ID: 1161438646

View in Genome Browser
Species Human (GRCh38)
Location 19:4278777-4278799
Sequence TTGGAGCAGCAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 1, 2: 8, 3: 68, 4: 689}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161438646 Original CRISPR TTGGAGCAGCAGAAGGAAGA GGG (reversed) Exonic
900858261 1:5203706-5203728 TGGCAGGAGCAGGAGGAAGAGGG + Intergenic
900949753 1:5851832-5851854 TGGCTGCAGCAGGAGGAAGAGGG - Intergenic
901313167 1:8285310-8285332 GTGGGGCAGTGGAAGGAAGATGG + Intergenic
902177903 1:14665092-14665114 TTGGGGCAGCGGAATAAAGAGGG - Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902612252 1:17604015-17604037 TTGTGGCCGCAGAAGGGAGATGG + Intronic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903192336 1:21663728-21663750 TGGGGGCAGCAGAGGGAAGGTGG - Intronic
903253990 1:22079465-22079487 TTGGAATGGTAGAAGGAAGATGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903788183 1:25875197-25875219 TGGGAGGAGCAGAAGGAGCACGG - Intergenic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904203655 1:28838353-28838375 TTGAAGAAGCAGAAGGAACTTGG + Intronic
904273021 1:29362785-29362807 GTGGAGCAGAACAAGGATGAGGG - Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904554299 1:31348159-31348181 TTGGTGCAGCAGAAAGCACAGGG + Intronic
904568356 1:31442134-31442156 GTGAAGCTGCAGAAGGGAGAAGG + Intergenic
904591155 1:31616308-31616330 CTGGAGCAGCATAAGGGAGGGGG - Intergenic
904679584 1:32219734-32219756 TTGCAACAGTAGATGGAAGAAGG + Intronic
904824495 1:33265612-33265634 TTGGAGTGGCAGAGGGCAGAGGG + Intronic
905338342 1:37260612-37260634 TTGGAGCCCCAGAAGGTTGAGGG + Intergenic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906205256 1:43983221-43983243 TGGGAGCACCAGGATGAAGACGG + Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908166411 1:61463472-61463494 TAGGAGGAGGAGGAGGAAGAGGG - Intergenic
908325869 1:63023107-63023129 TAAGAGCAGGTGAAGGAAGAGGG + Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
908894219 1:68880765-68880787 TTCGAGGAGCTGAAAGAAGACGG - Intergenic
908909020 1:69050940-69050962 TTGGAGCACCAGAAGCAAAAGGG - Intergenic
911383594 1:97146737-97146759 TTGGGGCTGCAGTAGAAAGATGG + Intronic
911471684 1:98327044-98327066 TTTGACCAGCAGAATAAAGATGG + Intergenic
911780941 1:101877585-101877607 TTGGAATAGGAGAAGAAAGAGGG + Intronic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
912567270 1:110597084-110597106 TGAGAGCTGCAGAAGGAAGCAGG - Intronic
913049400 1:115103794-115103816 CTGTAGCAACACAAGGAAGAAGG - Intergenic
914310542 1:146462120-146462142 TTGGAGGGGCACAAGGAAGTTGG - Intergenic
915101977 1:153507318-153507340 TGGAAGCACCAGGAGGAAGATGG - Intergenic
915185788 1:154104261-154104283 TAGGAGGAGGAGAAGCAAGATGG + Intronic
915200216 1:154221301-154221323 TTGGAGCAGCCGTAGGAAGGGGG + Intronic
915269983 1:154747038-154747060 TAGGAGGTGCAGGAGGAAGAGGG - Intronic
915311703 1:155008553-155008575 TGGGACCAGGAGAAGGAAGAAGG - Intronic
915611417 1:156996422-156996444 AGGAAGCAGCAGAAGGCAGAGGG + Intronic
915646570 1:157276982-157277004 TTGGAGGAGTAGAAGAAAGTTGG + Intergenic
916214361 1:162383098-162383120 TTGGAGTTGGAGAAGCAAGATGG + Intronic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916308514 1:163367549-163367571 CTGGAACAGCAGCAGGAACATGG - Intergenic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919159329 1:193807898-193807920 TATGTGGAGCAGAAGGAAGATGG + Intergenic
919862451 1:201749519-201749541 TTGGTGGAGCAGAAGGATGCAGG - Intronic
920034494 1:203056988-203057010 TTGGGGCATCAGAAGCAGGAAGG + Intronic
920712680 1:208310116-208310138 TGGAAGCAGCAGAATGCAGATGG - Intergenic
921538452 1:216382380-216382402 TTGTAGCAACATAAGAAAGATGG + Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921721302 1:218474803-218474825 TTGGAGCAGCAAAATGATTAAGG + Intergenic
922276667 1:224085624-224085646 TTGGACCATCAGCAGGAAGCTGG - Intergenic
922511906 1:226175660-226175682 TTAAAGCAGCAGTAGGAAAATGG + Intronic
922615503 1:226958858-226958880 ATGGAGCAGCAGGAAGAAGTAGG + Intronic
922775613 1:228213099-228213121 TGGGAGCAGCGGGAGGGAGAGGG - Intronic
922977920 1:229800659-229800681 TTGGAGGGGCAGCAGGAACAGGG + Intergenic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
924202384 1:241673484-241673506 ATGGAGCAGGATAAGGCAGAGGG - Intronic
924735283 1:246750095-246750117 TTCGAACAGCAGAAAGAGGATGG - Intronic
1063057038 10:2517010-2517032 TGGGAGGAGGAGGAGGAAGATGG - Intergenic
1063563199 10:7148290-7148312 TGAGAGCACCAGAGGGAAGAAGG - Intergenic
1064918110 10:20484995-20485017 TTTGAGCATCATTAGGAAGAAGG - Intergenic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065351565 10:24800160-24800182 TTGGAGGACCAGAAATAAGAAGG - Intergenic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065620323 10:27574534-27574556 TTGGATCAAGTGAAGGAAGATGG + Intergenic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066291922 10:34022295-34022317 TTGCAGCAGCAGAGCAAAGAAGG + Intergenic
1067248987 10:44571474-44571496 TTGGGGAAGCAGAAGCAAGGGGG + Intergenic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1067292639 10:44955527-44955549 TGGGAGCACCAAAGGGAAGAAGG + Intergenic
1067525655 10:47036804-47036826 TGGGTGCAGCAGCAGAAAGATGG + Intergenic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069851052 10:71405240-71405262 TCGGAGCAGGAGAAGGAACATGG - Intronic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1069979562 10:72242800-72242822 TAGGAGGGGCAGCAGGAAGAGGG + Intergenic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071251026 10:83819940-83819962 TTGTAGCAGCAGTTGGATGATGG - Intergenic
1071906090 10:90175302-90175324 TGGGAGCAGGAGGAGGAAGCTGG - Intergenic
1072932648 10:99680264-99680286 TTGCAGTAGCAGCAAGAAGAGGG - Intronic
1073067921 10:100774857-100774879 TGAGAGCAGCAAAAGGAAGAAGG - Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1074210001 10:111322524-111322546 TGGCAGCAGCAGTAGGAGGATGG + Intergenic
1074290899 10:112137410-112137432 TTGGAGCAGCAGAGGGGAGCAGG + Intergenic
1074426591 10:113356897-113356919 TTGGAGCAACAGCAGGCATAAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076209994 10:128632613-128632635 TTAGAGCAGCATCAGGCAGATGG - Intergenic
1076418184 10:130307534-130307556 TTTGAGCACCATATGGAAGAGGG - Intergenic
1076438546 10:130463205-130463227 CTGGAGCAGCTGACAGAAGAGGG + Intergenic
1076685385 10:132196321-132196343 TAGGACGAGCAGAAGGATGAGGG - Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077390352 11:2298166-2298188 TTTGAGCAGCATGAGGAATATGG - Intronic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078118431 11:8480245-8480267 CTGGAGCATCAGGTGGAAGAAGG + Intronic
1078759155 11:14237857-14237879 TAAGAGCAGCAGAAGTAGGAGGG + Intronic
1080415388 11:32065432-32065454 TTGGATGAGGAGAATGAAGAAGG - Intronic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1080806928 11:35662611-35662633 TTGGAGGAGGAGGAGGGAGAAGG - Intergenic
1080886906 11:36376293-36376315 TGGGAGGAGAAGGAGGAAGAGGG + Intronic
1081007151 11:37759094-37759116 GTGGAAGAGCAGAAGGAAAAAGG - Intergenic
1081095262 11:38924939-38924961 AGGGAGCAAGAGAAGGAAGAAGG - Intergenic
1081550064 11:44102644-44102666 TGGCCTCAGCAGAAGGAAGAGGG - Intronic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084927547 11:72525566-72525588 TGGCAGCTGCAGAAGGAACATGG - Intergenic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1086193427 11:84108174-84108196 GGGGAGCAGGGGAAGGAAGAGGG + Intronic
1086268858 11:85035231-85035253 TTGAAACAGCAGATAGAAGATGG + Intronic
1086737115 11:90320442-90320464 TTTGAGGGGCAGAAGGCAGAAGG - Intergenic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1088723145 11:112612148-112612170 TTGGGGCTGCAGCAGGAAAACGG + Intergenic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1089097024 11:115927690-115927712 TTCGAGAAGCTGAAAGAAGATGG + Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089276263 11:117338063-117338085 CAAGAGCAGCAGAAGGCAGAAGG - Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1090126877 11:124095480-124095502 TTGTGGCAGCAGAAGGTACAGGG + Intergenic
1090424381 11:126596940-126596962 TTAAAGCAGCAGGAGGAAGCAGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090681768 11:129067089-129067111 TTTGACCAGCAGTAGGAAGAGGG - Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1092071622 12:5636232-5636254 TGGGGACAGAAGAAGGAAGAGGG - Intronic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1092762068 12:11819265-11819287 TTCGGGCAGCAGATGGCAGATGG - Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093652069 12:21657535-21657557 GCGGAGGAGCAGAAGGCAGAGGG - Exonic
1093742697 12:22706425-22706447 GTGGGGCAACAAAAGGAAGAAGG + Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1095259893 12:40085854-40085876 TGGGAGTAGCAGAAGGAATGCGG - Intronic
1095529409 12:43168295-43168317 TTGGAGCAGAAGATTGCAGATGG - Intergenic
1095986758 12:48004427-48004449 TTGGAGCAGGAGGGGGAAGCGGG + Exonic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097594436 12:61610866-61610888 TTCGAGGGGCAGCAGGAAGAGGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097907962 12:64939990-64940012 TTGGAGGAGCAAAAGGGAAAGGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098864469 12:75746104-75746126 GTGGCCCAGCAGGAGGAAGAAGG + Intergenic
1099054687 12:77824473-77824495 TTGGAGCCCTAGAAGGAAGAGGG + Intergenic
1099149764 12:79095809-79095831 TTGAATCTTCAGAAGGAAGAGGG - Intronic
1099767668 12:87009420-87009442 TTGGAGGAGGAGAAAAAAGATGG + Intergenic
1100286582 12:93172630-93172652 TTGGAGGGACAGAAGGAAGTGGG - Intergenic
1100394441 12:94172212-94172234 TAGGAGGAGGAGAAGAAAGAGGG + Intronic
1100550763 12:95644462-95644484 GAGGAGGAGCAGGAGGAAGAGGG - Intergenic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1102024153 12:109703979-109704001 CTGGAGCTGCAGTGGGAAGATGG - Intergenic
1102145006 12:110648462-110648484 TTGAAGCAGCAGAGGCAAGGGGG + Intronic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1104402275 12:128485867-128485889 TTAGAGGAGGAGGAGGAAGAAGG - Intronic
1104570055 12:129917369-129917391 TTGGAGGAGGAAAAGGAAGGGGG - Intergenic
1104584090 12:130033926-130033948 TGAGAGCCTCAGAAGGAAGATGG - Intergenic
1104835461 12:131787120-131787142 TTGGAGCAGGAGATGGAGGGAGG + Intronic
1105899625 13:24743888-24743910 GTGGAGCAGGAGATGGTAGAGGG - Intergenic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1108522059 13:51255505-51255527 TTGTAGCAGCAAAAGCAAAATGG + Intronic
1108628235 13:52254137-52254159 TTAGAGCAGCAGAAGCAACTTGG - Intergenic
1108657824 13:52552312-52552334 TTAGAGCAGCAGAAGCAACTTGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1109065385 13:57682152-57682174 TAGGAGTATAAGAAGGAAGATGG - Intronic
1109225450 13:59689127-59689149 TTCTTGCAGCAGAAGAAAGAAGG - Intronic
1109319907 13:60797839-60797861 TTGTAGCAGCTGAAGAAATATGG + Intergenic
1109376483 13:61500920-61500942 TTGGACCACCACAAGGAAAAGGG + Intergenic
1109765084 13:66884531-66884553 TTGAAGGAGCAGAAGGTAAAAGG + Intronic
1109853080 13:68092734-68092756 TTGTGGCAGCAGAAGAATGAAGG + Intergenic
1110483770 13:76014473-76014495 TTGGAGCAGAAGAAAGGAAAGGG - Intergenic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1112332094 13:98484576-98484598 TTGGAAGTGCAGAAGGACGAGGG - Intronic
1112352974 13:98651943-98651965 TTGGAGCAGCTGGAAGAAGAAGG - Intergenic
1112560297 13:100506772-100506794 TAGGAGGAGAAAAAGGAAGAGGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113393450 13:109920043-109920065 TTGCATCAGCAGAAAGAAAATGG + Intergenic
1113509467 13:110841489-110841511 TAGAAGCTGCAGAGGGAAGATGG - Intergenic
1113669453 13:112165765-112165787 GAGGAGGAGGAGAAGGAAGAGGG - Intergenic
1113696720 13:112351714-112351736 GTGGAGGGGCAGAAAGAAGAGGG - Intergenic
1114042384 14:18691141-18691163 TAGGAGAAGCTGTAGGAAGACGG - Intergenic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115783153 14:36793499-36793521 TGGGAGGAGCAGAGGGGAGAAGG - Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118805297 14:69231246-69231268 TCTGAGGAGAAGAAGGAAGAAGG - Intronic
1119217608 14:72881106-72881128 TTGGAGCTGCAGGAGGATGATGG - Intronic
1119424052 14:74524514-74524536 TTGGTGCAGGAGAAGCAAGGCGG - Intronic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1119909799 14:78339151-78339173 TTGGAGAAGCTGAAGGAAAGAGG + Intronic
1120014215 14:79451730-79451752 CTGGAGCAGCAGAATGCAAAGGG - Intronic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1121463171 14:94097631-94097653 CTGGAGCTGCAGAAGTATGAGGG + Intronic
1121614589 14:95304759-95304781 TCGGAGCTGCAGAAGGAAGTGGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1122037335 14:98958293-98958315 TGGGAGCAGCTGCAGGAAAAGGG - Intergenic
1122405978 14:101501265-101501287 TTGTAGCTCGAGAAGGAAGAAGG - Intergenic
1122631153 14:103108341-103108363 TTGGAGCAGCGGTGGGGAGAGGG + Intronic
1122785857 14:104162956-104162978 TTGGAGCAGCACCAGGCAGCAGG + Intronic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1125207242 15:37167601-37167623 TTGCTGCAGGAGAGGGAAGATGG - Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1125747747 15:42008644-42008666 CTGGAGCAACAGAAGGGATAGGG + Intronic
1126257948 15:46650297-46650319 TTGGAGCAGAAGAGAGTAGAGGG + Intergenic
1126265054 15:46744470-46744492 TTTGAGGAGCTGAGGGAAGAAGG - Intergenic
1126330491 15:47525928-47525950 GTAGGGCAGCAGAAGGAAGGGGG + Intronic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127157089 15:56139600-56139622 TTTGAGGAGCAGAGAGAAGAAGG - Intronic
1127341090 15:58044824-58044846 TTGGATGAGCAGAGGGAAAAGGG + Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1127734863 15:61831008-61831030 TTTGAGCAGCACAAGGAAGCAGG + Intergenic
1128053561 15:64683562-64683584 TGAGGGCAGCAGAAGGCAGAGGG - Exonic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1128802464 15:70505363-70505385 TGGGAGCAGCAGGAGCTAGAAGG - Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1129015563 15:72465074-72465096 TGTGTGGAGCAGAAGGAAGAGGG - Intergenic
1129990612 15:79959313-79959335 TTGGAGGAAGAGAAGGAAAAAGG + Intergenic
1130688833 15:86062677-86062699 TGGGAGCAGGAGAAGGAAAGAGG - Intergenic
1131069486 15:89456817-89456839 TTGGAGCAGCAAAGGAAGGAGGG + Intergenic
1131150129 15:90042572-90042594 TTGGATGATCAGAAGGAAAAAGG + Intronic
1131875145 15:96798019-96798041 ATGGAGGAGGAGAAGGAAAAGGG + Intergenic
1132751118 16:1458179-1458201 GGGGAGCAGCCGAAGGGAGAGGG - Intronic
1132953869 16:2580709-2580731 TGGAAGCAGCAGAGAGAAGAGGG - Intronic
1132960476 16:2619454-2619476 TGGAAGCAGCAGAGAGAAGAGGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134224075 16:12378245-12378267 TCGTGGCAGCAGAAGGCAGAGGG + Intronic
1135192886 16:20369111-20369133 TTTGAGGAGGAGAAGGGAGATGG - Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135928096 16:26712842-26712864 TTTTACCAGAAGAAGGAAGATGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136118618 16:28113045-28113067 TTGGACCTGCAGAGGGAAGAGGG + Exonic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1137342612 16:47624604-47624626 TTGGAACAGCCAAAGGTAGAGGG - Intronic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1138177906 16:54918506-54918528 TTGTAGCAGCTATAGGAAGATGG - Intergenic
1138527564 16:57617884-57617906 TTGGGGTACCAGAAGGGAGAAGG - Intronic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141124593 16:81392121-81392143 TTGCAACAGCCGTAGGAAGAAGG + Intergenic
1141278045 16:82605888-82605910 AGGAAGCAGCAGTAGGAAGATGG - Intergenic
1141308851 16:82893863-82893885 TTGGACCAGTGGAAGGAAGGAGG - Intronic
1141514560 16:84535092-84535114 TTGGGGGAGAAGGAGGAAGAAGG - Intronic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1142749007 17:1976483-1976505 TTGGTGCTGCAGAAGGAAACGGG + Intronic
1143046796 17:4087515-4087537 TAGGTGCAGCAGAAGGAAAGTGG - Exonic
1143095815 17:4477767-4477789 TTGGAGCAGCACAGGGAGGTGGG - Intronic
1143097723 17:4487383-4487405 TGGCTGCAGCAGAAGCAAGAGGG + Intronic
1143205056 17:5135546-5135568 TTGGAGCAGCCCCAGGAGGAGGG - Intronic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143475914 17:7203892-7203914 TTGGAGCAGCCAGAGGAGGAAGG + Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1145123105 17:20278302-20278324 TTGGAGAATTAGAAGCAAGAGGG + Intronic
1146510289 17:33441603-33441625 TGGGAGAAGGAGAAGGAAGGAGG - Intronic
1146553001 17:33798206-33798228 TTGGGGCAGGAGGAGGAAGTAGG + Intronic
1146682795 17:34820668-34820690 TTTCAGGAGCAGGAGGAAGATGG - Intergenic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147800696 17:43084616-43084638 GTGTAGCAGGAGAAAGAAGATGG - Intronic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148047678 17:44753937-44753959 GAAGAGCAGCAGAAGGAAGGAGG + Intergenic
1148785837 17:50145835-50145857 TTGGAGCAGGGGAGGGAAGCAGG + Intronic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1150222325 17:63503188-63503210 TTTGCGTAGGAGAAGGAAGAGGG - Intronic
1150650280 17:67005669-67005691 TGTGATCAGCAGAAGGGAGACGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151076246 17:71276337-71276359 TTTTAGTAGCAGTAGGAAGAAGG - Intergenic
1151181266 17:72330515-72330537 TTGGAGCAGGAAAGGGAAGGTGG - Intergenic
1151659182 17:75509634-75509656 TTGAGGCAGTAGAAAGAAGAGGG + Intronic
1151778828 17:76228309-76228331 TGAGAGCACCACAAGGAAGAAGG - Intronic
1152660137 17:81538242-81538264 TTGGAGCAGGTGGAGGAAGCTGG + Intergenic
1153333770 18:3901082-3901104 AGGGAGCAGCAGAAGGGAGTAGG - Intronic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1154149596 18:11895912-11895934 TAGAAACAGCAGCAGGAAGAAGG + Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155416117 18:25601559-25601581 TTGGAGGTGCTGAAGGAAGCAGG - Intergenic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156361420 18:36387726-36387748 GTGGAGGAGCAGCAGGGAGATGG - Intronic
1157201659 18:45664676-45664698 TTGGGGGAGCTGGAGGAAGAAGG - Intronic
1157585735 18:48800071-48800093 TTTCAGCAGCCGGAGGAAGAGGG + Intronic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158500124 18:57993507-57993529 TTGGAGCAGCTGAGGGAAGCAGG + Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158870257 18:61679920-61679942 TACGAGCAACAGAAGGAGGATGG - Intergenic
1159097465 18:63920552-63920574 TTGTAGTAGCAGCAGGAAGTGGG + Intronic
1159220396 18:65456137-65456159 GTGGAGCAGTAAATGGAAGAAGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160429719 18:78803208-78803230 TTGGAGGAGAAGAAGCCAGATGG - Intergenic
1160629853 18:80239201-80239223 TGGGAGCAGCAGGGAGAAGAGGG + Intronic
1161287995 19:3478690-3478712 TTGGAGGAGCAGCAGGGAAATGG + Intronic
1161348867 19:3781567-3781589 TTGGGGGTGCTGAAGGAAGATGG - Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161922824 19:7279339-7279361 TTCTGGCAGCAGAATGAAGAAGG + Intronic
1161931740 19:7345192-7345214 TTTGAGGAACAGAAGGAAGCAGG - Intergenic
1162554071 19:11375592-11375614 GTCGAGCAGCAGAAGGGAGGGGG - Exonic
1162792047 19:13068259-13068281 TGCAAACAGCAGAAGGAAGAGGG + Intronic
1163244755 19:16086558-16086580 ATGGCGCAGCAGCAGGAAGTGGG + Intronic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163620896 19:18359397-18359419 TTTGAGGAGCAGGAGGAAGCTGG - Intronic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1164567686 19:29339566-29339588 TAGGAGGAGGAGTAGGAAGAAGG + Intergenic
1164686869 19:30172448-30172470 CTGGAGCAGGAGAAGGGAGCTGG + Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165183410 19:33994018-33994040 TTTGAGGAGCATAAGGCAGAAGG - Intergenic
1165534942 19:36435945-36435967 TTAGAGCAGCAAAAGTAAAAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166873326 19:45883635-45883657 TTGAAGGAGCAGAAGGGAGCGGG + Exonic
1166886780 19:45966283-45966305 TTGGAGGAAGGGAAGGAAGAAGG - Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167209981 19:48128099-48128121 TGAGAGCTGCAGAAGGAAAAGGG - Intronic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
1167603455 19:50467511-50467533 GTGGGGCAGCAGAGGGCAGAGGG - Intronic
1167608138 19:50492703-50492725 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167689811 19:50978397-50978419 TTGGAGGTGGAGAAGAAAGAGGG + Intronic
1167752522 19:51389276-51389298 TGGGAGCAGCAGGGGCAAGAGGG + Exonic
1167873375 19:52391454-52391476 GAAGAGCAGGAGAAGGAAGAAGG + Intergenic
1168152004 19:54454413-54454435 TGGGGGCTGCAGAAGGAAGCAGG - Exonic
1168602429 19:57728437-57728459 TTGGAGTGGAAGAAGGAAGAGGG + Intronic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925421211 2:3713431-3713453 GTGGAGCAGCAGAGGGGGGAAGG - Intronic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
926946219 2:18190236-18190258 TTGGAGCAGAATAAAGAAGATGG + Intronic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
927633496 2:24793984-24794006 TTTGGGCAGCAGCAGGAAGGAGG - Intronic
927674077 2:25091611-25091633 TTGGATCTGCAGAAGGCAGCTGG + Intronic
927811797 2:26184575-26184597 CTGGAGCTGCAGATGCAAGAGGG + Exonic
927853114 2:26512145-26512167 TTTGGGCAGCAGAAGGAGGTGGG + Intronic
928893819 2:36238300-36238322 TTGGAAGAAGAGAAGGAAGATGG - Intergenic
929250791 2:39752905-39752927 TAGGAGCAGGGGAAGGCAGAGGG - Intronic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930511389 2:52349727-52349749 GTGGAGGAGAGGAAGGAAGAAGG - Intergenic
931691638 2:64838897-64838919 TTGGCGCAGCAGGAAGGAGAAGG - Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933629137 2:84636363-84636385 TGGGACCTGAAGAAGGAAGAAGG - Intronic
933656712 2:84894531-84894553 TTGAAGCAGAAGAAGGAAGTGGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934716379 2:96547018-96547040 TTGGAGCAGAGGAAAGAAAAGGG + Intronic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
935958686 2:108402708-108402730 TTCGAACAGCAGAAAGAGGATGG + Intergenic
936225314 2:110644153-110644175 TGGGAATACCAGAAGGAAGAAGG + Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936741044 2:115509026-115509048 TGGGAGCAGCACAAGGAAGGGGG + Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937922719 2:127143225-127143247 TTGGAGGAGCAGAAGGATGGTGG - Intergenic
937941021 2:127286149-127286171 GCTGAGCAGCAAAAGGAAGATGG + Intronic
938737484 2:134199601-134199623 TTGGAGCAGCCGATAGAACAAGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939667352 2:144967915-144967937 TTAGAGCAGAAGAATGAACATGG + Intergenic
939992091 2:148885376-148885398 GTGAAGCAGCAGCAGGGAGAAGG - Intronic
940326268 2:152428543-152428565 TTGATGCAGCAAAAGGAAAAAGG - Intronic
940624163 2:156151153-156151175 TGGGAACAGGAAAAGGAAGACGG + Intergenic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
941759669 2:169227967-169227989 GTGGAGCAGCTGAGAGAAGAAGG - Intronic
942210187 2:173662424-173662446 TTAGAGCAGCAGAAGGAACTTGG - Intergenic
942301268 2:174564756-174564778 TTGGTGCCCAAGAAGGAAGAAGG + Intronic
942744846 2:179220378-179220400 TAGGAGCAGCAAAAGGAAAAAGG + Intronic
942832084 2:180249406-180249428 TCAGAGCAGCAAAAGGCAGAAGG + Intergenic
942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG + Intergenic
943187618 2:184632768-184632790 TTGGGGTAGAAGAAGGAAAAGGG + Intronic
943641211 2:190360182-190360204 TTCGATCAGCAGCTGGAAGAGGG - Exonic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946151756 2:217778296-217778318 TTGTCCCAGCAGAAGAAAGAGGG - Intergenic
947076007 2:226346816-226346838 TGGGGGCAGGAGAAGGTAGATGG - Intergenic
947087795 2:226475154-226475176 TGGAAGCAGGAGAAGGAAGAAGG - Intergenic
947228978 2:227866494-227866516 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948458489 2:238118210-238118232 ATGGAGCAGCAGATGGATGGAGG + Intronic
948618187 2:239215057-239215079 TTCGAGCGGCAGAATCAAGATGG + Intronic
948672465 2:239577272-239577294 TTGAAGCTGCAGCAGGAAGCGGG + Intergenic
948906533 2:240982285-240982307 TTGGACAAGCTGAAGGCAGAGGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169571844 20:6914767-6914789 TTGTTGCTGGAGAAGGAAGAGGG + Intergenic
1169804759 20:9548025-9548047 TTGCGCCAGCAGTAGGAAGATGG - Intronic
1171087434 20:22250622-22250644 CTGGAGCAGGAGGAGGGAGAGGG + Intergenic
1171383147 20:24748280-24748302 TGGGAGCAGCAGAAGGAAACAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172763196 20:37336420-37336442 TTGGACCAGCAGAGAGGAGATGG + Intergenic
1172865108 20:38089903-38089925 TTGTACCAGCAGAAAGAAGAGGG + Exonic
1172948146 20:38704205-38704227 TAGGAGCTGGAGAAGGCAGAAGG - Intergenic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1173580518 20:44143606-44143628 GGGGAGCACGAGAAGGAAGAAGG - Intronic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175156106 20:56972754-56972776 TTGGGGCCCCAGAAGGCAGAGGG + Intergenic
1175503321 20:59465496-59465518 ATGGGGCAGAAGGAGGAAGAAGG - Intergenic
1175554657 20:59840977-59840999 ATGGAGCAGCACAACGAAGAAGG - Intronic
1175825054 20:61932162-61932184 TCTGAGCAGCAGGAGGGAGATGG - Intronic
1175954039 20:62599241-62599263 TTGGAGCTTCTGTAGGAAGATGG - Intergenic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1176671555 21:9739510-9739532 TGGGAGAAGAAGAAGAAAGAAGG + Intergenic
1177364875 21:20121629-20121651 TTTTTGCAACAGAAGGAAGAAGG + Intergenic
1177388229 21:20434038-20434060 TTGGAGGAGAAGAAGAAATACGG - Intergenic
1177731379 21:25031071-25031093 GTGGAGCAGCAGAAACAAAAGGG + Intergenic
1177802945 21:25846374-25846396 TTGGAGCAGGAAAAGGAAGGAGG + Intergenic
1178217343 21:30614342-30614364 TTGGAGCAGCAGGAAAGAGATGG - Intergenic
1178580166 21:33831592-33831614 TTGGAACAGCAGGAGCAGGAAGG + Intronic
1178738208 21:35171815-35171837 TCTGTGCAGCAGAAGAAAGAGGG + Intronic
1179295069 21:40054441-40054463 GTGGGGCAGCAGAAGGGTGATGG + Intronic
1179355307 21:40653296-40653318 TTGGAGCAGTAGAAAAAAGATGG + Intronic
1179670413 21:42942973-42942995 TTAGGGCAGCAGAAGGATGTAGG + Intergenic
1179982991 21:44906067-44906089 GTGGTGCAGCAGATGGGAGAAGG - Intronic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1180642177 22:17307798-17307820 GGGGTGCAGCAGAAGGAAGAAGG + Intergenic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1180969247 22:19806482-19806504 TTGCAGCAGCAGGAAGCAGAGGG + Intronic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1181886238 22:26024438-26024460 CTGGAGCAGCATGAGCAAGAGGG + Intronic
1182505293 22:30777883-30777905 TTGGAGGAGAGGGAGGAAGAAGG + Intronic
1182848927 22:33454776-33454798 TGGGAGCAGCAGAAAGAATGGGG + Intronic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183593977 22:38798563-38798585 ATGGAGCAGCAAGAAGAAGATGG - Intergenic
1184391451 22:44205778-44205800 CTGGAGCTGCTGAAGGACGAGGG + Exonic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184855416 22:47143921-47143943 CTGGAGCAGAAGAAGGCAGCGGG - Intronic
1184953910 22:47867810-47867832 TTAGAGCAGCAGCAAGAAAATGG - Intergenic
1185188538 22:49418009-49418031 GGGGAGCAGCACCAGGAAGACGG + Intronic
949609940 3:5693636-5693658 TTTGAACAGCAGAAAGAAGATGG - Intergenic
949901832 3:8821522-8821544 ATGGAGGATGAGAAGGAAGAAGG - Intronic
950340080 3:12235605-12235627 TTGTAGCACCAGTATGAAGAAGG + Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
950595674 3:13979160-13979182 ATGGAGCAGAAGCAGGAAGCAGG - Intronic
950866220 3:16191241-16191263 TTCCCGCAGCAGGAGGAAGAAGG - Intronic
950980865 3:17303099-17303121 GGGGAGCAGCAGAAAGAAAAGGG - Intronic
952925891 3:38318944-38318966 TTGCAGCATCAGCAGAAAGATGG - Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
954065791 3:48104866-48104888 TTGGAGCAGGTGAAAGAACAGGG + Intergenic
954263991 3:49459464-49459486 TGGGAACAGCTGCAGGAAGAGGG + Intergenic
954770652 3:52965149-52965171 TTTGAGCTGGAGAAGGAAGAGGG - Intronic
954841736 3:53517354-53517376 TTGAAGTTGCAGAAGGAAGGTGG + Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957830395 3:85509227-85509249 TGGGGGCAGTAGCAGGAAGAGGG + Intronic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
958860452 3:99438896-99438918 TTAAAGCAGAAGAAGGAAGGAGG + Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960062824 3:113340902-113340924 TGGGAGAACCAGAAGGGAGATGG + Intronic
960113383 3:113867886-113867908 TGGGAGTATCAGAAGGAAAAAGG - Intronic
960490657 3:118313501-118313523 TTGGACCAGCCCAAGGCAGAGGG + Intergenic
961070993 3:123926701-123926723 TTGGAGAAGGAAAAGAAAGAGGG + Intronic
961153192 3:124657166-124657188 TTGGATTGGGAGAAGGAAGAGGG + Intronic
961467744 3:127091755-127091777 TTGGAGCAGCAAACAGTAGAAGG - Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
964210142 3:154217595-154217617 TCAGAGCAGCTGAAGGGAGATGG - Intronic
965073630 3:163948388-163948410 TTGGAGCAACAAAATGAAGTAGG + Intergenic
965550461 3:169959780-169959802 GGGCAGCAGCAGCAGGAAGATGG - Intergenic
966211721 3:177460239-177460261 TGGGAGGAGGGGAAGGAAGAAGG + Intergenic
966967706 3:185011766-185011788 TAGGATCAGTAGGAGGAAGAAGG + Intronic
967062506 3:185884623-185884645 TAGGAGCTACAAAAGGAAGAAGG + Intergenic
968045207 3:195620075-195620097 TCGGAGGGACAGAAGGAAGAGGG - Intergenic
968061059 3:195726418-195726440 TCGGAGGGACAGAAGGAAGAGGG - Exonic
968276667 3:197445632-197445654 AAGGAGCAGAAGAAGGAACAGGG - Intergenic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
969448770 4:7260830-7260852 GAGCAGCAGCAGGAGGAAGAGGG - Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
970299468 4:14666508-14666530 GTGGAGCATCTGGAGGAAGATGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971525957 4:27619040-27619062 TGGAAGCAGGAGAAGGTAGATGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
974239226 4:59223783-59223805 TTAGAGTAGCAGAAAGAAGGAGG - Intergenic
974247092 4:59333849-59333871 GTGGAAGAGCAGAAGGAAGGAGG - Intergenic
974329668 4:60461696-60461718 TGGGAGCCACAGAAGAAAGATGG + Intergenic
974468801 4:62292700-62292722 TTGCAAGGGCAGAAGGAAGAAGG - Intergenic
975103067 4:70536312-70536334 TTGGAACAGGAGATGGAACATGG - Intergenic
975195033 4:71514329-71514351 TGGCTGCAGCAGGAGGAAGAGGG - Intronic
975814705 4:78205722-78205744 TGGGAGCAGCAGCAGGAAGAGGG + Intronic
976339919 4:83935437-83935459 TTGAATCAGCAGAAGGACAAAGG - Intergenic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978151671 4:105443332-105443354 GTGAAGAAGCAGAAGGCAGAAGG + Intronic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
979611240 4:122691100-122691122 TGAGAGCAGCAGCAGGAACAGGG - Intergenic
979808205 4:125001657-125001679 TTGGGGAGGCAAAAGGAAGATGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980963943 4:139502524-139502546 GTGGAGCACAGGAAGGAAGAGGG + Intronic
981359814 4:143833223-143833245 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981370581 4:143954302-143954324 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981380347 4:144064222-144064244 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983218327 4:165021232-165021254 GTGGAGCAGAAGAAGAGAGAGGG - Intergenic
983917047 4:173303239-173303261 TTGCGGCAGAAGTAGGAAGATGG + Intronic
984112103 4:175629395-175629417 TGGAAACAGCAGATGGAAGATGG + Intergenic
984713638 4:182905975-182905997 TAGGGGCAGCATCAGGAAGATGG - Intronic
985880288 5:2634151-2634173 GTGGAGCTGCAGAAGGCAGGCGG + Intergenic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
986692000 5:10320879-10320901 CTGGAGCAGGAGAAGAGAGAGGG + Intergenic
986806547 5:11313254-11313276 TTGGGGCAGCAGCAGGAAACAGG + Intronic
987092927 5:14523441-14523463 TGGGAGCACCAGCAGGAGGAAGG - Intronic
987420072 5:17709459-17709481 TTGGTGCTACAGAATGAAGAGGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987772212 5:22319940-22319962 CGGGAGCAGGAGAAGGGAGATGG + Intronic
988776002 5:34478575-34478597 TTTGAGGGGCAGAAGGCAGAAGG + Intergenic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989563756 5:42880372-42880394 TAGGAGGAGGGGAAGGAAGATGG - Intronic
990182296 5:53174516-53174538 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
991126487 5:63075513-63075535 CTGCAGCAGCATATGGAAGATGG - Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992090649 5:73312971-73312993 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
992254063 5:74904111-74904133 TTGGAGCTGCAGTGGGAACAGGG + Intergenic
992361264 5:76041039-76041061 TGGGAGGGGCAGAAGGGAGAGGG + Intergenic
992368379 5:76116465-76116487 TGGGAAGAGCAGAAGGCAGAGGG - Intronic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
992477243 5:77115698-77115720 GTGGCACAGCAGAAGGAACATGG + Intergenic
992751118 5:79862721-79862743 TTGGATCTGCAAAAGGAATAAGG - Intergenic
992773469 5:80070041-80070063 GCAGAGCAGCAGAAGGGAGATGG - Intronic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
993311108 5:86333083-86333105 TTGGAACAGGAGAAGGTATAAGG + Intergenic
994014798 5:94952793-94952815 TTGGAGCATGAGAAGGGTGAAGG - Intronic
994109653 5:95986945-95986967 TTGGAGTGGCAGAAAGGAGATGG + Intergenic
995394616 5:111674037-111674059 TCGGAGCAGAGGAAGGGAGAAGG + Intronic
995466270 5:112452230-112452252 TTGAAGCTGTAGGAGGAAGATGG - Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
996362197 5:122662086-122662108 TTGTAACAGCAGATGGAACATGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996865218 5:128113263-128113285 TGGGAGCATCAGAATCAAGAAGG + Intronic
996882668 5:128317703-128317725 TTGGAGCAGAAGAAGTTGGAAGG - Intronic
997044620 5:130299364-130299386 TTTGAGCAACAGAAGGATGGTGG + Intergenic
997291434 5:132738537-132738559 CTGGTGCAGAAGAAGCAAGAGGG - Intergenic
997597231 5:135115130-135115152 TTGGAGCTCCAGAAAGAAAAAGG - Intronic
997800660 5:136857732-136857754 TTTGAGCACCAGTAGGAATAAGG - Intergenic
997923096 5:138001502-138001524 ATGGAGCTTTAGAAGGAAGATGG - Intronic
997981297 5:138468959-138468981 TGGGAGCAAAATAAGGAAGAGGG + Exonic
998855175 5:146387733-146387755 TTTGAGGAGAAGAAGGAAGGAGG - Intergenic
999397597 5:151239919-151239941 TTGGAGGGGCAAAAGGAAGAGGG + Intronic
999443895 5:151623516-151623538 TTGGGGAAGCTGAAGCAAGAGGG + Intergenic
999963243 5:156779662-156779684 TAGGTGCAGCAGTAGGAAGCAGG - Intergenic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000497717 5:162006439-162006461 TTGGAATAGCTGAAGGAAAATGG + Intergenic
1001041908 5:168342225-168342247 TTGGAGCAGAGGAAGGGAGAGGG + Intronic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001257155 5:170192885-170192907 GGGGAGCAGAAGAAGGCAGAGGG + Intergenic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001321172 5:170683005-170683027 TTAAAGCAGGGGAAGGAAGATGG - Intronic
1001852500 5:174981700-174981722 CTTTAGCAGCAGGAGGAAGAGGG - Intergenic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002118228 5:176981706-176981728 TGGGACCAGGAGAAGGAAGGTGG + Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002401056 5:178991785-178991807 TTGGGGCAGAAGCAGAAAGATGG - Intronic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003169020 6:3705883-3705905 TTCAGGCAGCAGAAGGCAGATGG + Intergenic
1003395747 6:5750578-5750600 TTGCAGGTGCAGGAGGAAGAAGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004167124 6:13266677-13266699 TTGGAGGAGCAGGAGCAAGAGGG + Exonic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1005558781 6:27015981-27016003 TTGAAGCAGCACAAGGCAGATGG - Intergenic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1006090543 6:31626132-31626154 TTGGATCAGGAGAATGATGATGG + Exonic
1007129377 6:39455527-39455549 TTTGACGAGCTGAAGGAAGAAGG + Intronic
1009890283 6:69672356-69672378 TTGTAACAGCAGATGCAAGAAGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010630023 6:78188452-78188474 TGGCAGGAGCAAAAGGAAGAGGG + Intergenic
1010716783 6:79239344-79239366 TTTAAGCAGCAGGAGCAAGAAGG - Intergenic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011888420 6:92126674-92126696 GAGGAGGAGCAGGAGGAAGAGGG + Intergenic
1012708996 6:102573522-102573544 TTCGAGGAGGAGAAAGAAGAGGG - Intergenic
1012957399 6:105586185-105586207 TCAGAGCAGGAGAATGAAGAGGG + Intergenic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013373464 6:109490904-109490926 TTGGGGCAGCAGCTGGAGGATGG + Intergenic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014479604 6:121919882-121919904 TAGTAACAGCAGGAGGAAGAAGG + Intergenic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015696558 6:135986904-135986926 GTGGAGCAGAAGAAGTGAGAAGG + Intronic
1016283630 6:142448338-142448360 TGGGATCATCAGAATGAAGAGGG + Intergenic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1016646203 6:146411379-146411401 CTGGAGCAGAGGAAGTAAGAAGG + Intronic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1018637714 6:165878903-165878925 TGGAACCACCAGAAGGAAGATGG + Intronic
1018657914 6:166057601-166057623 TAGAAGCAGAAAAAGGAAGAGGG + Intergenic
1018687746 6:166317017-166317039 TAGGGGCTGCAGAAGGATGAAGG - Intergenic
1018787646 6:167120935-167120957 TTGGAACTACAGAAGGAATATGG + Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019412727 7:913592-913614 TTTGAGCAACAAAAGGAAGATGG - Intronic
1019623543 7:2003934-2003956 TGGGAACGGCAGATGGAAGAGGG + Intronic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019830276 7:3321683-3321705 GAGGAGGAGGAGAAGGAAGAAGG - Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1022190233 7:28010387-28010409 TAGGAACAGCAGAAGGCTGAAGG - Intronic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1023144155 7:37132625-37132647 TGGGTGGAGCAGAAGGAAGTGGG - Intronic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1026584293 7:71643692-71643714 TTGCAGCAGCAGAAGGCAGCAGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026679851 7:72457602-72457624 TGGGAGAAGGAGGAGGAAGAGGG - Intergenic
1026956141 7:74377447-74377469 TGGGTTCAGCTGAAGGAAGAAGG - Intronic
1027226219 7:76245258-76245280 TTGAAGGAGCAGAGGGAAGCAGG + Intronic
1027639365 7:80714127-80714149 TTTGACGAGCAGAAAGAAGAAGG + Intergenic
1027772854 7:82429378-82429400 TAGAGGCAACAGAAGGAAGAAGG + Intronic
1028076851 7:86527094-86527116 TTGGACCAGCAGAAGGATGGAGG - Intergenic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029635043 7:101777955-101777977 TGGGAGCAGGAAGAGGAAGAGGG + Intergenic
1029797584 7:102911150-102911172 TTGGAGGAGGTGAAGCAAGATGG - Intronic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1030522203 7:110611739-110611761 TAGGAGGGGCAGAAGGAAGAGGG + Intergenic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1031518687 7:122735640-122735662 TTGGATCAGCAGGGGGATGAGGG - Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032417757 7:131750363-131750385 TTGGACCAGGAGAAGGAACTAGG + Intergenic
1032681829 7:134192938-134192960 TGGGAACAGAGGAAGGAAGAAGG - Intronic
1033439655 7:141367147-141367169 GTGGACCAGCAGAGGGAGGAAGG + Intronic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1034016748 7:147596020-147596042 TTGGAGCTGCAGCATGAAGACGG - Intronic
1034453418 7:151150034-151150056 TGGGAGGAGGAGGAGGAAGAGGG + Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035516769 8:240376-240398 GAGGACCAGCAGAAGGGAGAAGG + Intronic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1036452499 8:8881075-8881097 TTGGAGCAGGAGAAGAATGTGGG - Intronic
1036511523 8:9404668-9404690 TGCCTGCAGCAGAAGGAAGACGG + Intergenic
1036667019 8:10752961-10752983 TGGAAGCATCAGAAGGAAGTGGG - Intronic
1037176772 8:15956656-15956678 TGGGTTCAGAAGAAGGAAGAGGG + Intergenic
1037229967 8:16646176-16646198 TTCCAGAAGCAAAAGGAAGAGGG + Intergenic
1037236046 8:16720531-16720553 TCTGAGCAGCACAAGGCAGAAGG - Intergenic
1038054603 8:23846639-23846661 GTGGCACAGCAGAAGGAAGCTGG + Intronic
1038795236 8:30703776-30703798 GGGGAGCAGGGGAAGGAAGAAGG + Intronic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1041834688 8:62198264-62198286 TGGGAGCAGCAGGGGGAAGCAGG + Intergenic
1041861870 8:62523616-62523638 TAGGAGCAGGAGAAGGAAAATGG + Intronic
1042215275 8:66424952-66424974 CTAGAGGAGCAGGAGGAAGATGG + Intergenic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1043011339 8:74885213-74885235 TGAGAGCACCAGAAGGAACAAGG + Intergenic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1044753251 8:95436445-95436467 TGAGAGCAGCAGAAAGGAGAGGG - Intergenic
1044893530 8:96863213-96863235 TTGGAGCAGGGGGAGGATGATGG + Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045316984 8:101052058-101052080 GTGGAGCAGCATAAAGATGAAGG - Intergenic
1045388271 8:101691228-101691250 TGGGAGCTGTAGAAGGAAGGAGG - Intronic
1046744767 8:117864895-117864917 TTGGAGAAGAGGAAGGAAGTAGG - Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047640903 8:126820878-126820900 TTGGAGAGGAAGAAGGGAGATGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048421191 8:134279823-134279845 GTGGAGCAGCAGATGTAAGGAGG + Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049092940 8:140530397-140530419 AGGGAACAGCAGCAGGAAGAGGG + Intergenic
1049133062 8:140866456-140866478 TTAGAGAAGCATAAGGAACATGG + Intronic
1049444355 8:142623255-142623277 TGGGAGCAGCAGATGGCAGCAGG - Intergenic
1051846397 9:21455848-21455870 TTGGTGCAGGAGATGGGAGAAGG + Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1055511035 9:76995791-76995813 TGGAAGGAGCAGAAGGAAGGGGG - Intergenic
1055927923 9:81529883-81529905 TAGGAGCAGTTTAAGGAAGAGGG - Intergenic
1057164874 9:92917549-92917571 TTGGAGCTGGAGCAGGAACAAGG - Intergenic
1057325858 9:94062606-94062628 TGGGAGCAGGAGCAGGAGGAAGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1060573019 9:124660571-124660593 TTGGAGCTGCAGAAAGATGGGGG + Intronic
1060593079 9:124831669-124831691 TTGAAGCAGGAGATGGAAGTGGG - Intergenic
1061201175 9:129139371-129139393 TTGAGGCAGCAGAAGGAACAGGG + Intronic
1062097767 9:134711776-134711798 TTGGATCAGGAGATGCAAGAAGG - Intronic
1062477521 9:136736121-136736143 GGGGAGGAGAAGAAGGAAGAAGG - Intergenic
1062488394 9:136792226-136792248 GTGGAGCAGGAAATGGAAGAGGG - Intronic
1185487218 X:491253-491275 TGGGAGCTTCAGAAGAAAGAGGG + Intergenic
1186325449 X:8471812-8471834 TGGGACCAGAAGTAGGAAGAGGG - Intergenic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1186919497 X:14262513-14262535 TTTGGGTAGAAGAAGGAAGAGGG - Intergenic
1187532894 X:20112635-20112657 TTTCACCAGAAGAAGGAAGAGGG - Intronic
1187850083 X:23583104-23583126 TTTGGGTAGAAGAAGGAAGAGGG + Intergenic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1188986167 X:36770202-36770224 TAGGACCTGCAGAAGGTAGATGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189668127 X:43379229-43379251 TTCTAGCAGTAGAAGAAAGAAGG + Intergenic
1189760880 X:44320360-44320382 CTGGAGCAGAACAAGGGAGAAGG + Intronic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1192085796 X:68096073-68096095 TGGAAACAGCAGAAGCAAGAAGG + Intronic
1192314231 X:70039561-70039583 AGGCAGCAACAGAAGGAAGATGG + Intergenic
1193827431 X:86242844-86242866 ATGGAGCAGGAGAAAGAAGGGGG - Intronic
1195059870 X:101183825-101183847 TAGGGGCTGCAGAAGGATGAAGG + Intergenic
1195574717 X:106437030-106437052 TTGTAGCAGCAGAAAGAACCGGG - Intergenic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1198278909 X:135123332-135123354 GTGGAGCATCAGGAGGAAGGTGG + Intergenic
1198292050 X:135249188-135249210 ATGGAGCATCAGGAGGAAGGTGG - Intronic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200123428 X:153802092-153802114 TTGGGGTGGGAGAAGGAAGAGGG - Intergenic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1201316896 Y:12656271-12656293 TTGGGGGAACAGAAGGAATAAGG - Intergenic