ID: 1161435885

View in Genome Browser
Species Human (GRCh38)
Location 19:4262572-4262594
Sequence ATGATCAGGTGTAAATAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161435875_1161435885 9 Left 1161435875 19:4262540-4262562 CCTCCACCCTGTGGCTGTAGCCC 0: 1
1: 2
2: 16
3: 40
4: 314
Right 1161435885 19:4262572-4262594 ATGATCAGGTGTAAATAAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 118
1161435871_1161435885 27 Left 1161435871 19:4262522-4262544 CCAGTCTGCACCCTAACTCCTCC 0: 1
1: 0
2: 2
3: 21
4: 297
Right 1161435885 19:4262572-4262594 ATGATCAGGTGTAAATAAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 118
1161435874_1161435885 16 Left 1161435874 19:4262533-4262555 CCTAACTCCTCCACCCTGTGGCT 0: 1
1: 0
2: 0
3: 53
4: 596
Right 1161435885 19:4262572-4262594 ATGATCAGGTGTAAATAAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 118
1161435876_1161435885 6 Left 1161435876 19:4262543-4262565 CCACCCTGTGGCTGTAGCCCAAA 0: 1
1: 0
2: 1
3: 48
4: 224
Right 1161435885 19:4262572-4262594 ATGATCAGGTGTAAATAAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 118
1161435878_1161435885 2 Left 1161435878 19:4262547-4262569 CCTGTGGCTGTAGCCCAAAACAC 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1161435885 19:4262572-4262594 ATGATCAGGTGTAAATAAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 118
1161435873_1161435885 17 Left 1161435873 19:4262532-4262554 CCCTAACTCCTCCACCCTGTGGC 0: 1
1: 0
2: 1
3: 34
4: 288
Right 1161435885 19:4262572-4262594 ATGATCAGGTGTAAATAAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 118
1161435877_1161435885 3 Left 1161435877 19:4262546-4262568 CCCTGTGGCTGTAGCCCAAAACA 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1161435885 19:4262572-4262594 ATGATCAGGTGTAAATAAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161435885 Original CRISPR ATGATCAGGTGTAAATAAGT GGG Intronic
902713570 1:18256919-18256941 ATGATGTGGAGTAAAGAAGTTGG - Intronic
905551173 1:38840779-38840801 AGAATCAGGTCTGAATAAGTAGG + Intronic
909783958 1:79586335-79586357 ATTCTCAGGTGTAACTAACTAGG + Intergenic
910655845 1:89617186-89617208 ATGATAAGATATAAGTAAGTGGG - Intergenic
914445384 1:147745782-147745804 AAGTTAAGGGGTAAATAAGTGGG + Intergenic
1067756527 10:49009928-49009950 ATGGTCAGGTGGAAATAAACAGG + Intergenic
1068255431 10:54503449-54503471 ATGACCAAGTGAACATAAGTGGG + Intronic
1068343553 10:55740532-55740554 AGGTTTAGGTGTAAATAAGTAGG + Intergenic
1069085239 10:64131140-64131162 ATGTTCAACTGGAAATAAGTTGG + Intergenic
1069151215 10:64962861-64962883 ATGAGCATATGTAAATAAATAGG + Intergenic
1074993064 10:118728710-118728732 AAGATCAGGTATTATTAAGTTGG - Intronic
1079056565 11:17211252-17211274 ATAATCAGGATTAAATAATTGGG - Intronic
1080236743 11:30078649-30078671 CTGCTCAAGTGGAAATAAGTTGG - Intergenic
1080770718 11:35338841-35338863 TTGATCAGGTGTATCTTAGTGGG - Intronic
1084230483 11:67749153-67749175 ATGAACAGCTGTAATTAATTGGG - Intergenic
1086992949 11:93326184-93326206 ATGGTGAGGTGGAAATAAATCGG - Intergenic
1091157739 11:133389184-133389206 ATGATCAGGTGTAGACATTTTGG - Intronic
1093066495 12:14663735-14663757 ATGAACAGGAATGAATAAGTAGG - Intronic
1096710880 12:53454648-53454670 TTGATAAGGTGAAAATAACTTGG + Intronic
1097464307 12:59903412-59903434 AAGGTCAGGTGAAAATAATTTGG + Intergenic
1098735993 12:74106042-74106064 ATGATCAGCTGTAAAGCAGTAGG + Intergenic
1100004802 12:89881781-89881803 ATGAGCAAGTCTAAATGAGTAGG - Intergenic
1101610927 12:106290953-106290975 ATGATCAGGCCTAACTAATTGGG - Intronic
1102778008 12:115537713-115537735 ATGATTAGGTTACAATAAGTTGG + Intergenic
1106846701 13:33744733-33744755 ATGATCAAGTGGTAATAAGCGGG + Intergenic
1107023712 13:35778226-35778248 ATGAGGAGCTGTAAATAAATTGG - Intronic
1109532662 13:63671516-63671538 ATTATGAGAAGTAAATAAGTAGG + Intergenic
1112732243 13:102377358-102377380 ATTTTTAGGTGTAAATAATTAGG + Intronic
1112969525 13:105243031-105243053 AGGATCAGTTGTAAGTAAGAAGG + Intergenic
1116071656 14:40054227-40054249 AATATCAGGTGTGTATAAGTAGG + Intergenic
1116642547 14:47484050-47484072 ATATTCAAGGGTAAATAAGTTGG + Intronic
1120472244 14:84940008-84940030 ATAGTAAGGTATAAATAAGTGGG + Intergenic
1121772730 14:96563655-96563677 ATGATCACGTTAAAATAACTCGG - Intronic
1122076083 14:99235485-99235507 ATGATCAGGAGTAATTAACATGG + Intronic
1202888275 14_KI270722v1_random:129450-129472 ACAAACAGGTGTAAATAAGGAGG - Intergenic
1126462949 15:48932619-48932641 ATGAGTAGGTGTTAATAAGATGG - Intronic
1128979101 15:72173959-72173981 TTGATCATGTGTAAAGGAGTTGG - Intronic
1134856918 16:17527698-17527720 ATGAACAGGAGTAAATAATGTGG - Intergenic
1139412885 16:66779819-66779841 ATAATTAGGTGTAAATATGATGG - Intronic
1140605775 16:76535155-76535177 AAGATCAGGTTTAAATATGAAGG + Intronic
1144818340 17:18052709-18052731 TTGTTCATGTGTTAATAAGTAGG - Intronic
1149024555 17:52011376-52011398 ATGCTCTGGTGCAAATAATTAGG + Intronic
1149465149 17:56872606-56872628 ATAATCAGGATTAAATAAGGTGG + Intergenic
1150039885 17:61849078-61849100 ATGTTCAGCTGTAACTAACTGGG + Intronic
1156826468 18:41435467-41435489 ATGGTCAGGAGCAAATAATTAGG + Intergenic
1158723765 18:59949497-59949519 GAGAACAGGTGTAAATATGTAGG + Intergenic
1159640031 18:70853097-70853119 ATGATGAGATGTAAATAATATGG - Intergenic
1161435885 19:4262572-4262594 ATGATCAGGTGTAAATAAGTGGG + Intronic
1167592706 19:50413221-50413243 ATGGTCAGGTGGAAAGAAGTGGG - Intronic
1167830344 19:52014842-52014864 ATAATCAGGTGTAATTAAAAGGG + Exonic
1202663669 1_KI270708v1_random:96242-96264 AAAAACAGGTGTAAATAAGGAGG - Intergenic
925860272 2:8168671-8168693 ATGAGCACGTGTAAATAAAAAGG - Intergenic
926481526 2:13402796-13402818 ATGATCAAGTGGAATTAAGATGG + Intergenic
930462691 2:51703667-51703689 ATGATCATTTGCAAATAAGAAGG - Intergenic
931552302 2:63460527-63460549 ATGATCAAGTGTGAGTAATTGGG - Intronic
935657056 2:105432215-105432237 ATGAGCAGGTGCAAATGTGTTGG - Intronic
936698396 2:114979567-114979589 TTGATAATGTGTAAATATGTTGG + Intronic
940747954 2:157591472-157591494 TCCATAAGGTGTAAATAAGTAGG - Intronic
941682849 2:168417134-168417156 ATGATTTGGTGTAAAGAAATTGG - Intergenic
943981391 2:194555843-194555865 ATGATCATTTGTAAGCAAGTGGG + Intergenic
944979439 2:205098384-205098406 ATGATCACCTGTAAATCAGAGGG + Intronic
945728630 2:213504856-213504878 AAGATCAGGTGAAAGTAAATGGG - Intronic
947256278 2:228167650-228167672 GTATTCAGGTGAAAATAAGTGGG + Intronic
1170624812 20:18022676-18022698 ATGATCAGGTGTAGGTGACTGGG + Intronic
1178200565 21:30398448-30398470 ATGATTAGGTATAAATTATTAGG + Intronic
1180330402 22:11473126-11473148 ACAAACAGGTGTAAATAAGGAGG - Intergenic
1180595844 22:16972725-16972747 AGGATCAGGAGGAAATGAGTAGG - Intronic
949493744 3:4612517-4612539 ATGATCAGGGGGACAGAAGTGGG - Intronic
952383618 3:32822826-32822848 GCGATCAGATGTAACTAAGTTGG + Intronic
952674926 3:36017138-36017160 ATGAACAGATATAAATAATTTGG - Intergenic
956643720 3:71436342-71436364 ATGCTATGGTGAAAATAAGTTGG - Intronic
957141750 3:76368540-76368562 ATGGTCAGGTGTAAATACTGTGG - Intronic
958546075 3:95552361-95552383 GTGATCAAGTTTAAATAAATGGG - Intergenic
959392839 3:105797568-105797590 AGGTTCAGGAGTAAATATGTAGG - Intronic
962292850 3:134151373-134151395 ATGAACAGGTGGAAAACAGTGGG + Intronic
962629553 3:137262587-137262609 ATGATCAGGAGTAAATACACAGG + Intergenic
963750095 3:149168880-149168902 ATGCTGAGGTGTAAAGATGTGGG - Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
968373804 4:20085-20107 ATAATCAGGTGTGTATAGGTAGG + Intergenic
970728125 4:19071396-19071418 ATGATTAGGTGCTAATAATTAGG - Intergenic
977601845 4:98941787-98941809 ATAATCTGGTGTCAAGAAGTGGG + Intergenic
978540368 4:109810230-109810252 ATGATCATTTGTTGATAAGTAGG + Intergenic
978851607 4:113343924-113343946 ATGAACAGTTGGAAATGAGTAGG - Intronic
981555247 4:145986506-145986528 ATGGTTAGGGGTAAATAAGGAGG + Intergenic
983803941 4:171969502-171969524 ATAATCACGTGTAAATAAATTGG - Intronic
984298995 4:177890859-177890881 TTGGTCAGGTGTACATAAGGAGG + Intronic
985460930 4:190106179-190106201 ATAATCAGGTGTGTATAGGTAGG - Intergenic
986207411 5:5638075-5638097 ATGATCAGATGGAAATGAATTGG - Intergenic
987941502 5:24544573-24544595 AGGATCTGGAGTAAATAACTAGG + Intronic
988634753 5:32970598-32970620 ATGATCAGATTTAATTAAGATGG + Intergenic
989993622 5:50800059-50800081 ATGATCTGGTGTACATGAATTGG - Intronic
990590604 5:57259393-57259415 ATGAGTAGGTGTAAATAAGAGGG + Intronic
991105276 5:62835818-62835840 ATCATCAGGGGTAAATACCTGGG + Intergenic
997518966 5:134510041-134510063 ATGGTCAGGTTCAAATAAATAGG - Intergenic
998714269 5:144864615-144864637 ATGCTCATTTGTAAATAAGACGG + Intergenic
1003883686 6:10501660-10501682 CTGATCACGTGGAATTAAGTTGG - Intronic
1004834280 6:19513650-19513672 ATGAACAGATGGAAATAAGAAGG - Intergenic
1005045224 6:21635524-21635546 ATGATAAAGTGTCAAAAAGTAGG + Intergenic
1005686864 6:28261689-28261711 ATGATAAGGTATAAAGAAGAAGG + Intergenic
1008959953 6:57256293-57256315 ATGGTGAGGGGTAAATAAGGTGG - Intergenic
1010437050 6:75843916-75843938 ATGATGAGGTGTATTTAATTTGG + Intronic
1017641816 6:156501797-156501819 CTGTTCATTTGTAAATAAGTAGG + Intergenic
1021457487 7:20845356-20845378 CTGATCCTGTGTAAATAGGTTGG + Intergenic
1024825869 7:53388370-53388392 TTGCCCAGGTGTAAATTAGTAGG + Intergenic
1027893901 7:84015701-84015723 AAGATCAGGACTAAATAACTTGG - Intronic
1040824260 8:51603020-51603042 ATGATAATATGTAAATAATTTGG - Intronic
1041218459 8:55625052-55625074 ATGATCAATGTTAAATAAGTTGG + Intergenic
1041923506 8:63210764-63210786 TTGATCAGATCTATATAAGTGGG + Intronic
1042733849 8:71965718-71965740 ATTTTTAGGTGTAAATAATTTGG + Intronic
1044012165 8:87007253-87007275 ATGAAAAGGTGAAAATAAATGGG - Intronic
1045567203 8:103332101-103332123 ATGGTAAGGTATCAATAAGTGGG - Exonic
1045739466 8:105338926-105338948 TTGATGAAGAGTAAATAAGTAGG + Intronic
1047848522 8:128829962-128829984 ATGACCAGTTGTAAGTATGTAGG + Intergenic
1048805122 8:138233364-138233386 AAGATCAGTTGTATATGAGTTGG - Intronic
1051081270 9:13296396-13296418 ATTATTAGGTTTAAATAATTTGG + Intergenic
1052132393 9:24864312-24864334 ATAACTAGGTGTAAATATGTTGG + Intergenic
1052152538 9:25135635-25135657 ATTATCAGGTAGAAATATGTAGG + Intergenic
1052356194 9:27506979-27507001 ATGGTCAAGATTAAATAAGTTGG - Intronic
1203485460 Un_GL000224v1:49380-49402 ACAAGCAGGTGTAAATAAGGAGG - Intergenic
1188846712 X:35081107-35081129 ATGATGAAGAATAAATAAGTAGG - Intergenic
1189647790 X:43153102-43153124 ATCATAATGTGTAAAGAAGTGGG - Intergenic
1190405912 X:50087383-50087405 ATGTTCAGTTGTCAAGAAGTGGG + Intronic
1193898819 X:87149787-87149809 AGGTTCAGGGGTAAATATGTAGG + Intergenic
1197866161 X:131019896-131019918 AAGATCACGTATAAAAAAGTAGG - Intergenic