ID: 1161455364

View in Genome Browser
Species Human (GRCh38)
Location 19:4367156-4367178
Sequence CCTGCTCTGCAGGCAGCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 281}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161455364_1161455374 -4 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455374 19:4367175-4367197 CAGGGTGGGCCTGCAGGGGGAGG 0: 1
1: 0
2: 10
3: 119
4: 901
1161455364_1161455372 -8 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455372 19:4367171-4367193 AGAGCAGGGTGGGCCTGCAGGGG 0: 1
1: 0
2: 4
3: 54
4: 503
1161455364_1161455370 -10 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455370 19:4367169-4367191 GCAGAGCAGGGTGGGCCTGCAGG 0: 1
1: 0
2: 5
3: 71
4: 627
1161455364_1161455383 8 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455383 19:4367187-4367209 GCAGGGGGAGGGGGAGGGTGGGG 0: 1
1: 14
2: 469
3: 1449
4: 6996
1161455364_1161455373 -7 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455373 19:4367172-4367194 GAGCAGGGTGGGCCTGCAGGGGG 0: 1
1: 0
2: 3
3: 65
4: 569
1161455364_1161455384 9 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455384 19:4367188-4367210 CAGGGGGAGGGGGAGGGTGGGGG 0: 1
1: 4
2: 78
3: 1188
4: 6116
1161455364_1161455375 -3 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455375 19:4367176-4367198 AGGGTGGGCCTGCAGGGGGAGGG 0: 1
1: 1
2: 7
3: 104
4: 821
1161455364_1161455385 12 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455385 19:4367191-4367213 GGGGAGGGGGAGGGTGGGGGTGG 0: 2
1: 14
2: 341
3: 2839
4: 16169
1161455364_1161455376 -2 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455376 19:4367177-4367199 GGGTGGGCCTGCAGGGGGAGGGG 0: 1
1: 1
2: 11
3: 130
4: 1058
1161455364_1161455382 7 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455382 19:4367186-4367208 TGCAGGGGGAGGGGGAGGGTGGG 0: 1
1: 2
2: 26
3: 339
4: 2588
1161455364_1161455377 -1 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455377 19:4367178-4367200 GGTGGGCCTGCAGGGGGAGGGGG 0: 1
1: 1
2: 17
3: 174
4: 1274
1161455364_1161455371 -9 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455371 19:4367170-4367192 CAGAGCAGGGTGGGCCTGCAGGG 0: 1
1: 0
2: 5
3: 57
4: 464
1161455364_1161455379 3 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455379 19:4367182-4367204 GGCCTGCAGGGGGAGGGGGAGGG 0: 1
1: 4
2: 24
3: 196
4: 1830
1161455364_1161455381 6 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455381 19:4367185-4367207 CTGCAGGGGGAGGGGGAGGGTGG 0: 1
1: 0
2: 31
3: 406
4: 2939
1161455364_1161455378 2 Left 1161455364 19:4367156-4367178 CCACACGCTGCCTGCAGAGCAGG 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1161455378 19:4367181-4367203 GGGCCTGCAGGGGGAGGGGGAGG 0: 1
1: 2
2: 32
3: 349
4: 2486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161455364 Original CRISPR CCTGCTCTGCAGGCAGCGTG TGG (reversed) Intronic
901039861 1:6357399-6357421 CCTGCCCTGCAGGCCCCGTGTGG - Intronic
901631814 1:10651673-10651695 CCTGCTCTGCTGGCCTCCTGCGG - Intronic
901653171 1:10754695-10754717 GCTGCTCTCCAGGCAGAGAGAGG - Intronic
902704870 1:18197652-18197674 CAGGCTCTGGAGGCAGCCTGTGG + Intronic
904499067 1:30903681-30903703 CCTGCTCTTCTGGCGGGGTGGGG - Intronic
905210948 1:36373908-36373930 CCTGCTCTGCTCCCAGCCTGTGG + Intronic
905253507 1:36665300-36665322 CCAGCTCTCAAGGCAGCCTGGGG - Intergenic
905650135 1:39650798-39650820 CCTGCTCTGCAGACACTTTGAGG + Intergenic
907761408 1:57364462-57364484 CCTGCTCTGCACGCAGGCAGAGG + Intronic
911219351 1:95230961-95230983 CGGGCTCTGCAGGCTGAGTGTGG - Exonic
912739310 1:112178833-112178855 CCAGCTCTGCATGCATCATGAGG + Intergenic
916782990 1:168056368-168056390 CCTGCTCTGCACCCTGCGCGCGG - Intronic
916787459 1:168096848-168096870 CCTCCTCTTCAGGCAGCAGGAGG - Exonic
921185762 1:212667923-212667945 CTTGCTCAGCTGGCAGAGTGGGG + Intergenic
922542896 1:226432714-226432736 CAGGCTCTGCCGGCAGCCTGTGG - Intergenic
922601993 1:226863479-226863501 ACTGCTTAGCAGACAGCGTGGGG - Intergenic
923146086 1:231199208-231199230 CATCCTCTGCACCCAGCGTGGGG + Intronic
1063034381 10:2270852-2270874 CCTGCTCTGCCTGCAACGTGGGG - Intergenic
1063045433 10:2387449-2387471 TCTGCTCGGCCGTCAGCGTGGGG - Intergenic
1063350319 10:5348153-5348175 CCTTTTCTGCAGGGAGCTTGAGG + Intergenic
1063460375 10:6211808-6211830 CCTTCTCAGCAGGCAGAGTAAGG - Intronic
1064280155 10:13944145-13944167 CCTGCTGTGCAGCCAGTCTGTGG - Intronic
1067227340 10:44384707-44384729 CTCGCTCTGCAGCCAGCTTGAGG + Intronic
1067458942 10:46443327-46443349 CCTGCTCTGCTCTGAGCGTGGGG - Intergenic
1067628254 10:47941305-47941327 CCTGCTCTGCTCTGAGCGTGGGG + Intergenic
1067693578 10:48519851-48519873 CCTTTTCTGCAGGCAGTCTGGGG + Intronic
1067806406 10:49395989-49396011 CCTGCTCGGCTGGCGGCGGGCGG + Intronic
1068388296 10:56360099-56360121 GCTGCTCTGCAGCCAGCTTCAGG - Exonic
1069950314 10:72014241-72014263 CATGCTCTGCAGGCAGCTCTTGG - Intergenic
1071564663 10:86665508-86665530 GATGCTCTGTAGGCAGCGTTAGG + Intronic
1073445713 10:103579109-103579131 CCTGCACTGCTGGCAGCGTATGG + Intronic
1073487520 10:103829218-103829240 CCAGCCCTGCAGACAGGGTGGGG + Intronic
1075060910 10:119256186-119256208 GCAGCCCTGCAGGCAGCGAGAGG - Intronic
1075273042 10:121069571-121069593 CATGCTCTGCAGGCGGCCTTGGG + Intergenic
1075522293 10:123150145-123150167 CCGGCTCTGCGGGCAGCTGGGGG - Exonic
1075715155 10:124551444-124551466 CCTGCTCTGCAGGGTGGGGGCGG + Intronic
1076119209 10:127922403-127922425 CCTGCTCTGGAGACTCCGTGGGG + Intronic
1076242713 10:128921771-128921793 CATGCTGTGCAGGCATCCTGTGG - Intergenic
1076287762 10:129317061-129317083 CCTGGGCTGCATGCAGCCTGTGG - Intergenic
1076404558 10:130203204-130203226 TGTGCTGTGCAGGCACCGTGCGG - Intergenic
1076775106 10:132691043-132691065 TCTGCTCCGGAGGCCGCGTGGGG - Intronic
1077477492 11:2797290-2797312 CTTGGTCTGCAGGCAGGTTGGGG - Intronic
1077574650 11:3373174-3373196 CCTGTTCTGCATGCAGCTTATGG + Intronic
1078235401 11:9480060-9480082 CCTGGTCTGCAGGTGGCCTGTGG + Intronic
1083261718 11:61526762-61526784 CCTCCTTTGCAGGCACCATGAGG - Intronic
1083327804 11:61882012-61882034 CCAGCTCTGCAGGTAGCTGGGGG - Intronic
1083777977 11:64903460-64903482 CCTGCTGTGCGGGCTACGTGTGG + Intronic
1084601449 11:70148136-70148158 CCTTAACTGAAGGCAGCGTGTGG - Intronic
1085163360 11:74370305-74370327 CTTGCTTTGCACGGAGCGTGGGG - Intronic
1086215477 11:84374393-84374415 CCTGGACTGCATGCAGCCTGTGG - Intronic
1088446216 11:109931592-109931614 CCTGGTCTGCAGGCGGCCTGTGG - Intergenic
1089386018 11:118068596-118068618 ACCCCTCTGCAGGCAGCCTGGGG + Intergenic
1092255756 12:6926115-6926137 CCTGCTCTCCAGGTAGCCTCTGG - Intronic
1094082972 12:26557521-26557543 ACTGCTCTCAAGGCAGCTTGAGG + Intronic
1095765208 12:45886840-45886862 CCTAGGCTGCAGGCAGCATGGGG + Intronic
1096665481 12:53161181-53161203 CCTGCTCCACAGGCTGCCTGGGG - Exonic
1096798369 12:54092665-54092687 CCTGCTCTGCATGAAGGGTCAGG - Intergenic
1098999311 12:77159291-77159313 CCTGGGCTGCATGCAGCCTGTGG + Intergenic
1104638982 12:130455324-130455346 CCTGGTCTTCATGCAGCGTCTGG + Intronic
1104720662 12:131043527-131043549 TCTCCCCTGCAGGCTGCGTGTGG + Intronic
1104999264 12:132678683-132678705 CCTGCTCTTCAGCCTGCATGAGG - Intronic
1105015478 12:132784127-132784149 TCTGCTGTGGCGGCAGCGTGGGG - Intronic
1105291932 13:19058773-19058795 CCAGCACTGCCGGCAGGGTGGGG + Intergenic
1105402036 13:20104742-20104764 CTTACTCTGCAGCCAGCCTGTGG - Intergenic
1105506955 13:21018532-21018554 CCTGCTGCGCAAGCAGGGTGTGG - Intronic
1105534054 13:21247701-21247723 CCTGGTCTGCAGGGAGGGGGTGG - Intergenic
1105790568 13:23794230-23794252 CTTTCTCTGGAGGCAGCCTGGGG - Intronic
1112508975 13:99991712-99991734 CCAGCTCTGGATGCAGCGAGAGG - Intergenic
1113372870 13:109738608-109738630 CCTGCCCTGCATCCAGCCTGCGG - Intergenic
1113571878 13:111363687-111363709 CCTGGGCTGGAGGCAGGGTGTGG - Intergenic
1114233431 14:20803478-20803500 CCTGCTCTGGGGGCATCGAGAGG + Intergenic
1119265304 14:73260647-73260669 CCTGGGATGCAGGGAGCGTGGGG + Intronic
1120793066 14:88603014-88603036 CTTGCTGAGCAGGCAGCTTGAGG + Exonic
1121122360 14:91383953-91383975 CCCATTCTGCAGGCAGTGTGAGG + Intronic
1121422688 14:93826475-93826497 CCTGCTCTGTGGTCACCGTGGGG - Intergenic
1121698019 14:95928587-95928609 CATGCTCTGCAGGCAGCTGGTGG - Intergenic
1121713328 14:96055178-96055200 CCTGCTCTGCAGGTCCCATGGGG + Intronic
1122030325 14:98907355-98907377 CCAGCCCTGCCGGCAGCATGGGG + Intergenic
1122355356 14:101119892-101119914 CCTGCTCGGCAGGCAGCCTCGGG + Intergenic
1122503795 14:102218998-102219020 CCTGCTCTTCAGGGAGGGAGTGG - Intronic
1122583622 14:102788143-102788165 CATTCTCTGCAGGCCGGGTGTGG - Intronic
1122872218 14:104644166-104644188 CCAGATCTGCAGTCAGCCTGCGG + Intergenic
1122997746 14:105274708-105274730 TGTGCTCTGCAGACAGAGTGGGG - Intronic
1123705961 15:22951405-22951427 CTGGCTCTGCAGGCAGCGCTGGG - Intronic
1124510068 15:30316436-30316458 GCTGCTCTCCAGCCAGCCTGGGG - Intergenic
1124732821 15:32214117-32214139 GCTGCTCTCCAGCCAGCCTGGGG + Intergenic
1124785144 15:32672324-32672346 CCAGGGCTGCAGGCAGCGTGAGG + Intronic
1126462341 15:48927312-48927334 CCTGCTCTCCAGCCTGTGTGGGG - Intronic
1126660682 15:51030521-51030543 CATGCTCTTCAGTCAGCTTGTGG + Intergenic
1127218376 15:56849276-56849298 CCTGGGCTGCATGCAGCCTGTGG - Intronic
1127464088 15:59227009-59227031 CCTGCCCTGCAGGCAGGCTGAGG + Intronic
1127592447 15:60439078-60439100 CTTGCTTTGCATGCAGTGTGAGG + Intronic
1127994653 15:64146168-64146190 ACAGCTCTCCAGGCTGCGTGTGG - Intergenic
1128671027 15:69574902-69574924 CCAGATGTGCAGGCAGCGTGGGG + Intergenic
1128705179 15:69832886-69832908 CCAGCTCTGCTGGCTCCGTGTGG + Intergenic
1128928352 15:71679772-71679794 TCTGCTCTGCAGACAGTTTGGGG + Intronic
1129878876 15:78994297-78994319 ACTGCTCTGGGGGCAGAGTGTGG + Intronic
1130967567 15:88708596-88708618 TCTGGTCTGCAGGCAGCATTAGG - Intergenic
1131066137 15:89436019-89436041 GCTGATATGCAGGCAGCCTGGGG + Intergenic
1132043804 15:98547823-98547845 CGTGCTCTGGAGGCGGGGTGGGG + Intergenic
1132463883 16:68744-68766 CAGGCTCTGCAGGCAGCCAGAGG - Intronic
1132755516 16:1482667-1482689 CCTGCCCAGCTGGCACCGTGGGG - Intergenic
1134460287 16:14424216-14424238 ACTGCTCTGAGGGCTGCGTGTGG + Intergenic
1136074242 16:27805962-27805984 CCTATTCTGCAGGGAGCCTGGGG + Intronic
1136674819 16:31893276-31893298 CCTAGGCTGCAGGCAGCATGGGG + Intronic
1137655344 16:50153900-50153922 GCTGCTCCGCGGGCAGCGCGTGG - Exonic
1138473846 16:57259095-57259117 CCTGCTCAGCAGGCCTCCTGGGG - Intronic
1139961714 16:70721778-70721800 GCTGCTCTGCAGACAGGGTTAGG + Intronic
1141086032 16:81096224-81096246 CCTGCTCTGCACCCTGCGCGCGG - Exonic
1141717977 16:85737872-85737894 CCTGGGCTGCAGGCAGCTGGAGG - Intronic
1142998592 17:3776429-3776451 CCTTCTCTGCAGTCAGCGTGGGG - Intronic
1144756560 17:17683173-17683195 CCTGCTCTGACGTCAGCGCGAGG - Intronic
1144777444 17:17791885-17791907 TCTGCTCTGCAGGCAGGGGCAGG + Intronic
1144816587 17:18039557-18039579 CTTGCTCCGCAGGCAGCGGGCGG + Exonic
1145241652 17:21243809-21243831 CCTGCTCTCCAGGCAGCCTGGGG + Intronic
1146724160 17:35143943-35143965 CCTGGGCTGCATGCAGCCTGTGG - Intergenic
1146848903 17:36204958-36204980 CCAGCTCTGTAGTCAGAGTGTGG + Intronic
1148683154 17:49486176-49486198 CCTGCTCTGCACTCCGAGTGGGG - Intergenic
1149481175 17:57004276-57004298 GCTGCTCTGGAGGCTGAGTGAGG + Intronic
1149644311 17:58228686-58228708 CCTGCTCAGCTGGGAGCTTGGGG - Intronic
1150832694 17:68538329-68538351 CCTGCTCTGGAGGCAGGGAAGGG + Intronic
1151512411 17:74569387-74569409 CCGGCTCTGCAGGCTGCAAGGGG - Intergenic
1151978870 17:77497682-77497704 CAGGCCCTGCCGGCAGCGTGGGG + Intronic
1152080250 17:78182766-78182788 CCTGCTTTGCAGGTAGCAGGTGG - Intronic
1152715479 17:81898333-81898355 CGGGCTCTGCAGGCTGCCTGTGG - Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1154252524 18:12756257-12756279 CCTCCTCTGCTGGCCGGGTGCGG + Intergenic
1156474225 18:37395441-37395463 CCTGCTATGCATGAAGTGTGCGG - Intronic
1158976471 18:62715636-62715658 CCAGCTCCGGAGGCAGCGGGCGG - Exonic
1160099404 18:75906014-75906036 CATGGTCTGCAGTCAGGGTGGGG + Intergenic
1160456570 18:79006266-79006288 CGGGCTCTGCAGCCAGAGTGAGG - Intergenic
1160519051 18:79494076-79494098 CCTGTGCGCCAGGCAGCGTGTGG + Intronic
1160540274 18:79617259-79617281 CCTCCTCTCCAGGGAGCTTGGGG - Intergenic
1160599851 18:80004264-80004286 CCTGCCCTGAGGGCAGCCTGAGG + Intronic
1161455364 19:4367156-4367178 CCTGCTCTGCAGGCAGCGTGTGG - Intronic
1161771419 19:6233150-6233172 CCGGCACTGCAGGCAGGCTGGGG - Intronic
1163103019 19:15108999-15109021 GCTGCTCTGCAGGCAGTGAGGGG + Intronic
1163670866 19:18627692-18627714 TCTGCTCTGGCGGCTGCGTGAGG + Intergenic
1164574452 19:29397603-29397625 CCAGCTCTGCAGGAAGCATGAGG - Intergenic
1166781324 19:45345091-45345113 CCTCCTCTGCCGGCAGAGTGAGG - Intronic
1167290987 19:48625039-48625061 CCTGCTCTCCAGGGAGCGGGTGG - Intronic
1167864012 19:52309373-52309395 CCTGCTCTTCAGCCTGTGTGGGG + Intronic
1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG + Intronic
1168021292 19:53610652-53610674 CCTGAGCTGCAGGCAGCCTATGG - Intergenic
1168041721 19:53764262-53764284 CTTTCTCTGCAGGAAGGGTGTGG + Intergenic
925046109 2:774005-774027 CCTGCTCGGGGGGCAGCCTGGGG - Intergenic
926059362 2:9795545-9795567 CCTGCTGAGCAGCCAGCATGAGG - Intergenic
926082880 2:10003054-10003076 CCTGCTCTCCAGGAAACGAGAGG - Intergenic
926150381 2:10422623-10422645 ACAGCTCAGCAGGCAGTGTGGGG + Intronic
926579461 2:14618813-14618835 CGTGCTCTGCAGACAGTGGGAGG - Intergenic
926813770 2:16780158-16780180 CTGGCTCTGCTGGCAGGGTGGGG - Intergenic
927048479 2:19303621-19303643 ACTGCTCAGCAGGCAGGCTGGGG + Intergenic
927726948 2:25432896-25432918 GCAGCTCTGCCAGCAGCGTGGGG + Exonic
927792034 2:26017884-26017906 CCTGCTCTGCAGGAATAGGGGGG + Intergenic
927927459 2:27023878-27023900 CCTTCTCTACAGGCACCGTGTGG - Intronic
929382119 2:41365462-41365484 CCTGCTCTGTAAGCAGCCTTAGG - Intergenic
932420052 2:71596260-71596282 CCTGCTCGGGGGCCAGCGTGGGG + Intronic
932497505 2:72153635-72153657 CCTGCTGTCCAGGCTGGGTGGGG + Intergenic
932784706 2:74590030-74590052 CCTGGGCTGCATGCAGCCTGCGG + Intronic
935666690 2:105518534-105518556 CATGGTCTGCAGGCGGGGTGGGG + Intergenic
936252385 2:110876596-110876618 GCTTCTCCGCAGGCACCGTGGGG + Intronic
937979787 2:127608272-127608294 GCTGCTTTGCAGGCAGCTGGGGG - Intronic
938105843 2:128529242-128529264 CCTGCACTGCAGGCAACCAGGGG + Intergenic
939991018 2:148876469-148876491 CCTCCTCTCCACCCAGCGTGAGG - Intronic
940024168 2:149187818-149187840 CCTGGGCTGCATGCAGCCTGTGG + Intronic
941721038 2:168813212-168813234 CCTGCTCTGCAGGCAGAAGGTGG - Intronic
942388737 2:175469649-175469671 TCTGCTCTGCAGGCCTCTTGTGG + Intergenic
946614714 2:221497110-221497132 CCTGCTGTGGAGGCAGTTTGGGG + Intronic
948582865 2:238999723-238999745 CCTCCTCAGAAGGCAGAGTGGGG + Intergenic
948605681 2:239133267-239133289 GCTGCGCTGCAGGATGCGTGGGG - Intronic
948686587 2:239674362-239674384 CCTTCTCTGCAAGCAGTGGGTGG + Intergenic
948862296 2:240758487-240758509 CCGTCCCTGCAGGCAGCGTCTGG - Exonic
1168803909 20:661996-662018 ATTGCTCTGCAGCCAGCTTGGGG - Exonic
1168978412 20:1985202-1985224 CCTGCTCTGGCTACAGCGTGGGG - Intronic
1171798040 20:29581675-29581697 CCTGCTCTGCATGAAGGGTCAGG + Intergenic
1172997699 20:39083340-39083362 CCTGCTCTGCAGGGTCCCTGTGG - Intergenic
1173189505 20:40865302-40865324 CCTGCTCTGCAGGCCCCTTGGGG - Intergenic
1174055244 20:47794138-47794160 CCTGCTCTGGTGTCACCGTGGGG - Intergenic
1175413102 20:58784464-58784486 CCAGCTCCCCAGCCAGCGTGGGG + Intergenic
1175569732 20:60009748-60009770 ACTGCTCTGCTGTCAGCCTGGGG + Intronic
1176171176 20:63697043-63697065 CGTCCTCTGCGGGGAGCGTGAGG + Exonic
1178773166 21:35524659-35524681 CCTGCTCTGTACTCAGCATGGGG + Intronic
1179428860 21:41304625-41304647 CCCGGCCTGCAGGCAGCGGGTGG + Intronic
1180053510 21:45344862-45344884 CCTGCTCTGAAGGCGGCTGGAGG - Intergenic
1180222851 21:46370287-46370309 TCTGGTCTGCAGGCAGTGAGTGG + Intronic
1180657822 22:17438542-17438564 CCTGGGCTGCAGGCGGCCTGCGG - Intronic
1180843882 22:18971184-18971206 CCCGCCCTGGAGGCAGCGTTGGG - Intergenic
1181920435 22:26316371-26316393 CCTGCTAGGCATGCAGGGTGAGG - Intronic
1182996074 22:34813504-34813526 ACTGCACTGCAGCCAGCATGGGG + Intergenic
1183353973 22:37348802-37348824 GCTGCCCTGCTGGCAGCGTCCGG - Intergenic
1183383929 22:37504208-37504230 CATCCTCCGCCGGCAGCGTGAGG - Exonic
1183451251 22:37896572-37896594 CCTGCTCTGCAGGCAAAGGCAGG - Intergenic
1183697744 22:39432752-39432774 CCTGCTCTGCCCTAAGCGTGTGG + Intronic
1184925624 22:47634775-47634797 CAGGCTCTGCAGCAAGCGTGGGG - Intergenic
1185135698 22:49070909-49070931 CCTCATCAGCAGGCAGTGTGAGG - Intergenic
1185143340 22:49116204-49116226 CCTGCTGTGTAGGCTGCGGGCGG + Intergenic
1185222952 22:49638112-49638134 GCTGCCCAGCAGGCAGCGGGTGG - Intronic
950449532 3:13057889-13057911 CCTGAGCTGCAGGGAGCCTGGGG - Intronic
953919766 3:46943778-46943800 CTAGCTCTGCAGACAGCATGAGG + Intronic
955943439 3:64168451-64168473 CCTGGGCTGCATGCAGCCTGTGG + Intronic
956828925 3:73026614-73026636 CCTGGGCTGCATGCAGCCTGCGG - Intronic
959728127 3:109568876-109568898 CCAACTCAGCAGGCAGGGTGAGG + Intergenic
961360634 3:126365066-126365088 CCTCCTCTGCAGGCAGAGGTGGG - Intergenic
961646414 3:128395058-128395080 CCTGTGCTGCTGGCAGCATGGGG + Intronic
961816519 3:129553467-129553489 CCCGCACTGCAGGCTGCCTGGGG - Intergenic
962205057 3:133427569-133427591 CCTGCTCCTCAGCCAGCTTGGGG + Intronic
964344706 3:155744439-155744461 CCTGCTCTCCTGGCGGCGTCTGG + Intronic
964867983 3:161282567-161282589 CTTGCTGTGCAGGCAGCCGGGGG + Intergenic
967814465 3:193787435-193787457 CCTGCTCTGCAGACAGAGGGAGG + Intergenic
968502656 4:958285-958307 CCTGCTCAGCAGGCAGGTGGAGG - Exonic
968603245 4:1520281-1520303 GCTCCTCTGCAGTCAGCGTGGGG + Intergenic
968618751 4:1594094-1594116 GCTGCCCTGCTGGCAGCCTGGGG - Intergenic
969300551 4:6294656-6294678 CCTCCTCTTCAGCCAGCGTGGGG - Intronic
969578626 4:8050976-8050998 CCTCCTCTGCTGGCAGCATCCGG + Intronic
969686075 4:8674992-8675014 TCTGCTCTACAGCCAGCTTGGGG + Intergenic
971405927 4:26320849-26320871 CCTACTCTGCGGGCGGCGCGAGG + Intronic
978105806 4:104900513-104900535 CCTCCACAGCAGGCAGCCTGTGG + Intergenic
978348633 4:107798189-107798211 ACTGAACTGCAGGCAGCCTGGGG + Intergenic
979524266 4:121701264-121701286 CCTGGTATGCAGGCAGAGTAGGG - Intergenic
983792417 4:171813833-171813855 GCTCCTCTGCAGGCAGCGGCTGG - Exonic
983833272 4:172358417-172358439 CATGGCCTGCAGGCCGCGTGCGG + Intronic
985929698 5:3047310-3047332 GCTGTGCTGCAGGCAGGGTGAGG + Intergenic
986030984 5:3892316-3892338 CATGCTCTGCAGTCAGGGTTTGG + Intergenic
986674252 5:10169268-10169290 CCTGAGCTGCAGGCACTGTGGGG - Intergenic
987257449 5:16170858-16170880 ACTGCACTGCAGACAGCCTGGGG + Intronic
988776215 5:34480108-34480130 CCTGCTCCCCAGGGAGGGTGGGG + Intergenic
995191627 5:109324262-109324284 CCTGGGCTGCATGCAGCCTGTGG - Intergenic
996606233 5:125326864-125326886 CCTGGGCTGCATGCAGCCTGTGG - Intergenic
997549463 5:134739016-134739038 AGAGCTCTGCAGGCAGGGTGGGG - Intronic
998137022 5:139679201-139679223 CCTACTCTGCAGGCCTTGTGAGG + Intronic
998169607 5:139864802-139864824 CCTGCTCCGAAGGCTGCCTGAGG - Intronic
999343751 5:150796444-150796466 CCAGCTCTGCAGCCAGCCTATGG + Exonic
999573984 5:152953445-152953467 CCTGCTGTGCAAGCAGGGTCTGG - Intergenic
1002575531 5:180171843-180171865 CCTGCTCGGCAGCCAGGGTGTGG + Intronic
1003874791 6:10425986-10426008 GCTGCTCTGCACGCAGCTGGAGG + Intergenic
1004895409 6:20143125-20143147 TGTTCTCTGCAGGCAGCCTGAGG - Intronic
1005111868 6:22290945-22290967 ACTGCTCTGCCAGCAGCATGGGG - Intronic
1006454384 6:34123582-34123604 CCAGCTCTGGAGGCGGCATGTGG - Intronic
1006460548 6:34155183-34155205 CCTGCTCTCCTGGCAGGGAGGGG + Intronic
1011342846 6:86336454-86336476 CCTTCTCTACAGGCAGCAGGAGG - Intergenic
1012836832 6:104280144-104280166 CCTTCTCTGCAGGCTCCCTGTGG + Intergenic
1013279339 6:108621216-108621238 CTAGCTCTGCAGGCAGAGCGAGG - Intronic
1016802783 6:148183441-148183463 CTTGCTTTGCAGTCAGTGTGAGG - Intergenic
1017911384 6:158795931-158795953 CCTGATCTGCAGGTAGAGTTTGG + Intronic
1018091164 6:160348033-160348055 CCTGCTCTGCAGTCAGCCCCAGG - Intergenic
1018803362 6:167240104-167240126 CCTGCTCTGAAGGCTGCCAGAGG + Intergenic
1018888954 6:167966989-167967011 CCTGCTCTACAGTCAGCATAGGG - Intronic
1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG + Intergenic
1019319423 7:408886-408908 CCTGCTCTGCACCACGCGTGGGG + Intergenic
1019643843 7:2118685-2118707 CCTGCCATGGAGGCAGTGTGTGG - Intronic
1020719607 7:11724841-11724863 CCTGCTGTGGAGGCTGAGTGTGG + Intronic
1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG + Intergenic
1022593180 7:31686073-31686095 CCTGCTCTGCAGGGAACCTCAGG + Intergenic
1022826614 7:34020803-34020825 CCTGCTTTGCAGGCAGCATGGGG + Intronic
1023856779 7:44188953-44188975 TCTGCACAGCAGCCAGCGTGGGG + Intronic
1024064681 7:45722386-45722408 GATGCTCTGCAGCCAGCGGGCGG - Exonic
1024537608 7:50450781-50450803 CCTGTGCTGCAGGCAGGGAGCGG + Intronic
1024676871 7:51645260-51645282 CCTGATGTGCACGCAGCGTTGGG + Intergenic
1024775259 7:52777419-52777441 CCTCCTCTCCAGGCACAGTGTGG + Intergenic
1024997802 7:55287219-55287241 CCTTCTCTTCAGGCTGGGTGTGG + Intergenic
1025237744 7:57246000-57246022 CCTGCTCTGGTGTCACCGTGGGG + Intergenic
1026776823 7:73235652-73235674 CCTCCTCTGCGGGCAGAGAGCGG - Intergenic
1027017672 7:74789022-74789044 CCTCCTCTGCGGGCAGAGAGCGG - Exonic
1027070350 7:75156910-75156932 CCTCCTCTGCGGGCAGAGAGCGG + Intergenic
1029573471 7:101387036-101387058 CCTGCTTTGCTGACAGCGGGTGG + Intronic
1030567622 7:111179293-111179315 CCTGGGCTGCATGCAGCCTGTGG - Intronic
1031288288 7:119900365-119900387 CAAGCTCTGCAGTCAGCATGTGG + Intergenic
1033028834 7:137805374-137805396 CCTTCCCTGCAGACAGCGTAAGG - Intronic
1033223077 7:139541673-139541695 CCTGATTTGCAGGAAGCTTGGGG - Intronic
1033532555 7:142279849-142279871 CATGCTTTGCAGGCAGCTGGTGG - Intergenic
1033756662 7:144402217-144402239 CCTGCTTTGCAGGGAGGGGGAGG - Intronic
1034339029 7:150340691-150340713 CCTGCTCTGGGGGGAGGGTGGGG + Exonic
1034514842 7:151567824-151567846 CCTGCCCTGGAGGCAGCTTGAGG - Intronic
1035767037 8:2114393-2114415 GCTGCACTGCAGGCAGGGAGGGG + Intronic
1036709338 8:11068257-11068279 CCTCCTCTAGAGGCAGCCTGGGG + Intronic
1037329596 8:17731290-17731312 CCTGCTCACTAGGCAGTGTGAGG - Intronic
1037733111 8:21545765-21545787 TCTACTCTGCAGACAGGGTGGGG - Intergenic
1039819705 8:41124842-41124864 CCTGGTCTGCATGCAGCCTGCGG - Intergenic
1041527514 8:58823774-58823796 CCTGCTCTGGATGCAGAGTATGG + Intronic
1041984870 8:63909572-63909594 CCTGGGCTGCACACAGCGTGGGG + Intergenic
1042877314 8:73451057-73451079 CAGGCTTTGCCGGCAGCGTGTGG - Intronic
1046092788 8:109522968-109522990 CCTGGTGTGCTGGCAGCCTGAGG + Intronic
1048136403 8:131750560-131750582 CCTGGGCTGCATGCAGCCTGTGG - Intergenic
1048317661 8:133374316-133374338 CCTGCTCTGCAGGCAGGGGTGGG + Intergenic
1048987533 8:139742734-139742756 TCTGATCTGCAGGCTGGGTGGGG + Intronic
1049032475 8:140047923-140047945 CCTGCCTTGCTGGCAGCTTGTGG - Intronic
1049467134 8:142756753-142756775 ACTTCTCTGCTGGCTGCGTGGGG - Intergenic
1049695676 8:143983338-143983360 GCAGCTCTGCAGGCAGTGTGCGG + Exonic
1049808588 8:144552928-144552950 CATGCTCTGGGGGCAGAGTGGGG + Intronic
1051663208 9:19444572-19444594 CCTGGTCGGCATGCAGCCTGTGG + Intronic
1053787976 9:41665779-41665801 CCTGCTCTGCATGAAGGGTCAGG - Intergenic
1054157156 9:61648989-61649011 CCTGCTCTGCATGAAGGGTCAGG + Intergenic
1054176252 9:61877121-61877143 CCTGCTCTGCATGAAGGGTCAGG - Intergenic
1054476931 9:65579994-65580016 CCTGCTCTGCATGAAGGGTCAGG + Intergenic
1054661287 9:67703687-67703709 CCTGCTCTGCATGAAGGGTCAGG + Intergenic
1056578398 9:87872760-87872782 CCTGCTCAGGAGGCAGCATCAGG - Intergenic
1056795938 9:89659047-89659069 CCTGCTGCCCAGGTAGCGTGAGG + Intergenic
1057268428 9:93633816-93633838 CCAGCACTGCTGGCAGGGTGGGG - Intronic
1057824615 9:98362753-98362775 CCTGATCTGCTGGCAGGCTGTGG - Exonic
1057842149 9:98495015-98495037 GCTGCTCTGCAGGAAGCATCTGG - Intronic
1059285712 9:113169750-113169772 CCTGCTCTGAGGGCACCATGGGG + Exonic
1060802081 9:126551236-126551258 CCTCCTCTGCAGGAAGGCTGCGG - Intergenic
1060983620 9:127807574-127807596 CCTCCCCTGCAGGAAGCCTGTGG + Exonic
1061762029 9:132857776-132857798 CCTGCTGTGCAGGCTGCAGGGGG - Intronic
1061926022 9:133806453-133806475 CGGGCTCTGCAGACAGCGTGGGG + Intronic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1061937653 9:133867146-133867168 CCGGCTCTGCAGGGAGCGCCGGG - Intronic
1062037079 9:134387116-134387138 CCTTCTCTGCAGGGAGTGAGGGG + Intronic
1062292756 9:135804573-135804595 AGTGCTCTGCAGGGAGGGTGTGG + Intergenic
1062498025 9:136840714-136840736 CCTGCTCTGCAAGAAGGGAGGGG + Exonic
1062564826 9:137159508-137159530 CCTGCTCTGCAGACAGGGTGGGG + Intronic
1188537796 X:31216601-31216623 CTTGCTGTGGAGGCAGCCTGTGG + Intronic
1188615498 X:32153855-32153877 TCTGCCATGGAGGCAGCGTGAGG - Intronic
1189325228 X:40107623-40107645 CCGCCTCTGCAGGCAGCCTGGGG + Intronic
1192234996 X:69289955-69289977 CCTGCTCTCCTGGCAGGGCGAGG + Intergenic