ID: 1161437788

View in Genome Browser
Species Human (GRCh38)
Location 19:4273875-4273897
Sequence AGGGGTTCCCACTCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161437788_1161437796 9 Left 1161437788 19:4273875-4273897 CCTTCCTCAGAGTGGGAACCCCT No data
Right 1161437796 19:4273907-4273929 GCCATATCTCTCCCATCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161437788 Original CRISPR AGGGGTTCCCACTCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr