ID: 1161456115

View in Genome Browser
Species Human (GRCh38)
Location 19:4370485-4370507
Sequence CCTGCATCAGGGTGGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 377}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161456105_1161456115 -4 Left 1161456105 19:4370466-4370488 CCACCCTCCGCTGACTGAACCTG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG 0: 1
1: 0
2: 3
3: 35
4: 377
1161456099_1161456115 26 Left 1161456099 19:4370436-4370458 CCAGGGACCCAACAGGGCTCAGG 0: 1
1: 0
2: 3
3: 32
4: 300
Right 1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG 0: 1
1: 0
2: 3
3: 35
4: 377
1161456106_1161456115 -7 Left 1161456106 19:4370469-4370491 CCCTCCGCTGACTGAACCTGCAT 0: 1
1: 0
2: 1
3: 2
4: 91
Right 1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG 0: 1
1: 0
2: 3
3: 35
4: 377
1161456103_1161456115 19 Left 1161456103 19:4370443-4370465 CCCAACAGGGCTCAGGGGTGAGA 0: 1
1: 0
2: 1
3: 18
4: 191
Right 1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG 0: 1
1: 0
2: 3
3: 35
4: 377
1161456104_1161456115 18 Left 1161456104 19:4370444-4370466 CCAACAGGGCTCAGGGGTGAGAC 0: 1
1: 0
2: 1
3: 18
4: 143
Right 1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG 0: 1
1: 0
2: 3
3: 35
4: 377
1161456107_1161456115 -8 Left 1161456107 19:4370470-4370492 CCTCCGCTGACTGAACCTGCATC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG 0: 1
1: 0
2: 3
3: 35
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161456115 Original CRISPR CCTGCATCAGGGTGGCAGGG TGG Intronic
900002368 1:21764-21786 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
900022087 1:192288-192310 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
902177281 1:14660109-14660131 CCTGCTTCAGTGGGGCTGGGAGG + Intronic
904631655 1:31847341-31847363 GCTGGAGCAGAGTGGCAGGGAGG + Intergenic
904830050 1:33300512-33300534 TCTGCATCTTGGAGGCAGGGAGG + Exonic
905270708 1:36785710-36785732 CCTGTTTCAGGGTTGCAGAGTGG + Intergenic
906449647 1:45934068-45934090 CCTACATCAGGGTGGAGGGTGGG - Intronic
907928093 1:58973521-58973543 CATGCTTCAGGGTGTCAGAGGGG + Intergenic
907933617 1:59022279-59022301 CCTGGATCAGGTGGTCAGGGTGG + Intergenic
911179336 1:94847351-94847373 CCTTGAGGAGGGTGGCAGGGAGG + Intronic
913671229 1:121098328-121098350 CCGGCATTAGGTTGGGAGGGTGG + Intergenic
914022999 1:143885749-143885771 CCGGCATTAGGTTGGGAGGGTGG + Intergenic
914661486 1:149793691-149793713 CCGGCATTAGGTTGGGAGGGTGG + Intronic
915362438 1:155294337-155294359 ACGGCATCATGGTGGCACGGGGG - Exonic
915601571 1:156925729-156925751 CTTGCTTCATGGTGGCGGGGGGG + Intronic
916298597 1:163248336-163248358 ACTCCATCAGGGTGTCATGGAGG + Intronic
917067243 1:171110379-171110401 CCTGCAGCACTGTGACAGGGTGG + Intronic
917731076 1:177875666-177875688 CCTTCAGCAGGGTGGCACTGGGG - Intergenic
918981742 1:191570369-191570391 CCTACTTGAGGGTGGGAGGGTGG + Intergenic
920032885 1:203048139-203048161 CCTGCACCCTGGTGCCAGGGTGG - Intronic
920334864 1:205238291-205238313 TCTGCATGTGGGTGTCAGGGAGG - Intronic
920416328 1:205801249-205801271 CCTGGTTCTGGGTGGCAGGAAGG - Intronic
920555998 1:206905057-206905079 CCTCCATCATGGCGGCAGGCTGG + Exonic
921053335 1:211526600-211526622 CTTGCATCATGGTGGCTGGCTGG - Intergenic
921185308 1:212665275-212665297 CCTGCGTCAGGGAGCCAGGAGGG - Intergenic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
923028462 1:230226183-230226205 GCTGCATCAGGCTGCCAGGATGG + Intronic
923540042 1:234882063-234882085 CCTGCCTGAGGGTGGGAGGCTGG - Intergenic
924324181 1:242878726-242878748 TATGCAAGAGGGTGGCAGGGAGG + Intergenic
924326631 1:242901332-242901354 CCTGCTTCAGGGGAGAAGGGTGG - Intergenic
924380754 1:243462103-243462125 CCTGCATCAGTGTAGCACAGAGG + Intronic
924415022 1:243849940-243849962 CCCGCCTGAGGGAGGCAGGGAGG + Intronic
1063207960 10:3853099-3853121 TCTGCAGGAGGGTGGCAGCGTGG + Intergenic
1063973345 10:11396656-11396678 CGTGCCTGAGGGTGGCAGAGTGG + Intergenic
1063976163 10:11417493-11417515 CTTGAACCCGGGTGGCAGGGAGG - Intergenic
1065287822 10:24202468-24202490 CCTGCATCAGGGTGACCTGCAGG + Intronic
1066687100 10:37991736-37991758 GCTGTGTCAGGGTGGCAGGGTGG + Intergenic
1067033629 10:42897756-42897778 GCCGCATCAGGGTGGCCGCGGGG - Intergenic
1069546200 10:69330635-69330657 TCTGCATCAGGGAAGAAGGGAGG - Intronic
1069814429 10:71184653-71184675 CCTTCATCAGGGTGGTCAGGAGG + Intergenic
1070848494 10:79543279-79543301 CCTGCATTAGGGTGGTTTGGAGG + Intergenic
1070925291 10:80216894-80216916 CCTGCATTAGGGTGGTTTGGAGG - Intergenic
1071470190 10:85978789-85978811 CCTGCACCTGGATGGCTGGGAGG - Intronic
1073192063 10:101658535-101658557 ACTTCGTCTGGGTGGCAGGGGGG + Intronic
1075689923 10:124387828-124387850 CCTGCTTCAGGGGAGAAGGGAGG - Intergenic
1075723113 10:124598667-124598689 ACTGCATCAGGGTGGACAGGTGG - Intronic
1075723166 10:124598887-124598909 GCTGCATCAGGGTGGATGGGTGG - Intronic
1075723208 10:124599063-124599085 ACTGCATCAGGGTGGATGAGTGG - Intronic
1076721554 10:132395563-132395585 CCTGGAGCAGGGTGGCGAGGGGG + Intergenic
1077117909 11:893618-893640 CCTGCTGCAGGGTGTCAGGCTGG - Intronic
1080446572 11:32343435-32343457 CTTGCTTCAGGGTGGCAAGATGG - Intergenic
1080685205 11:34509607-34509629 CCTGAGTGAGGGGGGCAGGGAGG + Intronic
1081535662 11:43994394-43994416 GCTTCATCAGGGTGTCAGTGTGG + Intergenic
1081543258 11:44051422-44051444 CCTCCACCAGGGTGGCAGCAAGG - Intronic
1081712862 11:45228697-45228719 TCTGCATTTGGGAGGCAGGGGGG + Intronic
1084297834 11:68224721-68224743 CCTGCACCTGAGTGGCATGGAGG - Intergenic
1085259808 11:75198026-75198048 CCAGCATGAGGGTGGGAGGTGGG - Intronic
1086597022 11:88585005-88585027 CCTGCTTCAGGGGTGAAGGGTGG - Intronic
1088972639 11:114787257-114787279 CCTGCATGAGCTTGGGAGGGTGG - Intergenic
1089475630 11:118759063-118759085 TTTGTCTCAGGGTGGCAGGGGGG - Intronic
1090975919 11:131679812-131679834 CCTGCATCAGGGTGACTGGGAGG - Intronic
1091375786 12:23826-23848 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
1091767410 12:3130573-3130595 CCTGGGGCAGGGTGGCAGAGTGG + Intronic
1092432440 12:8420260-8420282 CCTGCAGCAAGGTGGGGGGGGGG + Intergenic
1092894576 12:13000191-13000213 CCGGCGGCAGGGCGGCAGGGCGG + Exonic
1094436158 12:30422982-30423004 CTTGGACCAGGGTGGCAGTGAGG - Intergenic
1095663396 12:44764999-44765021 CCTGAATCAGTGTTTCAGGGTGG - Intronic
1096843608 12:54393306-54393328 CCTGGGGCAGTGTGGCAGGGTGG - Intergenic
1100251584 12:92830321-92830343 CCTGCTTGAGGGTGGAAGGTGGG - Intronic
1101897273 12:108766146-108766168 CCTGGATCAGAGTGGGATGGTGG - Intergenic
1102805133 12:115773150-115773172 GATGTATCAGGTTGGCAGGGAGG + Intergenic
1103145361 12:118590647-118590669 GCTGCATCAGGGTGGTGGGTGGG + Intergenic
1103309462 12:119992959-119992981 ACTCCATCTGGGGGGCAGGGTGG - Intronic
1103476543 12:121222921-121222943 CAAGCACAAGGGTGGCAGGGGGG - Intronic
1103530061 12:121594988-121595010 CATGAATAAGGGTGGCAGTGTGG - Intergenic
1104791194 12:131483161-131483183 CCTGCTTCAGGCAGGCAGGCAGG - Intergenic
1104934751 12:132358483-132358505 CCTGCATGAGGCAGGCAGTGCGG - Intergenic
1105378018 13:19863054-19863076 CCGGCGGCAGGGTGGCAGCGCGG + Intronic
1105456054 13:20542180-20542202 CCTGCAGGATGGTGGCAGTGAGG + Intergenic
1106461460 13:29973992-29974014 CCTGCCACAGAGTGGCAGTGGGG + Intergenic
1106475746 13:30096666-30096688 CCTCCATCAATGGGGCAGGGAGG - Intergenic
1108057588 13:46499816-46499838 CCTTCACAAGGTTGGCAGGGTGG + Intergenic
1108883170 13:55146375-55146397 CCTGCTTCAGGGAGGAAGGCTGG + Intergenic
1108943984 13:55998412-55998434 CCTGCAGCTGGGTCCCAGGGCGG - Intergenic
1109219257 13:59624956-59624978 CCTGCTTCAGGGGAGAAGGGTGG + Intergenic
1110321082 13:74160739-74160761 ACTGCATGAGGTTAGCAGGGAGG + Intergenic
1111033169 13:82633659-82633681 ACTGCATCCAAGTGGCAGGGAGG + Intergenic
1112129825 13:96510449-96510471 CCAGCACCAGGCTGGAAGGGTGG - Intronic
1113800853 13:113085645-113085667 CTGGCATCAGGGTGGCAGGAGGG + Intronic
1113800871 13:113085702-113085724 CTGGCATCAGGGTGGCAGGAGGG + Intronic
1113800889 13:113085759-113085781 CTGGCATCAGGGTGGCAGGAGGG + Intronic
1113800907 13:113085816-113085838 CTGGCATCCGGGTGGCAGGAGGG + Intronic
1113800926 13:113085873-113085895 CTGGCATCCGGGTGGCAGGAGGG + Intronic
1113860931 13:113486341-113486363 CCTGCTTGAGGGTGGCAGGAGGG + Intronic
1114670402 14:24408009-24408031 CCACCATCAGGGAGCCAGGGGGG - Exonic
1116591429 14:46780986-46781008 ACTCCAGCAGGTTGGCAGGGTGG - Intergenic
1117326981 14:54678336-54678358 CCTGCCTCAGGGGAGAAGGGAGG + Intronic
1118216808 14:63816526-63816548 CCTGCTTCAGGGAAGAAGGGTGG - Intergenic
1118321634 14:64756925-64756947 CCTGGATCACCGTAGCAGGGAGG + Intronic
1118719682 14:68585310-68585332 CCTGCTTCACCATGGCAGGGAGG + Intronic
1118753186 14:68821147-68821169 CCTGGATCAGGGTGACTGGGAGG - Intergenic
1119385127 14:74253218-74253240 CCTGCGTCAAGGTGCCAGCGAGG - Intronic
1119431064 14:74568208-74568230 CCTGCACAAGGGTGCCAGGCAGG - Intronic
1121173147 14:91870997-91871019 CCTGCTTCAGGGTGGGAGGCAGG + Intronic
1121564247 14:94896704-94896726 ACTGCAGGAGAGTGGCAGGGTGG - Intergenic
1121993881 14:98586583-98586605 CCTCCATCAGGGTTCCAGAGAGG + Intergenic
1122623727 14:103073857-103073879 CCCGCATCATGGCTGCAGGGTGG - Intergenic
1122873484 14:104652006-104652028 CCTGCAGGAGGGGAGCAGGGGGG - Intergenic
1123028011 14:105437730-105437752 CCTGCATCAGCTCCGCAGGGGGG - Intronic
1123814011 15:23958100-23958122 CCTACCTCAGGGTGGAAGGTGGG - Intergenic
1124007460 15:25806174-25806196 GCTGCCTCAGGGTGGCAGAGAGG - Intronic
1124389848 15:29244595-29244617 CCTGGATCAGGGAAGCAGCGTGG + Intronic
1124392285 15:29269848-29269870 CTTGCGTCAGGGCGGCTGGGCGG + Intronic
1124470310 15:29978304-29978326 TCTGCATCTGGGTGGCAGAAAGG - Intergenic
1124613143 15:31222936-31222958 GCTGCCTCAGGGTGGCAGAGAGG + Intergenic
1126671639 15:51120819-51120841 CCTGCATCAGGAGAGGAGGGTGG + Intergenic
1128380314 15:67107472-67107494 ACTGCATCAGGAGGGCAGGAGGG - Intronic
1129597344 15:76975147-76975169 GATGCAGGAGGGTGGCAGGGAGG - Intergenic
1129649011 15:77466674-77466696 CATGCAGCATTGTGGCAGGGAGG - Intronic
1129747889 15:78037625-78037647 GATGCAGCAGGGTGGGAGGGAGG + Intronic
1130285707 15:82552800-82552822 CCTTCACCAGGGTGGGAGGGAGG - Intronic
1130368643 15:83263872-83263894 CCTGAACCAGGGTAGCTGGGAGG + Exonic
1131374231 15:91910309-91910331 CCTGCAACAGGGTAACAGAGTGG - Intronic
1131839886 15:96425786-96425808 CATCTGTCAGGGTGGCAGGGAGG + Intergenic
1132237358 15:100232275-100232297 CCTGCAGCATGGAGCCAGGGTGG + Intronic
1132376189 15:101329824-101329846 CCTGCAAGAGAGTGGCTGGGAGG - Intronic
1132451144 15:101969175-101969197 CCTGCACAGGGGTGGGAGGGGGG + Intergenic
1132801691 16:1757826-1757848 CCTGCATCATGGGGGCTGCGGGG + Intronic
1133873434 16:9710925-9710947 GCTGAATCAAGGTGACAGGGAGG + Intergenic
1134084717 16:11348561-11348583 CTGCCATCAGGGAGGCAGGGAGG + Intronic
1135134261 16:19876096-19876118 CCAGCCCCAGGGTGGCTGGGAGG + Intronic
1136089110 16:27905730-27905752 CATTCATCTTGGTGGCAGGGCGG + Intronic
1136235453 16:28910980-28911002 CCTGCATCTGGGTTGGAGGGAGG + Exonic
1137603755 16:49773846-49773868 CCTGCTTGAGGGAGGCAAGGAGG + Intronic
1137772772 16:51030369-51030391 CCTGCATCAATATGGCAGGAAGG - Intergenic
1138492120 16:57382840-57382862 CCTGCCTCCGGGTGGCAGCCTGG - Exonic
1138623624 16:58231836-58231858 CCTTCATCAGGTTTCCAGGGAGG - Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139924445 16:70478473-70478495 CCAGCATGAGGGAGGCAGGCAGG + Intronic
1140125039 16:72111703-72111725 CATGCATCAGTGTGCCACGGGGG - Intronic
1140449259 16:75057171-75057193 CATGCAGCAGGACGGCAGGGTGG - Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1141158133 16:81610946-81610968 CCTGCTCCAGGGTGGGAGAGGGG + Intronic
1141693196 16:85607846-85607868 CCTGCTCCAGAGTGGCAGTGGGG - Intergenic
1142072686 16:88099831-88099853 CCTGCTTCAGGGTAGCAAAGGGG + Intronic
1142742802 17:1940810-1940832 GCTCCCTCAGGGTGGCAGAGCGG - Intronic
1142848761 17:2694415-2694437 CCTGCAGCAGGGACGCAGCGGGG + Intronic
1144438096 17:15259216-15259238 CCTGAGTCAGGGAGGGAGGGAGG + Intronic
1144704035 17:17355689-17355711 CCTGCAGCAGGGAGGCAGTGTGG + Intergenic
1144874625 17:18390971-18390993 CCTGGACCAGGGTGGGAAGGAGG - Intergenic
1145157738 17:20554081-20554103 CCTGCACCAGGGTGGGGGAGGGG - Intergenic
1146277300 17:31523871-31523893 CCTGCAGCAGGGGGCCGGGGTGG - Exonic
1146473908 17:33146389-33146411 CCAGAATCAAGGTGGCAGAGTGG + Intronic
1147566460 17:41539249-41539271 CCAGCACCAGGGAGGCACGGGGG + Intergenic
1148081042 17:44967850-44967872 CCTGCACCAGCGTGGAAGGCGGG + Exonic
1150645445 17:66974952-66974974 ACGGCGTCAGGGTGGGAGGGAGG - Intronic
1151457077 17:74232647-74232669 CAGGCAGCAGGATGGCAGGGAGG - Intronic
1151892271 17:76957785-76957807 CCAGCATCAGGGTGCCAGCAGGG - Intergenic
1152079588 17:78178435-78178457 CCTTCCTCAGGATGGCACGGTGG + Intronic
1152549838 17:81023781-81023803 CCTGCATCTGGGTGGTTGGCAGG - Intergenic
1152610712 17:81313890-81313912 CCTGCAGCAGGGTGGGGGGCCGG + Exonic
1153229303 18:2921164-2921186 CCTGCAGAAGGGAGGCAGGTTGG + Intronic
1154096208 18:11417411-11417433 CCTGCATCCTGTTGGCAGTGTGG - Intergenic
1154420249 18:14222938-14222960 CCTGCATCTGGGAGGAAGTGAGG + Intergenic
1155202887 18:23533034-23533056 CCTTCATCTCAGTGGCAGGGAGG + Intronic
1157223021 18:45840558-45840580 CCTTCAGCAGAGTGCCAGGGGGG - Intronic
1158851269 18:61497511-61497533 CCTCCAGGAGGGTGGCAGAGAGG - Intronic
1159458612 18:68694173-68694195 CCTGCAACATGGTGACTGGGGGG - Intronic
1160030169 18:75250444-75250466 CCTGCAGCAAGGGGCCAGGGTGG + Intronic
1160634120 19:63372-63394 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
1160739708 19:680174-680196 CCTGCAGAAGGGGCGCAGGGAGG + Intronic
1160741713 19:689294-689316 GCTGGAACAGGGTTGCAGGGAGG + Intronic
1160841253 19:1147889-1147911 CCATCCTCAGGGTGACAGGGCGG - Intronic
1160865078 19:1252787-1252809 CCTACATCGCGGGGGCAGGGCGG + Intronic
1160865849 19:1255639-1255661 CCTGCAGCAGGGAGGCTGAGGGG - Exonic
1161309672 19:3586670-3586692 CCTTCATCAAGGTGCCCGGGAGG + Exonic
1161353083 19:3804420-3804442 CCTACATCAGGGAGAGAGGGAGG + Exonic
1161411185 19:4118424-4118446 GCTGCATCAGGTAGGCACGGTGG + Intronic
1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG + Intronic
1162147707 19:8623057-8623079 CCAGCCTCTGGGTGGCAGAGTGG - Intergenic
1162519964 19:11173969-11173991 CCTCCATCAGCCTGGGAGGGTGG + Intronic
1162520008 19:11174136-11174158 CCTCCATCAGCCTGGGAGGGTGG + Intronic
1162520016 19:11174164-11174186 CCTCCATCAGACTGGGAGGGCGG + Intronic
1164509288 19:28884414-28884436 CCTGCTTGAGGGTGGAAGGTGGG - Intergenic
1165077651 19:33289750-33289772 ACTGAATCAGGGTGGGAGAGAGG - Intergenic
1165092558 19:33394623-33394645 CTTGCACTAGGCTGGCAGGGTGG + Intronic
1165472836 19:36013462-36013484 GCTGCATCATGGTGTTAGGGCGG - Intronic
924998457 2:385236-385258 GCTGCCTCAGGGTGGCTGGCTGG - Intergenic
925809241 2:7682725-7682747 CCTGCATGTGGGTGGGTGGGTGG + Intergenic
925886994 2:8401775-8401797 CCTGCACCAGGCCTGCAGGGAGG + Intergenic
926128171 2:10284578-10284600 CCCGCACCAGGATGGCAGAGGGG - Intergenic
926663167 2:15491180-15491202 CCTGCTTCATGGAGGAAGGGTGG - Intronic
927246330 2:20959663-20959685 GCAGCATCAGGGTGCCAGGGAGG - Intergenic
927544751 2:23942704-23942726 CCTGCATCAGCCGGGCACGGTGG - Intronic
929484018 2:42338952-42338974 CCTGCATCAGAGCGCCAGGAAGG + Intronic
929552399 2:42902960-42902982 CCTGCCTCATGGTGGCCAGGAGG + Intergenic
929917517 2:46148407-46148429 CCTGGAGTGGGGTGGCAGGGCGG + Intronic
930872998 2:56185657-56185679 CCTAGAAGAGGGTGGCAGGGGGG - Intronic
931576743 2:63725199-63725221 CCTGCTGGAGGGTGGAAGGGTGG - Intronic
931837128 2:66110861-66110883 AGTACATCAGGGTGGGAGGGTGG + Intergenic
934058202 2:88270106-88270128 GCTGCATCAGGGTGGCAACTGGG + Intergenic
935707619 2:105870366-105870388 ACTGCCACAGGATGGCAGGGAGG - Intronic
936567359 2:113591656-113591678 CCTGCACAGGGGTGGGAGGGGGG + Intergenic
937911491 2:127077806-127077828 CCTCCATCAGGGCGGCAGAAAGG + Intronic
938299965 2:130203377-130203399 CCTGGAGCAAGCTGGCAGGGCGG - Intergenic
938456749 2:131471112-131471134 CCTGGAGCAAGCTGGCAGGGCGG + Intronic
939849577 2:147288384-147288406 AATGAATCAGGGTGGTAGGGAGG + Intergenic
939950100 2:148460579-148460601 CCTGCCTCAGGGTGGCATTGAGG + Intronic
942053662 2:172163105-172163127 CCTGCATCACTGCTGCAGGGAGG - Intergenic
943777815 2:191786086-191786108 CATGCAAGAGGGTGGCATGGCGG - Intergenic
943864432 2:192910641-192910663 TCAGCTTCAGGGTGGCAGGAAGG + Intergenic
945013713 2:205491896-205491918 GCAGCATCAGGATGGCTGGGGGG + Intronic
946133170 2:217623199-217623221 TCTGCATCAGGGTATCAGGTAGG + Intronic
946170425 2:217892179-217892201 CTTGAATCTGGGAGGCAGGGAGG - Intronic
946180673 2:217947162-217947184 CCTGCATTGGGGTGGGAGGGAGG - Intronic
947110032 2:226708596-226708618 CCTACATCAAGGTGTCAGGAAGG - Intergenic
947737724 2:232465304-232465326 CTTGCACCAGGGTGGTGGGGAGG + Intergenic
947780576 2:232757530-232757552 CATGCATCTTGGTGGCATGGTGG + Intronic
947968591 2:234302782-234302804 CCTGCATGAAGGAGCCAGGGGGG - Intergenic
948217272 2:236240965-236240987 CCTGCATCTGGCAGCCAGGGAGG - Intronic
948271106 2:236673940-236673962 CCTGCACCAGGGTACCTGGGAGG + Intergenic
948280740 2:236746102-236746124 CCAGCATGAGGGTGGCCAGGTGG + Intergenic
948541192 2:238692382-238692404 CCTGCATCAGGCAGGCACTGAGG - Intergenic
948599792 2:239101663-239101685 CCTGGTTCAGGGTGGCTGGGAGG + Intronic
948602776 2:239116741-239116763 TCGGGAGCAGGGTGGCAGGGAGG - Intronic
948750574 2:240130052-240130074 GCTCCATCAGGATGACAGGGTGG + Intronic
948836717 2:240629455-240629477 CCTGCAGCCGGGTGCCAGGAGGG + Intronic
1169075184 20:2755834-2755856 CCTGCCACAGTGAGGCAGGGTGG - Intronic
1169075188 20:2755838-2755860 CCTGCCTCACTGTGGCAGGAAGG + Intronic
1169586765 20:7094595-7094617 CCTGCCGCTAGGTGGCAGGGTGG - Intergenic
1170155692 20:13267298-13267320 CCTGTGTCTGGGGGGCAGGGCGG + Intronic
1170541040 20:17388253-17388275 GAAGCTTCAGGGTGGCAGGGAGG + Intronic
1171981798 20:31633736-31633758 CCTTTTTCAGGGTGGCTGGGAGG - Intergenic
1172187750 20:33041857-33041879 CCTGCATCAGGGAGGCGTTGGGG + Intronic
1173193755 20:40896710-40896732 CAGGCAACAGGGTGGCATGGAGG + Intergenic
1173294735 20:41747032-41747054 CCTTGATGAGGGTGGCTGGGAGG + Intergenic
1173334314 20:42100607-42100629 CCTGGATGAGGAAGGCAGGGAGG + Intronic
1173648216 20:44646758-44646780 TTAGAATCAGGGTGGCAGGGTGG - Intronic
1174483249 20:50845603-50845625 CCTGCCTCAGGGGGGCAGTGGGG - Intronic
1175881969 20:62264675-62264697 CCGGCATCAGGGGAGCTGGGTGG - Intronic
1176088614 20:63309191-63309213 CCAGCATGTGGGTGGCAGGTGGG + Intronic
1179196821 21:39171822-39171844 CCAGCATCAGGGTGACCAGGGGG + Intergenic
1180074744 21:45456738-45456760 CTGGCAGCAGGGTGGCGGGGCGG - Intronic
1180965303 22:19785006-19785028 GCTGCGTCAGGGTGGCAGCGCGG - Exonic
1181410104 22:22712577-22712599 CCTGCTGCAGGGTGGGAGGCTGG + Intergenic
1181547047 22:23608018-23608040 CCTGCAGCAGTGGGACAGGGTGG + Intergenic
1182517024 22:30864774-30864796 CCTGAAGCAGGGTGGAAGGATGG - Intronic
1182572265 22:31248313-31248335 CCTGAATGAGGGAGGGAGGGAGG - Intronic
1182684055 22:32107156-32107178 CCTGCCCCAGGGAGGCAGGAAGG - Intronic
1183295846 22:37029194-37029216 CCTACAGCAGGGGAGCAGGGAGG - Exonic
1183305720 22:37082052-37082074 ACTGCATCAGGGAGGGAGGAGGG + Intronic
1183639798 22:39085969-39085991 CCTGGATCAGGGTGGGTGCGGGG - Intronic
1184089879 22:42287043-42287065 GCTGGATCAGGATGGCTGGGGGG + Intronic
1184435133 22:44468611-44468633 GCTGAATCAGGGTGTCAGCGGGG + Intergenic
1184678196 22:46054564-46054586 CCTGCAGCAGGGGTGGAGGGTGG + Intronic
1185009789 22:48306575-48306597 CCTGCAACAGTGGGGCAGGTGGG - Intergenic
1185158621 22:49209116-49209138 CCTCCACCAGGCTGGCAGAGGGG + Intergenic
949946710 3:9195392-9195414 CTGGCCTCAGGCTGGCAGGGTGG - Intronic
950088176 3:10276138-10276160 CCTGCCTCAGGGTGGTTGTGAGG + Intronic
950577725 3:13842797-13842819 CCTGGAGCAGGGAGGCAGGATGG + Intronic
951111885 3:18813330-18813352 GCTGCATCCAGGTGGCAGGCAGG - Intergenic
952349845 3:32523760-32523782 CTTACAACAGGGAGGCAGGGAGG + Intergenic
955015329 3:55064281-55064303 CCTGGATCAGGGTGGGCGGGAGG + Intronic
958615945 3:96493825-96493847 ACAGCAGCAGGGTGGCAGGGAGG + Intergenic
960873324 3:122273015-122273037 CCAGCATCAGGGTAGAAGTGGGG - Intronic
961164149 3:124751904-124751926 CCAGGGGCAGGGTGGCAGGGTGG - Intergenic
961410176 3:126714666-126714688 CCTACAGCAGGCAGGCAGGGTGG - Intronic
961479982 3:127173414-127173436 TCTGGGTCTGGGTGGCAGGGGGG - Intergenic
963016426 3:140828422-140828444 CCTGCAACAGGAGGGCAGGTGGG - Intergenic
964333360 3:155628256-155628278 CCTGCTTCAGGGGAGAAGGGTGG - Intronic
964477485 3:157109921-157109943 CCAGAATCAGGGAGGAAGGGTGG + Intergenic
964529278 3:157649611-157649633 GCTGCATCATGGTTGCAAGGTGG - Intronic
965355488 3:167667871-167667893 CCTGAATTGGGGTGGGAGGGTGG + Intergenic
965695022 3:171399344-171399366 CCTGCCTCTGGGAGGGAGGGAGG - Intronic
966496303 3:180585512-180585534 CCTCTATCAGGATGGCATGGTGG - Intergenic
967805521 3:193711617-193711639 CCTGCATCAGCTGGACAGGGAGG - Intergenic
967829912 3:193909878-193909900 CCTGCTTCAAGGTGGGAGAGTGG + Intergenic
968695654 4:2024929-2024951 CCTGGATCAGGGTGATTGGGAGG + Intronic
969254984 4:5995391-5995413 CCTGCAGCAGGGCGGCAGCTGGG - Intergenic
969265481 4:6061661-6061683 CCTGCTTCAGGGGGCCAGTGTGG + Intronic
969518555 4:7662243-7662265 CCTGCCCAAGTGTGGCAGGGTGG - Intronic
971235142 4:24834789-24834811 CGTGCATCAGAGTTGCCGGGAGG - Intronic
974160911 4:58137698-58137720 CAGGCATCAGAGTGGCAGGAAGG - Intergenic
974950474 4:68579218-68579240 CATGCTTCAGGGTGGGAGGTCGG - Intronic
975424969 4:74215039-74215061 GCTTGTTCAGGGTGGCAGGGGGG - Intronic
975747026 4:77484827-77484849 CCTGCATCAGGCAGGCAGGATGG + Intergenic
976369722 4:84273534-84273556 CTTGCTTGAGGGTGGCAGGCGGG + Intergenic
977302422 4:95282733-95282755 CCTTCATCTGGGTGTCAGGCAGG + Intronic
977330626 4:95632847-95632869 ACTGCTTCAGGGAGGCAGGAAGG - Intergenic
977980371 4:103314045-103314067 CCTCCATCAGGATGGAAGTGGGG + Intergenic
978398232 4:108305284-108305306 CCTCCTTCAGGGAGGCAGGGAGG + Intergenic
978867829 4:113536302-113536324 CCTGCATTAGGCTGCCAGGGAGG + Intronic
981067989 4:140505706-140505728 CCTGCATAAAGTTGGCAGAGAGG - Intergenic
983482960 4:168297812-168297834 CTTGAATCAGGGAGGCAAGGAGG + Intronic
983796160 4:171866673-171866695 TCTGGATCAGGGTGCCAGCGGGG + Intronic
983962124 4:173767801-173767823 CCTGACTCAGGGTGGCAGGCGGG + Intergenic
985136940 4:186795456-186795478 CCTGCATCAGGGGAGGAGAGTGG + Intergenic
986256934 5:6108522-6108544 CCTGGCTCAGGGTGGCAGGCAGG - Intergenic
986264454 5:6180659-6180681 CCTCCATCAGGATGGAGGGGAGG - Intergenic
986735070 5:10662318-10662340 CCTGCAACAGGAGGGCAGGTTGG + Intergenic
986750992 5:10787801-10787823 CCTGCTTCAGTGAGGCATGGAGG - Intergenic
988112550 5:26841365-26841387 CCTGCTTCAGGGGAGAAGGGTGG + Intergenic
988542256 5:32120960-32120982 CGTGAATCTGGGAGGCAGGGAGG + Intergenic
989229712 5:39073458-39073480 CCTGCAGCAGGGTGAGGGGGCGG + Intronic
990495686 5:56345609-56345631 CCTGCATCTGGCTGGCAGAGAGG + Intergenic
990701843 5:58482663-58482685 CCTGTATAAGGGTGACAGTGAGG + Intergenic
991417596 5:66408158-66408180 GATGCATGAGGGAGGCAGGGAGG - Intergenic
992048088 5:72917492-72917514 CTTGAATCAGGGTGGTAGTGGGG + Intergenic
993273929 5:85831841-85831863 CCTGCTTGAGGGTGGAAGGTGGG + Intergenic
993592395 5:89810021-89810043 CCTGGATGGGGGTGGGAGGGTGG + Intergenic
993879667 5:93347827-93347849 CCTGCAGCAGCATGGCAGGCAGG - Intergenic
994254982 5:97582007-97582029 CCTGCTTCAGGGGAGAAGGGTGG + Intergenic
994452150 5:99956075-99956097 AGGGCACCAGGGTGGCAGGGTGG + Intergenic
995099951 5:108288103-108288125 CCTACTTGAGGGTGGAAGGGAGG + Intronic
995548529 5:113256741-113256763 TCTGTATCAGGTTGGCAGGTAGG - Intronic
995668651 5:114574483-114574505 CCTGTTGCAGGGTGGCAGGAGGG + Intergenic
997618981 5:135272599-135272621 CCTGCATGGGAGTGGCGGGGAGG + Intronic
998060505 5:139115128-139115150 CCAGGATCAGGGAGGGAGGGAGG + Intronic
999249952 5:150176561-150176583 CAGGCAGCAAGGTGGCAGGGGGG + Intronic
1001154943 5:169264592-169264614 CTTTCATCAGGGTAGCTGGGTGG - Intronic
1001211142 5:169811291-169811313 CCTGCTGCAGGGTGGAAGGGAGG + Intronic
1001295032 5:170493200-170493222 TCAGCATCAGGGTGGGATGGGGG - Intronic
1001751154 5:174132446-174132468 AATGAAACAGGGTGGCAGGGTGG - Intronic
1001999711 5:176190956-176190978 CCAGCAGCTGGGGGGCAGGGAGG - Intergenic
1002569443 5:180131702-180131724 TCTCCAGCAGGGTGTCAGGGCGG + Intronic
1002649492 5:180681156-180681178 CCAGCAGCTGGGGGGCAGGGAGG + Intergenic
1004164448 6:13243747-13243769 CCTGCATGAGGGTGGAGGGTAGG - Intronic
1005112811 6:22302869-22302891 CCTGCTTCAGGGGAGAAGGGTGG + Intergenic
1006767579 6:36522333-36522355 CCAGGAGCAGGGTGGCAGAGGGG + Intronic
1007971933 6:46060701-46060723 CAGGCACCAGGGTGGCAGGTAGG - Intronic
1008042882 6:46820500-46820522 CCTGCCTCAGGGAGGCAGATGGG + Intronic
1009735946 6:67675680-67675702 CCTGCATCACTTTGGCAGCGTGG - Intergenic
1010867841 6:81001922-81001944 CCTGCCACAGGGTGGGATGGCGG + Intergenic
1011014309 6:82737745-82737767 GCTGCCACATGGTGGCAGGGGGG - Intergenic
1011518802 6:88181838-88181860 CCTGCTTCAGGGGAGAAGGGTGG + Intergenic
1014554716 6:122831642-122831664 CCTGCTTCAGGGTAGAAAGGTGG - Intergenic
1016085703 6:139911725-139911747 CCTGCATAAGTGTGGGAGAGGGG - Intergenic
1017194724 6:151687018-151687040 CATGTCTCAGGGTGGCATGGAGG - Intronic
1017916572 6:158836159-158836181 TCAGCAGCAGGGGGGCAGGGAGG + Intergenic
1017995125 6:159525597-159525619 CCTGGATCAGGCAGGCAGAGAGG - Intergenic
1018442121 6:163822939-163822961 CCTGGAGAAGAGTGGCAGGGAGG + Intergenic
1018643899 6:165930153-165930175 CAGGCATGAGGGTGGCAGGTGGG + Intronic
1018649129 6:165976813-165976835 CCTGCTGCAGGGTGGCTGGTGGG - Intronic
1018720030 6:166565436-166565458 CCTGCAGCCAGGTGCCAGGGAGG - Intronic
1019183718 6:170208808-170208830 GCTGCATCAGGGTTGCAGGAGGG + Intergenic
1019310558 7:358608-358630 CCTGCATGTGGCTGGAAGGGTGG - Intergenic
1019735670 7:2648741-2648763 CCTGCAGTAGGGTGGTGGGGGGG + Intronic
1020677538 7:11198825-11198847 TCTGCATCCAGCTGGCAGGGAGG - Intergenic
1022992301 7:35720508-35720530 CCTGGATCAGTGTGGCATGCTGG - Intergenic
1023863898 7:44229785-44229807 ACAGCACTAGGGTGGCAGGGTGG - Intronic
1023871643 7:44266545-44266567 CCAGAATGAGGCTGGCAGGGAGG - Intronic
1024855050 7:53769452-53769474 CCTGGATCAGGGAAGCAGGGGGG - Intergenic
1029484273 7:100829594-100829616 CCTGCATCGGGGAGGGAGGAGGG - Intronic
1029639592 7:101811458-101811480 CCAGAGTCAGGGTGGGAGGGTGG + Intergenic
1029973945 7:104815242-104815264 GCTGCAGCAGGGAGGCGGGGTGG - Intronic
1029996604 7:105013501-105013523 CCCGAAGCACGGTGGCAGGGAGG + Intergenic
1033234941 7:139630727-139630749 CCTGCAGCAGAGGGGCAAGGAGG - Intronic
1033368421 7:140688659-140688681 CCTGCTGCAAGGTGGCAGGCTGG + Intronic
1034520306 7:151614319-151614341 GCAGCAGCAGGGTGGCAGGGAGG + Intronic
1034907724 7:154965336-154965358 CCTGCAACAGCTTGGCAGGGCGG - Intronic
1036286689 8:7449082-7449104 CCTGCAGCACCCTGGCAGGGAGG + Intronic
1036334789 8:7862441-7862463 CCTGCAGCACCCTGGCAGGGAGG - Intronic
1036739067 8:11345645-11345667 CCTGCATCAGGATTACAGGTGGG - Intergenic
1038241959 8:25818251-25818273 CCTGCCTTGGGCTGGCAGGGTGG + Intergenic
1038405636 8:27320425-27320447 GCTGGAGCGGGGTGGCAGGGTGG - Intronic
1038496697 8:28008413-28008435 CATGCCTCTGGGAGGCAGGGAGG - Intergenic
1038901456 8:31848939-31848961 CATGCTCCAGGGTGGCAGTGGGG - Intronic
1039442022 8:37601728-37601750 CTTGCATGATGGTTGCAGGGGGG - Intergenic
1040816293 8:51511682-51511704 CCTGGATCAGGGTGGCTCTGCGG - Intronic
1041522665 8:58772560-58772582 CCTAGATCAGGGTGGGAGAGAGG + Intergenic
1042130982 8:65586657-65586679 CCTGCCTCATGGTGGTAGGAAGG + Intergenic
1042563100 8:70088211-70088233 GCTGCATCAGATTTGCAGGGGGG - Intergenic
1043034281 8:75177569-75177591 CCTGCCTCAGGCTGGCAATGGGG - Intergenic
1043489307 8:80732548-80732570 CCCTCATATGGGTGGCAGGGTGG - Intronic
1043934178 8:86124517-86124539 CCTGTATCAGGGTCGCCTGGAGG - Intronic
1045643733 8:104280406-104280428 GCTGCTTCAGGGAGGCAAGGGGG + Intergenic
1047877015 8:129149819-129149841 CCAGCAGGAGAGTGGCAGGGAGG + Intergenic
1048848462 8:138621422-138621444 CCTGAATCAGTGAGGGAGGGAGG - Intronic
1049230185 8:141477853-141477875 TCAGCATCAGGGTGGCTGTGAGG + Intergenic
1049692106 8:143965989-143966011 GGTCCAGCAGGGTGGCAGGGAGG - Intronic
1049885174 9:21877-21899 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
1051224345 9:14883098-14883120 CCTGGATGAAGGTGGCAAGGTGG + Intronic
1051744588 9:20283351-20283373 CCTGCATGGGGGTTGGAGGGAGG + Intergenic
1052030447 9:23622264-23622286 CCTGCCTGAGGGTGGAAGAGTGG + Intergenic
1057183349 9:93041493-93041515 CCTGCAACACAGTGGCTGGGTGG - Intergenic
1057336119 9:94156562-94156584 CCTGCCTCAGGGTGGAAGCCCGG + Intergenic
1057443079 9:95096039-95096061 CCTGCTTCGGAGAGGCAGGGAGG - Intergenic
1057473185 9:95376154-95376176 CCTGCAGCCAGGTGGCACGGTGG - Intergenic
1057519742 9:95751653-95751675 GCTGCATGAGGGAGGGAGGGAGG + Intergenic
1058037879 9:100273112-100273134 CCAGAATCAGGGTGGAAGTGGGG + Intronic
1058102928 9:100937198-100937220 CCTTGATGAGGGTGGCTGGGGGG + Intergenic
1060051766 9:120383255-120383277 CCGGCAACAGAGAGGCAGGGTGG - Intergenic
1060685313 9:125605645-125605667 TCTGCCTCTGGGTGGCAGGGTGG - Intronic
1061152310 9:128835868-128835890 CCTGCAGCAGGGGCGCAGGTAGG + Exonic
1061181258 9:129026543-129026565 CCAGCCTCGGGGTGGGAGGGAGG - Intronic
1061187428 9:129063111-129063133 CCTGCCTCAGCCTGGCAGTGTGG - Intronic
1061577527 9:131516809-131516831 CCTGGATCATGGTGGCAGAGGGG - Intronic
1062067261 9:134535464-134535486 CTTACAACAGGGAGGCAGGGGGG - Intergenic
1062165304 9:135104659-135104681 CCAGCCTCTGGATGGCAGGGAGG + Intronic
1062360516 9:136185868-136185890 CCTGCCTCAGGGTAGGAGGAGGG + Intergenic
1062521662 9:136960429-136960451 CCTGCAGCTGGGTGGCGGGGGGG + Intergenic
1187684622 X:21804086-21804108 TCTGCTGCAGTGTGGCAGGGAGG + Intergenic
1188034351 X:25300134-25300156 CCTGCTTCAGGGTAGAAAGGTGG - Intergenic
1190054457 X:47173715-47173737 CCTGCAAGAGGGAGGGAGGGAGG - Intronic
1190058852 X:47198183-47198205 CATCCATCAGGGTGGCATGATGG - Intronic
1190453765 X:50606226-50606248 CCTTCATGAGGGGGGGAGGGGGG - Intronic
1190869601 X:54414012-54414034 CTTGGATCAGGGTGGTAGTGGGG + Intergenic
1191690771 X:63935722-63935744 CTTGGATAAGGGTGGCAGTGTGG - Intergenic
1192171905 X:68860903-68860925 CCTGCATCAGGGTCCCTGGCAGG + Intergenic
1199669127 X:150127446-150127468 CGTGCATCAGGCTTGCAGGCAGG - Intergenic
1199740328 X:150729613-150729635 AGTGGAACAGGGTGGCAGGGTGG - Intronic
1200064671 X:153498657-153498679 CCTGTACCAGGGAGGGAGGGAGG + Intronic
1200971610 Y:9158507-9158529 CCTGCATAAGGGTGGCAGGTAGG + Intergenic
1201224060 Y:11799899-11799921 CCTGCTTCAGGGGAGAAGGGTGG - Intergenic
1202015888 Y:20406162-20406184 CCTGAATAAGGGAGGCAGGTAGG + Intergenic
1202139408 Y:21705790-21705812 CCTGCATAAGGGTGGCAGGTAGG - Intergenic