ID: 1161435235

View in Genome Browser
Species Human (GRCh38)
Location 19:4258955-4258977
Sequence GTCCCATCCATGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161435225_1161435235 15 Left 1161435225 19:4258917-4258939 CCATGGTGTTTGCAGGAACAGCT 0: 2
1: 2
2: 2
3: 14
4: 190
Right 1161435235 19:4258955-4258977 GTCCCATCCATGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161435235 Original CRISPR GTCCCATCCATGAGGGTGGG AGG Intronic
900595145 1:3477082-3477104 GGCCCATCCAGGAGGGAGGGTGG + Intronic
901033090 1:6319860-6319882 GAGCCATCCACGAGGGTGCGAGG + Intronic
902788602 1:18749681-18749703 GTCCCATTGATGTGGGTGGGTGG + Intergenic
902804459 1:18852235-18852257 GACCCAGCAAGGAGGGTGGGAGG + Intronic
903921425 1:26803621-26803643 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
904198659 1:28804865-28804887 GCCCCATCCACTAGGGTGGTGGG + Intergenic
905344453 1:37301997-37302019 ATCCCATGCAAGAGGGTGAGGGG + Intergenic
906356945 1:45115283-45115305 GCCCCATCCAGGAGGGAGGTGGG - Intronic
906367514 1:45223205-45223227 GCCCCGTCCGGGAGGGTGGGGGG + Intronic
910313817 1:85858851-85858873 GTCCCAGCTACTAGGGTGGGAGG - Intronic
911351745 1:96762679-96762701 GCCCCATCCAGGAGGGAGGTGGG - Intronic
913162910 1:116161611-116161633 ATCCCATTTATAAGGGTGGGGGG - Intergenic
914231014 1:145764736-145764758 GCCCCATCCAGGAGGGAGGTGGG + Intronic
914641179 1:149607742-149607764 GCCCCATACTTGGGGGTGGGGGG - Intergenic
914788035 1:150851222-150851244 GCCCCATCCGGGAGGGTGGTGGG + Intronic
915640527 1:157220685-157220707 GTCCAACCCATGAAGTTGGGAGG + Intergenic
917375911 1:174349868-174349890 GCCCCATCCAGGAGGGAGGTGGG - Intronic
919129763 1:193437618-193437640 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
920152324 1:203919556-203919578 GCCCCATCCGTGAGGGAGGTGGG - Intergenic
920779490 1:208974743-208974765 ATGGCATCCATGAGGGTGTGGGG - Intergenic
920826966 1:209431495-209431517 GGCCCATTCATGGGGGTGGGTGG - Intergenic
922102520 1:222487938-222487960 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
922957685 1:229617880-229617902 GGCGCTTCCCTGAGGGTGGGTGG + Intronic
1062926559 10:1320182-1320204 GTCCCTCCCATGAGGCTGGTAGG + Intronic
1067325289 10:45260304-45260326 GCCCCATCCGTGAGGGAGGTCGG + Intergenic
1067413162 10:46082834-46082856 TTCCTATCCATGAGGATGGAAGG + Intergenic
1067441202 10:46310059-46310081 GACTCAGCCATGAGGCTGGGAGG + Intronic
1067577855 10:47419324-47419346 GACTCAACCATGAGGCTGGGAGG + Intergenic
1068083288 10:52346587-52346609 AGCCCAGCCATGAGGGTGTGGGG - Intergenic
1068502394 10:57856615-57856637 TTCCTATCCATGAGGATGGATGG + Intergenic
1070652150 10:78245203-78245225 GGGCCATACATGAGGGTGAGTGG - Intergenic
1070966519 10:80534294-80534316 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1071393013 10:85194507-85194529 GTCCCATCAATGAGTGTTGCGGG + Intergenic
1072684587 10:97528905-97528927 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1072898993 10:99391038-99391060 GTCCCATGAATCAGGGTTGGTGG - Intronic
1074102482 10:110364630-110364652 GTCACAGCCCTGAGGGTGTGTGG + Intergenic
1075963190 10:126586857-126586879 GTCAGATCCCTGAGGCTGGGGGG - Intronic
1076514750 10:131037645-131037667 GTCCCATCCATGAAGCTTTGTGG - Intergenic
1076535216 10:131172716-131172738 GTGCCAGCCATGATGGTGGTAGG + Intronic
1076757128 10:132578530-132578552 GTCTCATCCAGGAGAGTGTGCGG + Intronic
1079371913 11:19860001-19860023 GCCCCATCCGGGAGGGAGGGGGG - Intronic
1081348784 11:42023296-42023318 GTCCCACCTAAGAGGTTGGGAGG + Intergenic
1081772551 11:45658875-45658897 TTCCCATCCTTGAAGCTGGGAGG - Intronic
1081934970 11:46898109-46898131 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1083079165 11:60073154-60073176 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1083289030 11:61679852-61679874 TTCCCATTCATCAGGATGGGAGG + Intergenic
1083289361 11:61681113-61681135 TTCCCATTCATCAGGATGGGAGG - Intronic
1083715319 11:64572004-64572026 GTCCCCTCGATGAGGGTTGTTGG + Exonic
1084264571 11:67998175-67998197 GACCCAGCCAGGAGAGTGGGTGG - Intronic
1085116490 11:73936322-73936344 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1085517585 11:77120622-77120644 GTCCCTTCCATGGTGGTGAGGGG + Intronic
1086881729 11:92158266-92158288 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1091727308 12:2855080-2855102 GCCCCATCCAGGAGGGAGGGGGG + Intronic
1092955822 12:13548805-13548827 TTCCCATGCATGAAGATGGGGGG - Exonic
1095986019 12:48000372-48000394 GACCCAGCAATGAAGGTGGGGGG + Intronic
1096597626 12:52706785-52706807 GTCCCAGCCATGGGGCTAGGAGG - Intergenic
1097749365 12:63335082-63335104 TTCCTATCCATGAGGATGGAAGG - Intergenic
1098659271 12:73072447-73072469 GTCCCCTCCATGCTGGTGGCAGG - Intergenic
1098938950 12:76512804-76512826 TTCCTATCCATGAGCATGGGAGG + Intronic
1099255305 12:80307622-80307644 GTCCCATCCAGGAGGGAGGTGGG - Intronic
1101576729 12:106004315-106004337 AATCCATCCATGAGGCTGGGTGG + Intergenic
1102274071 12:111566568-111566590 ATGCCATCCATGAGCATGGGAGG + Intronic
1103875391 12:124123274-124123296 GTCCCATCTGTGGGGGTGGGGGG - Intronic
1104292143 12:127480007-127480029 GTCCGATGTTTGAGGGTGGGAGG - Intergenic
1104417494 12:128607286-128607308 GTCCCAGGGGTGAGGGTGGGTGG + Intronic
1107493258 13:40900903-40900925 GCCCCATCCGGGAGGGAGGGGGG + Intergenic
1108351497 13:49593355-49593377 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1108502099 13:51078268-51078290 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1108608762 13:52064333-52064355 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1110363725 13:74658505-74658527 TACCCATCCATGAGCATGGGAGG - Intergenic
1112397839 13:99049630-99049652 GTCCCAGCTATGTGGGTGGGAGG - Intronic
1112574027 13:100619177-100619199 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1115493908 14:33984424-33984446 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1116191991 14:41674660-41674682 GTCCCATCCGGGAGGGAGGTGGG - Intronic
1117105787 14:52395783-52395805 CTCCCATCCTTGGGGGTAGGTGG - Intergenic
1117277136 14:54203603-54203625 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1117981971 14:61350620-61350642 GACCCCTCCATGGGGGAGGGGGG - Intronic
1117994226 14:61463322-61463344 GTCCCCTCCATGTGGGTGTCTGG - Intronic
1118455744 14:65944528-65944550 ATCCCACCCATGAGGGAAGGTGG + Intergenic
1119764970 14:77182285-77182307 GTCCCAGCCCAGAGAGTGGGCGG - Intronic
1121369917 14:93347404-93347426 GGCCCAGCCATCATGGTGGGCGG + Intronic
1122188380 14:100019823-100019845 ATCCCAGTCATGGGGGTGGGAGG + Intronic
1122209663 14:100166223-100166245 AGCCCATCCAGGAGAGTGGGGGG + Intergenic
1123156249 14:106229298-106229320 ATTCCATTCATGAGGGTGGATGG + Intergenic
1124373735 15:29117528-29117550 GTCCCAGCCAAGGGGGCGGGAGG - Exonic
1125768984 15:42152855-42152877 GCCCCATCCAGGATGGAGGGAGG + Intronic
1126385998 15:48094038-48094060 TTGCCCTCCATGAGGGTGAGTGG + Intergenic
1127866396 15:63036784-63036806 CTCCCATCACTGAGAGTGGGTGG + Intergenic
1128649067 15:69397285-69397307 GTCACTTCCATTGGGGTGGGAGG + Intronic
1128970506 15:72101621-72101643 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1129236250 15:74225427-74225449 GCAGCATCCATGAGGGTGGATGG - Intergenic
1129326538 15:74802923-74802945 GTCCTGCCCGTGAGGGTGGGGGG + Exonic
1129949324 15:79572018-79572040 TTCCCATCCAGGAGCATGGGAGG - Intergenic
1134285414 16:12857463-12857485 TACCCAAGCATGAGGGTGGGAGG - Intergenic
1134914555 16:18059057-18059079 GTCACATGCATGTGGGTGTGTGG + Intergenic
1136171350 16:28491681-28491703 GGTCGTTCCATGAGGGTGGGCGG + Intronic
1139639248 16:68278989-68279011 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1140697284 16:77547645-77547667 GGCCTGTCCCTGAGGGTGGGGGG - Intergenic
1142140141 16:88469128-88469150 GGCCCAGACATGGGGGTGGGAGG - Intronic
1142705153 17:1689647-1689669 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1143384986 17:6523806-6523828 GTCCCATCCACGAGAAGGGGGGG - Intronic
1144635870 17:16908658-16908680 GTGCCACCCATGAAGGTGTGGGG - Intergenic
1145038243 17:19556187-19556209 ATCCCATCCTTGAGCCTGGGAGG + Intronic
1146059134 17:29595429-29595451 CTCCCTTGCCTGAGGGTGGGTGG + Intronic
1146215856 17:30979246-30979268 GCCCCGTCCGGGAGGGTGGGGGG - Intronic
1146444370 17:32922712-32922734 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1150774367 17:68067444-68067466 GTCCCAGCTATGAGGGAGGCTGG + Intergenic
1151325170 17:73375355-73375377 GTCCCAGCCAACGGGGTGGGAGG - Intronic
1153605481 18:6827649-6827671 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1154289909 18:13098280-13098302 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1155571108 18:27194868-27194890 GGCCCAGCTATGAGGGTGGTTGG + Intergenic
1156425260 18:37004205-37004227 TACCCATCCATGAGCATGGGAGG + Intronic
1158023748 18:52871570-52871592 GTCCCAGCTATGAAGGTAGGAGG - Intronic
1158505303 18:58042379-58042401 CTCCCATCCATGAGGGTCACAGG + Intergenic
1159614869 18:70569650-70569672 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1160033909 18:75284245-75284267 GTCCCATGGATGAGGCTGGAAGG - Intronic
1160973811 19:1782525-1782547 GTCCCCTCCTTGGGGGTGTGAGG + Exonic
1161435235 19:4258955-4258977 GTCCCATCCATGAGGGTGGGAGG + Intronic
1161896009 19:7080971-7080993 GACAGCTCCATGAGGGTGGGGGG - Intronic
1161983590 19:7642746-7642768 TTCCTGGCCATGAGGGTGGGCGG - Exonic
1164168071 19:22700427-22700449 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1164214751 19:23134580-23134602 GCCCCGTCCTGGAGGGTGGGGGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
926744397 2:16138980-16139002 GTCCTATGCATGAGGGGGGAGGG + Intergenic
927125697 2:20011248-20011270 GTCCCATCCCAGAGGGAGGCAGG + Intronic
927776906 2:25910452-25910474 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
928203939 2:29270881-29270903 ATCCCAGCCTTGAAGGTGGGAGG - Intronic
929093971 2:38246606-38246628 AGCCCATCGATGATGGTGGGGGG + Intergenic
929516038 2:42605722-42605744 GCCCCATCCAGGAGGGAGGTGGG - Intronic
932053121 2:68418757-68418779 TTCCCCTCCATGGGGGTGGTGGG + Intergenic
932158419 2:69438724-69438746 GACACATCTAAGAGGGTGGGTGG + Intergenic
933734988 2:85487882-85487904 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
937919175 2:127118264-127118286 GACCCTTCCCTGAGGTTGGGTGG - Intergenic
938088644 2:128418217-128418239 GCCCCGTCCGGGAGGGTGGGGGG - Intergenic
941067661 2:160921340-160921362 CTCCCATCACTGAGGGTGTGGGG + Intergenic
942725737 2:179005725-179005747 GTCCCAGCTATGGGGGTCGGGGG - Intronic
943863680 2:192899641-192899663 GTCCCATCCACGTTGGTGGCTGG + Intergenic
944255374 2:197618984-197619006 GCCCCATCCGGGAGGGAGGGAGG + Intronic
947739481 2:232478602-232478624 GCCCCACCCAGGAGGGTGGCAGG + Intergenic
948706381 2:239795879-239795901 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1170698386 20:18681172-18681194 GTCTCCTGCATGAGGGTGTGTGG - Intronic
1172141257 20:32724122-32724144 GTGCCATCCAGGAGGGAGGTGGG + Intronic
1172721024 20:37000397-37000419 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1174119298 20:48250236-48250258 GACCCAGCAAGGAGGGTGGGAGG - Intergenic
1176267577 20:64218630-64218652 GTCCCCTAGAGGAGGGTGGGTGG + Intronic
1178319775 21:31596580-31596602 TTTCCATACATGGGGGTGGGAGG - Intergenic
1179571370 21:42280704-42280726 ATCCCCTCCGTGAGGGTGGAGGG + Intronic
1179990688 21:44946920-44946942 GTCCCACCCATGAGGGTCTGTGG - Intronic
1180248627 21:46564824-46564846 GTCCCAACCCTGAGTGTGGCTGG + Intronic
1181054845 22:20256042-20256064 TTCTCATCCACGAGGGTGGGAGG + Intronic
1184976592 22:48066686-48066708 GTCCCTTCCATGAGTGTTTGAGG + Intergenic
1185195563 22:49467299-49467321 GCCCCATTCAGGAGGGTGGCAGG - Intronic
949586781 3:5448432-5448454 GGCCCACGCATGGGGGTGGGAGG - Intergenic
950949022 3:16979976-16979998 GCCCCATCCAGGAGGGAGGTTGG - Intronic
952816707 3:37452804-37452826 GTCCCAGCCCAGAGCGTGGGGGG + Intronic
954448039 3:50557154-50557176 GGCCCACCCAACAGGGTGGGAGG + Intergenic
955696184 3:61639529-61639551 TTCCAATCCATGAGCATGGGAGG + Intronic
955806902 3:62746149-62746171 GTCCCACCCTTGAGTGTGGGAGG + Intronic
956209156 3:66785569-66785591 TTCCAAGCCATGAGGGAGGGTGG + Intergenic
959415088 3:106073456-106073478 GCCCCGTCCAGGAGGGTGGTGGG - Intergenic
959415681 3:106074807-106074829 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
959683879 3:109124438-109124460 GCCCCATCCAGGAGGGAGGTAGG + Intergenic
963244420 3:143047006-143047028 GCCCCATCCAGGAGGGAGGTGGG - Intronic
963877160 3:150489301-150489323 GTCCCAGGCATGTGTGTGGGAGG - Intergenic
966611684 3:181874027-181874049 GTCCCATCTACCAGGGTGGCTGG - Intergenic
966970377 3:185040099-185040121 GTGCCTTCCCTGAGGGTGGGAGG - Intronic
967130586 3:186466805-186466827 GTCCTATCTGTGCGGGTGGGTGG + Intergenic
967177665 3:186874419-186874441 GCCCCATCCAGGAGGGAGGCGGG + Intergenic
968936137 4:3611513-3611535 GGCCCCTGAATGAGGGTGGGGGG + Intergenic
970494720 4:16613790-16613812 TTCCTATCCATGAGGATGGAAGG - Intronic
971221047 4:24706277-24706299 GTCCCAGCTATGAGGGAGGCTGG - Intergenic
971938206 4:33181149-33181171 TACCCATCCATGAGCATGGGAGG + Intergenic
972416122 4:38842320-38842342 GTCCAATTCATGAAGGTGGAGGG - Intronic
973109270 4:46377965-46377987 GCCCCATCCAGGAGGGAGGTGGG + Intronic
973808057 4:54544608-54544630 GTGCCCTCCATGAGGGTGGGTGG - Intergenic
974977719 4:68912339-68912361 TACCCATCCATGAGCATGGGAGG + Intergenic
975042521 4:69762295-69762317 GCCCCATCCAGGAGGGAGGTGGG + Intronic
975042548 4:69762345-69762367 GCCCCATCCGGGAGGGAGGGGGG + Intronic
975063854 4:70037804-70037826 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
976120817 4:81779194-81779216 TTCCTATCCATGAGGATGGAAGG + Intronic
977829080 4:101568992-101569014 TACCCATCCATGAGCATGGGAGG - Intronic
978123692 4:105110596-105110618 GCCCCGTCCGAGAGGGTGGGGGG + Intergenic
979373670 4:119918999-119919021 TTCCTATCCATGAGGATGGAAGG - Intergenic
980105269 4:128582584-128582606 GTCCCTTCCATCAGGGTTGGTGG + Intergenic
983928437 4:173427673-173427695 GTCCAGTCCATGAGGGTGCCTGG - Intergenic
984004860 4:174294989-174295011 GTCCCATCCGGGAGGGAGGTGGG - Intronic
985658511 5:1144125-1144147 GTCCTCTCCCTGAGGGTGGTGGG - Intergenic
985658522 5:1144157-1144179 GTCCCCTCCCTGAGGTTGGTGGG - Intergenic
985736556 5:1586486-1586508 GCCCCATCCGGGAGGGAGGGGGG + Intergenic
985799757 5:1997232-1997254 CTCCCACCCATGAGGGCAGGTGG - Intergenic
989153321 5:38320991-38321013 TTTCCATGGATGAGGGTGGGAGG + Intronic
991223396 5:64242006-64242028 GTCCAGTGCAGGAGGGTGGGAGG - Intronic
993544622 5:89195936-89195958 GTCCTATCCATGAGGATGAAAGG + Intergenic
993743632 5:91569032-91569054 TACCCATCCATGAGCATGGGAGG - Intergenic
995633198 5:114156501-114156523 TTCCTATCCATGAGGATGGAAGG + Intergenic
995994508 5:118282847-118282869 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
996698429 5:126423708-126423730 GACCCATCCAAGGAGGTGGGAGG + Intronic
997282653 5:132658494-132658516 GGCCCAGCCATGAGGGAGAGAGG + Intronic
997765149 5:136495680-136495702 TACCCATCCATGAGCATGGGAGG + Intergenic
997874692 5:137537633-137537655 GCCCCATCCAGGAGGGAGGTGGG - Intronic
997892454 5:137687522-137687544 GCCCCGTCCGGGAGGGTGGGGGG + Intronic
998128676 5:139640287-139640309 GTCCCCTCCAGGAAGGTGGGAGG + Intergenic
999996934 5:157101317-157101339 GTCCCATCCATCTTGGTTGGTGG - Intronic
1001012219 5:168108882-168108904 GTCCCCTCCCTGAGGGTAGCTGG + Intronic
1001647843 5:173295430-173295452 GCCCCCTCCTTGTGGGTGGGGGG + Intergenic
1002013695 5:176305124-176305146 GTGCCATCCAGGAGGGGGGGGGG + Intronic
1002522687 5:179800348-179800370 GACCCGTGCATGGGGGTGGGGGG - Intronic
1003414612 6:5896801-5896823 GTCCCTTCCTCTAGGGTGGGAGG + Intergenic
1004775112 6:18835441-18835463 GTCCCATCCTTCAGGGAAGGGGG - Intergenic
1005929858 6:30475338-30475360 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1008662326 6:53681103-53681125 GTCCCATCTGTGGGGGTGGGAGG + Intergenic
1011291402 6:85781144-85781166 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1015233536 6:130944119-130944141 GTCGCAATGATGAGGGTGGGTGG + Intronic
1017001391 6:149999964-149999986 GTCCCAGCCATGGGGATGGGTGG + Intergenic
1017040881 6:150307815-150307837 TTCCCAGCCATGCAGGTGGGTGG - Intergenic
1017966682 6:159272897-159272919 GTCCTTTCCATGAGCGTGGCTGG + Intergenic
1018528141 6:164736229-164736251 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1022669193 7:32440086-32440108 GTGCCATCCATAAGGCTTGGTGG - Intergenic
1023674124 7:42612634-42612656 GTCTCATCCAGGAGGGGGGCAGG + Intergenic
1023758217 7:43439948-43439970 ATCCCATCAAAGAGGGTGGGAGG - Intronic
1023908234 7:44536916-44536938 GTGCCATCCTTGAAGGTGAGCGG + Exonic
1024532389 7:50404667-50404689 GTCCCAGTCTTGAGGGTGGGTGG + Intronic
1024538777 7:50459910-50459932 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1025821349 7:64967621-64967643 GCCCCATCCAGGAGGGAGGCGGG - Intergenic
1025821619 7:64968249-64968271 GTCCCATCCGGGAGGGAGGTGGG - Intergenic
1026957000 7:74383295-74383317 TTCCAATCAATGAGGGTTGGGGG - Intronic
1027772542 7:82425647-82425669 GTCCCAGCTATGCGGGTGAGAGG - Intronic
1028751790 7:94391214-94391236 GTCCCATCCACTAGGGAGGCTGG + Intergenic
1029186447 7:98742176-98742198 GTCCCATCCATGTGGGTACCTGG - Intergenic
1031043688 7:116863593-116863615 GTCCCATTCCCGAGGGTGGTGGG + Intronic
1033286875 7:140049118-140049140 GTCCCATGGAGGAGGGTGGGAGG + Intronic
1033957439 7:146868634-146868656 TTCCTATCCATGAGCATGGGAGG + Intronic
1034269918 7:149798437-149798459 GTCTCCCCCATGGGGGTGGGAGG + Intergenic
1034273285 7:149813424-149813446 GGCCCCTCCCTGAGGGTGGAGGG - Intergenic
1034544237 7:151779419-151779441 GAGCCCTCCATGGGGGTGGGAGG - Intronic
1036201687 8:6775748-6775770 GTCCCTGCCATGGGGGAGGGAGG - Intergenic
1039806557 8:41004965-41004987 GTCTCATTCTTGAGGGTGAGAGG - Intergenic
1039952286 8:42181739-42181761 GACCCATGCATGGGGGTGGTGGG - Intronic
1040785606 8:51159492-51159514 GCCCCATCCAGGAGGGAGGCGGG + Intergenic
1041676756 8:60547535-60547557 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1041801928 8:61809683-61809705 CTCCCCTCCATGAGGCTGTGAGG - Intergenic
1042134044 8:65616982-65617004 GCCCCATCCAGGAGGGAGGCGGG + Intronic
1043427092 8:80158302-80158324 GTTCCATGGATGGGGGTGGGGGG - Intronic
1043554938 8:81420335-81420357 GCCCCATCCATCAGGGATGGTGG - Intergenic
1043985914 8:86694233-86694255 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1046636882 8:116680182-116680204 GCCCCTTCCGGGAGGGTGGGGGG + Intronic
1047345653 8:124025794-124025816 TTCCAATCCATGAGCATGGGAGG + Intronic
1047594533 8:126365131-126365153 GTTCTGTCCATGAGGATGGGCGG + Intergenic
1051258158 9:15234386-15234408 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1051280994 9:15442254-15442276 GCCCCATCCAGGAGGGAGGTTGG - Intronic
1051594541 9:18811232-18811254 CTCCCCTCCATGAGGGTTGGGGG - Intronic
1055298028 9:74853300-74853322 GCCCCATCCGGGAGGTTGGGGGG + Intronic
1055818069 9:80231266-80231288 GTCACATCCCTGAGGGAGAGGGG - Intergenic
1056152742 9:83804602-83804624 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1057491912 9:95526838-95526860 GGACGATCCGTGAGGGTGGGTGG - Intergenic
1057751615 9:97796902-97796924 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1059799155 9:117732115-117732137 GTCCCATCTGGGAGGCTGGGTGG - Intergenic
1059879844 9:118678021-118678043 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1062332442 9:136050705-136050727 GTCCCAGCCAGGAGGGGCGGGGG - Intronic
1062394340 9:136346715-136346737 GCCCCGACCATGAGGGAGGGAGG - Intronic
1062398020 9:136360351-136360373 GTCCCAGCCAGTAGCGTGGGCGG - Intronic
1062577154 9:137214136-137214158 GTCCCTCCCGTGTGGGTGGGCGG + Intronic
1185641709 X:1592223-1592245 GGCTCATCCAGGAGGGTGGTGGG + Intronic
1186244866 X:7608815-7608837 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1189837747 X:45040731-45040753 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1190289618 X:48983609-48983631 GCCAAATCCATGAGAGTGGGAGG - Intronic
1190955621 X:55190041-55190063 CTCCCTTCCCTGAGGGTTGGGGG + Intronic
1192252197 X:69422293-69422315 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1192549867 X:72045303-72045325 GTCCCAGCAATGAGGGAAGGAGG + Intergenic
1192696850 X:73425790-73425812 CTCCTATCCATGAGCATGGGTGG - Intergenic
1193387095 X:80884870-80884892 GTTGCATCCTTAAGGGTGGGGGG + Intergenic
1198189116 X:134285973-134285995 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1198246933 X:134839668-134839690 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1198600777 X:138282725-138282747 GCCCCATCCAGGAGGTGGGGGGG - Intergenic
1199387445 X:147239411-147239433 GTCCCATCCACGAGGTTAAGTGG + Intergenic
1199843495 X:151674173-151674195 GTCCCATACCTGATGGTAGGTGG - Exonic
1201077777 Y:10199979-10200001 GTGCCGTCCATGGGGGTGGGAGG - Intergenic