ID: 1161435097

View in Genome Browser
Species Human (GRCh38)
Location 19:4258367-4258389
Sequence TCCGCCGCTCCTCCTCCGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161435097_1161435103 21 Left 1161435097 19:4258367-4258389 CCTGTCGGAGGAGGAGCGGCGGA 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1161435103 19:4258411-4258433 AGCAGGAGACCGCGTGAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 116
1161435097_1161435101 -5 Left 1161435097 19:4258367-4258389 CCTGTCGGAGGAGGAGCGGCGGA 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1161435101 19:4258385-4258407 GCGGAGGCAGCAGCAGGAGGAGG 0: 1
1: 2
2: 29
3: 214
4: 1444
1161435097_1161435100 -8 Left 1161435097 19:4258367-4258389 CCTGTCGGAGGAGGAGCGGCGGA 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1161435100 19:4258382-4258404 GCGGCGGAGGCAGCAGCAGGAGG 0: 1
1: 1
2: 21
3: 171
4: 1101
1161435097_1161435104 22 Left 1161435097 19:4258367-4258389 CCTGTCGGAGGAGGAGCGGCGGA 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1161435104 19:4258412-4258434 GCAGGAGACCGCGTGAGTCAGGG 0: 1
1: 0
2: 0
3: 18
4: 155
1161435097_1161435105 26 Left 1161435097 19:4258367-4258389 CCTGTCGGAGGAGGAGCGGCGGA 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1161435105 19:4258416-4258438 GAGACCGCGTGAGTCAGGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 110
1161435097_1161435102 4 Left 1161435097 19:4258367-4258389 CCTGTCGGAGGAGGAGCGGCGGA 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1161435102 19:4258394-4258416 GCAGCAGGAGGAGGACGAGCAGG 0: 1
1: 1
2: 46
3: 410
4: 5563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161435097 Original CRISPR TCCGCCGCTCCTCCTCCGAC AGG (reversed) Exonic
900997341 1:6129790-6129812 TCCTCCCCTCCACCTCCAACAGG + Intronic
902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG + Intergenic
902504479 1:16930324-16930346 TCTGCTGCTCCTCCTCCAGCCGG - Exonic
904236954 1:29122505-29122527 GCCGCCTCTCCTCCTCTGCCTGG - Intronic
904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG + Intronic
905892300 1:41525098-41525120 TGCGCCCCTCCCCCTCAGACGGG + Intronic
906749066 1:48242562-48242584 TCTGCCGCTCCACCTCCTGCAGG - Exonic
910646979 1:89524863-89524885 TCCGGCTCGCCGCCTCCGACCGG - Intronic
916660726 1:166920673-166920695 TCTGCCTCCCCTCCTCCGAGGGG - Intronic
918177174 1:182056814-182056836 TCCGCTGCCCCGCCTGCGACCGG - Exonic
920226075 1:204440199-204440221 TCCGCTGCTTCTCCACCGGCCGG - Exonic
920370034 1:205473071-205473093 TGTGCCCCTCCTCCTCCCACAGG + Intergenic
1065024384 10:21526604-21526626 CCCGCCGCGCCTCCCCCGCCTGG + Intergenic
1070772204 10:79089089-79089111 TCTGCCCCTGCCCCTCCGACAGG + Intronic
1075031872 10:119029579-119029601 GCCTCCGCTCCGCCTCCGTCCGG + Intergenic
1076395925 10:130137027-130137049 CTCGCCGCTCTTCCTGCGACAGG - Intronic
1076807298 10:132865375-132865397 TCGGCCCCTCCTCCTGGGACTGG - Intronic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1081857366 11:46312354-46312376 TCCGCTTCTCCTCCTCTGTCAGG - Exonic
1083470550 11:62881209-62881231 TCAGCAGCTCCTCCTTGGACAGG - Exonic
1084150322 11:67285101-67285123 TCTGCGTCTCCTCCACCGACTGG - Exonic
1084273972 11:68042647-68042669 CCCGCCGCACCTCCTCCTGCAGG - Exonic
1084485046 11:69443363-69443385 TCCCCTGCTCCTCCTCCCTCGGG + Intergenic
1085011013 11:73141925-73141947 TCCGGCCCTCCTCCTCCTCCTGG - Exonic
1085434753 11:76490421-76490443 TCCGCCTCTCGTCATCCCACAGG - Intronic
1097236948 12:57546889-57546911 CCCGCCGCTCGTTCTCCGATCGG - Intronic
1097854908 12:64452154-64452176 TCCGCCGCGCCACCGCCGGCGGG - Exonic
1102278342 12:111599339-111599361 TCCGCCGCCCCTCCCCCGCCCGG - Exonic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1106683445 13:32031588-32031610 TCGGCCGCTCCTCCTCCTCCGGG - Exonic
1109024774 13:57143063-57143085 TGCTCCACTCCTCCCCCGACTGG + Exonic
1109025761 13:57149633-57149655 TGCTCCACTCCTCCCCCGACTGG + Exonic
1109026751 13:57156206-57156228 TGCTCCACTCCTCCCCCGACTGG + Exonic
1109027743 13:57162777-57162799 TGCTCCACTCCTCCCCCGACTGG + Exonic
1109028729 13:57169342-57169364 TGCTCCACTCCTCCCCCGACTGG + Exonic
1112374472 13:98825873-98825895 TCCCCGGCTCCTCCTCAGGCAGG + Exonic
1113318215 13:109206587-109206609 TCTGCCCCTCTTCCTCCCACAGG + Exonic
1122736759 14:103847763-103847785 TCCGCCCCTCCCCCGCCGCCGGG - Intergenic
1125024785 15:35019394-35019416 CCCCCCGCTCCTCCTCCAACTGG + Intergenic
1128451167 15:67806708-67806730 TCCGCCTCTCCTCCAGCGCCCGG - Exonic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1132032004 15:98446063-98446085 CCCGGCGCTCCACCTCCCACAGG + Intronic
1136485594 16:30570030-30570052 TCCACCGCTCCTGCTCCGGGGGG - Exonic
1137881355 16:52051830-52051852 TCCTCTGCTCCTCCTCAGAATGG + Intronic
1145248467 17:21284800-21284822 GCCGCCGCTGCTCCTCCGCCTGG + Exonic
1149729020 17:58925984-58926006 TCCTCCTCCCCTCCTCCAACTGG + Intronic
1152174885 17:78781476-78781498 GACGCCGCTCCTCCCCTGACTGG - Intronic
1155125355 18:22870012-22870034 TCCCCCACTCCGCCTCTGACAGG - Intronic
1155209199 18:23586433-23586455 TCCTCCGCTCCTCCTGCGCGGGG - Exonic
1155479703 18:26272124-26272146 TCCACCCCTCCTCCTCCCAGTGG + Intronic
1155911684 18:31511376-31511398 TGCCCCGCTCCTCCTGCCACTGG - Intronic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1161735582 19:5990460-5990482 TCCCCAGCTCCTCCTCGGCCGGG - Intergenic
1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG + Exonic
1163760392 19:19133170-19133192 CCCGAAGCTCCTCCTCAGACGGG + Exonic
1166949194 19:46415189-46415211 TCCGTGGCTCCTCCTGCTACAGG + Intergenic
1167573729 19:50307112-50307134 CCCTCCGCTCCTCCTCCACCTGG - Exonic
1168071921 19:53958316-53958338 CCCACCGCTCCTCCTCCAAGTGG - Intergenic
1168347146 19:55655405-55655427 TCCCCCGCGCCACCTCCGCCAGG - Intronic
929606602 2:43238942-43238964 TCCGAGGCTCTTCCTCCCACCGG + Intronic
929701894 2:44169292-44169314 TCAGCCGCTTCCCCTCCGGCGGG - Intronic
932207138 2:69893198-69893220 TCCCCAGCTCCTCCCCCTACAGG - Intergenic
934059957 2:88284276-88284298 TCGGCCCCTCCGCCTCCGCCTGG + Intergenic
936519195 2:113201226-113201248 TCCCCAGCTGCTCCTCCCACAGG - Exonic
938795988 2:134718782-134718804 CCTGCCGCTCCTCCTCCAGCTGG + Exonic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
946370647 2:219279506-219279528 CCGGCCGCACCTCCTCCGCCAGG - Exonic
947827935 2:233118753-233118775 TCCACCTCTCCCCCTCCGAGGGG - Intronic
948560091 2:238846780-238846802 GCCTCCGCTGCTCCTCCGGCCGG - Intergenic
948809290 2:240466666-240466688 TCCTCCCCGCCTCCTCCCACTGG + Exonic
1168960866 20:1868804-1868826 TCCTCCTCTCCTCCCCCGACCGG + Intergenic
1172481478 20:35274381-35274403 TCCGCCGCTCCACCTCCTTCTGG - Exonic
1175287277 20:57845252-57845274 TCCCCAGGTCCTCCTCCCACAGG - Intergenic
1176023537 20:62974473-62974495 ACCGTCGCTCCCCCTCGGACAGG - Intergenic
1179568265 21:42262613-42262635 TCCCTCCCTCCTCCTCCGAGTGG - Intronic
1180198118 21:46209370-46209392 TCCACCGGTCCTCCTCGGGCTGG - Intronic
953844047 3:46412838-46412860 TCCACTTCTCCTCCTCCGATAGG + Intronic
958457045 3:94345272-94345294 TCCACCGCTCCGGATCCGACAGG - Intergenic
968051586 3:195658314-195658336 TCCGCGGCTCCCCCTCGCACCGG - Intergenic
968104230 3:195990019-195990041 TCCGCGGCTCCCCCTCGCACCGG + Intergenic
968302531 3:197627609-197627631 TCCGCGGCTCCCCCTCGCACCGG + Intergenic
978126980 4:105146656-105146678 GCCGGCTCTCCTCCTCCGCCCGG - Exonic
985366585 4:189237494-189237516 TCCACCGCTCCTCAGCAGACAGG - Intergenic
990007742 5:50963559-50963581 GCCTCCGCTCCTCCTCCGCCCGG + Intergenic
992151575 5:73909687-73909709 GCAGCAGCTCCTCCTGCGACTGG - Exonic
1001435760 5:171698108-171698130 TCCCCAGCTCCTCCTCCTTCAGG - Intergenic
1004910394 6:20277426-20277448 CCCGCCTCTCCTCCTCAGTCAGG + Intergenic
1006071067 6:31498286-31498308 CCCGCCGCTCCCGCTCCGCCGGG - Intronic
1006915980 6:37594207-37594229 TCTGCAGCTCCTCCTGCGAAGGG - Intergenic
1010786256 6:80004537-80004559 GCCGCCCCTCCTCCTGCGTCAGG - Intronic
1012401140 6:98843644-98843666 TCGGCCTCACCTCCTCCGAGAGG - Intergenic
1018618751 6:165710979-165711001 TCTGCCGTTCCGCCTCCCACGGG - Intronic
1018769500 6:166958279-166958301 TCTGCCGCTCCTCCTGCCACAGG - Intergenic
1034589738 7:152129070-152129092 TCCGCAGCTCCCCCGCCGCCAGG - Intergenic
1034635703 7:152565723-152565745 TGAGCCGCTGCTCCTCCAACAGG + Intergenic
1035660096 8:1341075-1341097 TCCCACCCTCCTCCTCCCACAGG - Intergenic
1038267741 8:26049394-26049416 TCCTCTGCTCCTCCTCCCCCTGG + Intergenic
1047381982 8:124372457-124372479 CGCGCCGCTCCTCCTCAGCCGGG - Exonic
1049658590 8:143809706-143809728 TCAGCCGCTTCTCCTGCGGCGGG + Exonic
1053070875 9:35101261-35101283 TCCGCCGCTCTGCCTCCACCTGG + Exonic
1057605728 9:96496709-96496731 TCCGCTGCACCTCCTCCAGCGGG - Intronic
1057949653 9:99359581-99359603 TCCGTGGCTCCTCCTCCCACCGG - Intergenic
1062600261 9:137316127-137316149 GCCGCCGCCCCTCCCCCGTCTGG - Intronic
1185643442 X:1600706-1600728 GCCGCCGCTCCTCCTGCTGCTGG - Exonic
1185773616 X:2784687-2784709 TCCCCCACTCCTCCTCCTATTGG - Intronic
1190008085 X:46759040-46759062 CCCCCCGCGCCTCCTCCGAGCGG + Exonic
1192821615 X:74652444-74652466 CCTGCCCCTCCTCCCCCGACTGG + Intergenic
1194489710 X:94530897-94530919 TCAGCCACTCCTCCTCCTAGGGG - Intergenic
1200111599 X:153743570-153743592 GCCGCTGCTTCTCCTCCGTCAGG - Exonic
1201065556 Y:10091832-10091854 TCTGCGGCTCCTCCTGCTACAGG + Intergenic
1201296273 Y:12465892-12465914 TCCCCTACTCCTCCTCCTACTGG + Intergenic