
1002607424 5:180391410-180391432 CTCTGCATGGCTCACCCAGAAGG - Intergenic
1003177767 6:3765516-3765538 CTGTGTATACCTCACCCACGGGG + Intergenic
1003683084 6:8275050-8275072 CTGTGGATGACTCTCTCGGGAGG + Intergenic
1004020577 6:11772611-11772633 CTGTGCCTGACTCAGCCAGGCGG + Intronic
1004687830 6:17964006-17964028 CTTTGGAAGTCTCAGGCAGGAGG + Intronic
1007731415 6:43949900-43949922 CAGTGCATGGCTCACCCTGGAGG - Intergenic
1013835465 6:114330019-114330041 CTGTGCATCTCTTACCCAAGAGG - Intronic
1023035430 7:36127389-36127411 CTGAGGATGCCTCACTGAGGTGG + Intergenic
1023620453 7:42066552-42066574 CTGTGGGGATCTGACCCAGGAGG - Intronic
1028446645 7:90932129-90932151 CTGTGAATGCCTCAGACAGGAGG - Intronic
1029578467 7:101419695-101419717 CCGTGGAAATCTCACCCTGGTGG - Intronic
1031029206 7:116716222-116716244 CTCTGGCTCTGTCACCCAGGCGG - Intronic
1032544273 7:132728677-132728699 CTGTGACTGGCTCACCCAGAGGG + Exonic
1034762230 7:153683387-153683409 CTGTGCTTGCCTCACCCAGATGG - Intergenic
1036084594 8:5599689-5599711 GTCTGGCTGTCTCACCCAGGGGG + Intergenic
1036761195 8:11509566-11509588 CTGTGGTTGTCTAAGCCTGGGGG + Intronic
1037487164 8:19358532-19358554 ATGTGGATGTCTAAGCCATGTGG + Intronic
1037491687 8:19402343-19402365 CAGTGGAGGTCTCCTCCAGGCGG - Intergenic
1039490153 8:37941579-37941601 CTGTTGATGTCTCACCCAGAAGG + Intergenic
1039744024 8:40407609-40407631 CTGTGGAAGTCCCAGGCAGGAGG + Intergenic
1040275981 8:46013868-46013890 AGGTGCATGTCTCACCCATGGGG - Intergenic
1040298615 8:46176330-46176352 CTGTCTATGTCTCTCCCAGAAGG + Intergenic
1044863911 8:96550832-96550854 CTGTGGAGGTCTCACGCATGGGG + Intronic
1047551477 8:125877515-125877537 CTGTCGATGGCTCTCCCAGGAGG - Intergenic
1048195563 8:132329250-132329272 TTGGGGGTGCCTCACCCAGGAGG - Intronic
1049606593 8:143532521-143532543 CTGTGGATGGGGCAGCCAGGTGG - Intronic
1050568408 9:6912032-6912054 CTGTGAAGGTTTCTCCCAGGAGG + Intronic
1051870283 9:21728948-21728970 CTGTGGCAGTCTCACCGTGGGGG + Intergenic
1055294798 9:74823215-74823237 CTGTAGATGTCTCACCATGAGGG - Intronic
1058286637 9:103187312-103187334 CAGTGGATTCCGCACCCAGGCGG - Intergenic
1060173509 9:121480504-121480526 CTGGAGATGTCTCAGCCACGTGG - Intergenic
1062006311 9:134240119-134240141 GTGAGGAGGTCTCTCCCAGGTGG - Intergenic
1062477000 9:136733179-136733201 CTGGGGAAGTCTGACCCTGGTGG + Intergenic
1185717104 X:2351708-2351730 GTCTGGTAGTCTCACCCAGGTGG - Intronic
1186243604 X:7596560-7596582 ATGTGGATGGCCCTCCCAGGTGG + Intergenic
1191249941 X:58255493-58255515 GTGTGGGTGTCTCACCCAACGGG - Intergenic
1191251224 X:58261090-58261112 GGGTGCATGTCTCACCCACGGGG + Intergenic
1191251397 X:58261794-58261816 GGGTGCATGTCTCACCCACGGGG + Intergenic
1191251499 X:58262201-58262223 GGGTGCATGTCTCACCCACGGGG + Intergenic
1191252477 X:58266157-58266179 CGGTGAGTGTCTCACCCATGGGG - Intergenic
1191839202 X:65498615-65498637 CTGAGGATGTGTCTGCCAGGAGG - Intronic
1198478572 X:137019081-137019103 CTCTGGGGGTGTCACCCAGGTGG + Intergenic
1199868315 X:151874160-151874182 CTGGTAATGTCTCACCCATGGGG - Intergenic
1199881750 X:151978987-151979009 CAGTGGATGACTCAACAAGGAGG + Intergenic