ID: 1161458413

View in Genome Browser
Species Human (GRCh38)
Location 19:4381575-4381597
Sequence CAGGGTAGACAGAGAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 752
Summary {0: 1, 1: 0, 2: 7, 3: 72, 4: 672}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161458413 Original CRISPR CAGGGTAGACAGAGAGAGGC AGG (reversed) Intronic
900000645 1:13073-13095 CTGGGTCGACAGACAGGGGCTGG + Intergenic
900020358 1:183592-183614 CTGGGTCGACAGACAGGGGCTGG + Intergenic
900167114 1:1248237-1248259 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167197 1:1248500-1248522 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167580 1:1249622-1249644 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901685341 1:10940606-10940628 CAGGGGAGACTGGCAGAGGCAGG - Intergenic
901724639 1:11231295-11231317 CAGGGTACACGCAGAGAGGTAGG - Exonic
901740414 1:11338256-11338278 CACGGTCGCCAGGGAGAGGCTGG + Intergenic
902532464 1:17099159-17099181 GAGGGTCGCCAGAGAGTGGCAGG + Intronic
903061731 1:20673315-20673337 CAGGACAGCCACAGAGAGGCTGG + Intronic
903221067 1:21869984-21870006 CAGGGCACACAAAGAGAGTCAGG - Intronic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903325317 1:22565757-22565779 CAAGGTCTAGAGAGAGAGGCAGG + Intronic
903372996 1:22848868-22848890 CAAGGCAGGGAGAGAGAGGCAGG + Intronic
903562444 1:24238033-24238055 CAGGGTAGAAATTGGGAGGCTGG - Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904045134 1:27604105-27604127 CGGCGGAGACGGAGAGAGGCAGG - Intronic
904374370 1:30070851-30070873 CAGGGGACAGTGAGAGAGGCGGG - Intergenic
904939815 1:34157716-34157738 CAGGATAGATAGAGTGAGACAGG - Intronic
905409419 1:37757988-37758010 CAGGGTGGAGACAGAGGGGCTGG - Intronic
905575667 1:39042606-39042628 GAGGGTAGACGGAGAGATGTTGG - Intergenic
905797509 1:40823934-40823956 CAGGGTGGACAGTGGGAGACTGG - Intronic
905891668 1:41522041-41522063 CACGGCAGACAGAGACAGACAGG + Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906318516 1:44803047-44803069 CCGGGCAGGCAGTGAGAGGCTGG - Exonic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907165700 1:52408886-52408908 AAAGGGAGACAGACAGAGGCAGG - Intronic
907414893 1:54307366-54307388 TAGGGGAGACAGGGAGAGGTTGG - Intronic
908114171 1:60924918-60924940 AAGGGCAGAGAGAGAGAGGACGG - Intronic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908775709 1:67638145-67638167 CAGCGTGGTCAGAGAGAGGCTGG + Intergenic
908892319 1:68861545-68861567 CATGGTAGACCCAGAGAAGCAGG + Intergenic
909440438 1:75690260-75690282 CAGGCAAGAGAGACAGAGGCAGG + Intergenic
909516444 1:76512700-76512722 AAGGGAGGATAGAGAGAGGCTGG - Intronic
910455095 1:87389394-87389416 CAGGGAAGACAGAAAGAAGTGGG + Intergenic
910634800 1:89395189-89395211 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
910831821 1:91469068-91469090 CATGGGAGAAAGACAGAGGCTGG + Intergenic
910862606 1:91757156-91757178 CATGAAAGACAGAGAAAGGCTGG - Intronic
911357836 1:96843729-96843751 CAGGGTGGAGATAGACAGGCAGG - Intergenic
912497666 1:110101943-110101965 CAGGACAGACAGAGACACGCAGG - Intergenic
912933726 1:113985236-113985258 AAAGGCAGACACAGAGAGGCTGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914897306 1:151688202-151688224 CAGGGTGGTCAGAGAGACTCAGG + Intronic
914984889 1:152448003-152448025 CAGAGGAGACAGAGAGAAGGTGG + Intergenic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
915080573 1:153349102-153349124 CAGGATGGACAGAGAGAAACTGG + Intergenic
915318906 1:155045358-155045380 AAGGGTAGCCAGGGAGAGCCAGG + Intronic
915343077 1:155186777-155186799 GAGGGTAGACCGAGAAAGGCTGG - Intronic
915507115 1:156364855-156364877 CAGGGTAGGAAGAGACAGGATGG - Intronic
915591773 1:156874937-156874959 CAGCGTAGAAAGGAAGAGGCAGG - Exonic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916040947 1:160960950-160960972 CAGGAGAGAAAGAGTGAGGCAGG + Intergenic
916055684 1:161067824-161067846 AAGGAAGGACAGAGAGAGGCTGG - Intronic
916078306 1:161216020-161216042 CAGGGTTGATAGAAAGTGGCAGG + Intronic
916142997 1:161715799-161715821 CAGGCTAGACAGAAAGAGACGGG - Intergenic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
917374368 1:174333174-174333196 GAGGGTAGATGGGGAGAGGCTGG + Intronic
917968524 1:180193377-180193399 CAGAGGAGAGAGAGAGAGGCAGG + Intronic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
918757940 1:188360421-188360443 CAGGAGAGATAGAGAGAGGGGGG - Intergenic
919317436 1:195991119-195991141 CACGGGAGACAGATATAGGCTGG + Intergenic
919441634 1:197641002-197641024 CAGGGTAGACAGTGATGGACAGG - Intronic
922250676 1:223846084-223846106 CTGGGTAGACGGGGAGCGGCGGG + Intergenic
922823416 1:228500732-228500754 CTGGGGGGAGAGAGAGAGGCAGG + Intergenic
923136386 1:231123880-231123902 TAGGGTAGACTGAGAGATGCTGG - Intergenic
923512583 1:234665150-234665172 CGGGGGAGAGAGAGAGAGACAGG - Intergenic
923687014 1:236160497-236160519 AAGGGCAGACAGGGAGAGGCAGG - Intronic
923939934 1:238810287-238810309 CAGGGTTGAAAGAGAGGTGCGGG - Intergenic
1064050663 10:12056743-12056765 AAGGGGAGAGAGAGAGAGACTGG - Intergenic
1064306771 10:14174331-14174353 CAGGGTACACAGAGAGCTGTAGG - Intronic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066601366 10:37110957-37110979 AAGGGTAGAGAGGAAGAGGCAGG + Intergenic
1067167589 10:43878024-43878046 AAGGGGAGAAAGGGAGAGGCAGG - Intergenic
1067543386 10:47174257-47174279 CATGGCAGAAAGAGAGAGGGAGG - Intergenic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069619044 10:69825001-69825023 CAGGTCAGTCAGAGAGAGGCAGG - Intronic
1069662449 10:70132544-70132566 TGGGGGAGACAGAGAGGGGCGGG + Intronic
1069760737 10:70809372-70809394 CAGGGTTGACTCAGAGGGGCTGG - Intergenic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070518083 10:77226420-77226442 CAGTGAAGACAGAAAGAGACAGG - Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1071040384 10:81301811-81301833 GAGGGTAGAGAGTGAGAGGAGGG - Intergenic
1071149579 10:82618481-82618503 CAGGATAGACAGTGTGAGACAGG - Intronic
1071263890 10:83946463-83946485 GCGGATAGACAGAGAGGGGCTGG + Intergenic
1072155104 10:92716775-92716797 CAAGGTAGACAGGGACAGACTGG - Intergenic
1072162789 10:92784020-92784042 CAGAGTAGAAAGAGAGAAGGAGG - Intergenic
1072192622 10:93088763-93088785 CAGAGAGGAAAGAGAGAGGCTGG + Intergenic
1072237898 10:93468980-93469002 CTGTGTAGCCAGAAAGAGGCAGG - Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072780700 10:98249364-98249386 GAGGGTGGAAGGAGAGAGGCCGG + Intronic
1073027384 10:100497913-100497935 TAGAGTAGAAAGAGAGAGGCAGG + Intronic
1073545816 10:104347942-104347964 CAGGAGAGGCAGAGAAAGGCAGG - Intergenic
1074824090 10:117202150-117202172 CAGGGGTTGCAGAGAGAGGCTGG + Intronic
1074979369 10:118607588-118607610 GAGGGTGGACAGGGAGAGGAGGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075561915 10:123474174-123474196 CAGGCTAGAGAGAGAGACTCAGG - Intergenic
1075712135 10:124536450-124536472 CAGGGTGGAGGGAGAGGGGCCGG - Intronic
1076010368 10:126983222-126983244 CAAGGGAGACAGATAGAGCCAGG - Intronic
1076053995 10:127356605-127356627 CATGAGAGAGAGAGAGAGGCAGG + Intronic
1076607032 10:131695790-131695812 CTGGGGGGACAGAGAGATGCAGG + Intergenic
1076631510 10:131854899-131854921 TGGTGTGGACAGAGAGAGGCTGG - Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1077393938 11:2312052-2312074 CAGGGCAGGCAGAGCCAGGCAGG + Intronic
1077799584 11:5524748-5524770 GAGGGTAGACAGAAACAGGGAGG - Intronic
1078144816 11:8715527-8715549 CAGGAAAGAGAGAGAAAGGCTGG + Intronic
1078451403 11:11443542-11443564 GAGGGTGGACACCGAGAGGCAGG + Intronic
1078580900 11:12539026-12539048 CTGGGTAGAAAGCTAGAGGCAGG + Intergenic
1078800528 11:14640168-14640190 CAGAGTTGAAAGAGAGAGGTCGG + Intronic
1079003850 11:16779032-16779054 CACAGGAGACAGTGAGAGGCTGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601441 11:22316420-22316442 CGGGGGAGAAAGAGAGAGACGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1080240499 11:30121951-30121973 GCAGGTAGGCAGAGAGAGGCCGG - Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081574406 11:44310209-44310231 AGGGGGAGAGAGAGAGAGGCCGG - Intergenic
1082071559 11:47943728-47943750 GGGGGAAGACAGAGAGAGGGAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082968236 11:58990438-58990460 GAGGGTAGAGACAGAGGGGCTGG - Intronic
1083109393 11:60390180-60390202 CAGGGCTGACAGAGAGTGGTGGG + Intronic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083695195 11:64437915-64437937 GAGAGGAGACAGCGAGAGGCGGG + Intergenic
1084147024 11:67270415-67270437 CAGGGAAGCCAGAAAGGGGCAGG - Intronic
1084282115 11:68104328-68104350 GAGGGGAGACAGGGAGAGGTTGG + Intronic
1084286198 11:68132608-68132630 GAAGGAAGACAGAGAGAAGCTGG + Intergenic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1084537572 11:69766537-69766559 AAGGAAAGAGAGAGAGAGGCTGG + Intergenic
1085245429 11:75097152-75097174 CAGGGAAGACAGGCAGAGTCAGG + Intergenic
1087080797 11:94169260-94169282 CAGAGGAGACACAGAGAGGTGGG + Intronic
1087684367 11:101246398-101246420 GAGAGAAGAGAGAGAGAGGCAGG + Intergenic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1089104127 11:115987908-115987930 CTGGGTAGACAGAGAGGAGTAGG - Intergenic
1089282631 11:117385115-117385137 CAGGGAAGAAAGAGAGCGGAGGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090350188 11:126103022-126103044 CAGCAGAGACCGAGAGAGGCAGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1091206980 11:133828489-133828511 CATGAAAGACAGAGAGAGGGAGG + Intergenic
1091302968 11:134519384-134519406 CAGGTTATCCAGGGAGAGGCTGG + Intergenic
1091373737 12:13200-13222 CTGGGTGGACAGACAGGGGCTGG + Intergenic
1091880415 12:3972766-3972788 CAGGGTGGAGTGAGAGAGGTTGG + Intergenic
1092041047 12:5384672-5384694 CATGGGATACAGAGAGAAGCAGG - Intergenic
1092672826 12:10882780-10882802 CAGGTCAGGCAGAGAGGGGCCGG - Intronic
1092692684 12:11131186-11131208 CATGGAAGAGAGAGAGAGGAGGG - Intronic
1093596509 12:20968605-20968627 CAAGGTACAGAGAGAGAGTCTGG + Intergenic
1094372258 12:29751318-29751340 AAGAGCAGAGAGAGAGAGGCAGG + Intronic
1095977375 12:47949050-47949072 CAGGCCTGACAGGGAGAGGCGGG - Intergenic
1096261581 12:50095744-50095766 CAGAGAAGAGAGAGAGAGCCTGG + Intronic
1096279584 12:50240906-50240928 CAAGGAAGAGAGAGAGAGGGAGG + Intronic
1096521576 12:52187488-52187510 CAGAGCAGAGAGAGAGGGGCTGG - Intronic
1097078821 12:56414329-56414351 GAGGGTAGTCAGTGAGAGGTGGG + Intergenic
1097151708 12:56984110-56984132 CAGGGGAGAGAGACAGAGACAGG + Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG + Intergenic
1100563130 12:95769074-95769096 CAGGGAAGAAAGAGAGCGGAAGG + Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101325991 12:103716388-103716410 CAGGGTGGAAAGATACAGGCAGG + Intronic
1102031424 12:109742048-109742070 CAGGGGCCACAGAAAGAGGCTGG + Intronic
1102133439 12:110552452-110552474 CAGGGTAGAAGGAGAGGGGATGG - Intronic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1102744937 12:115242269-115242291 CTGGGAAGTCAGAGAGAGGGTGG + Intergenic
1103572779 12:121856289-121856311 CTGGGTGGACTGAGAGAGGAAGG - Intronic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1103953637 12:124565343-124565365 CAGGGAAGCCAGACAGAGCCCGG + Intronic
1104566268 12:129887223-129887245 CACGGTAGACAGGGAGGGGCGGG - Intronic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1105523613 13:21153820-21153842 CACGGTACACAGTGAAAGGCTGG + Exonic
1105651896 13:22387905-22387927 GAGAGAAGAGAGAGAGAGGCTGG - Intergenic
1107096232 13:36539652-36539674 CAGGGTACACAAACAGAGCCTGG - Intergenic
1107430824 13:40338604-40338626 CTGGGTAGACAGGGAAAGGGAGG + Intergenic
1107554999 13:41509963-41509985 CAAAGTAGACTAAGAGAGGCAGG + Intergenic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1107994053 13:45843308-45843330 CAGGGTAGAGACAGAGATGGAGG - Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108347836 13:49563909-49563931 CAGTCTAGACAAAGAAAGGCCGG + Intronic
1108602907 13:52010212-52010234 GTGGACAGACAGAGAGAGGCTGG - Intronic
1109290812 13:60473175-60473197 CATGTGAGACAGAGAGAGGCTGG + Intronic
1110240767 13:73264273-73264295 TAGAGAAGACAGAGAGAGACAGG + Intergenic
1110515732 13:76410541-76410563 CAGTGTAGACAGATAGATGGTGG + Intergenic
1111647483 13:91049137-91049159 CAGGGGAGACAGAGAGCGAGGGG + Intergenic
1113107731 13:106789565-106789587 CAGGGTAGAGAGTGACAGGAAGG - Intergenic
1113318289 13:109207095-109207117 CTAGGTAGCAAGAGAGAGGCTGG + Exonic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114650899 14:24284110-24284132 GAGGCTTGACAGAGAAAGGCAGG + Intergenic
1116239418 14:42322386-42322408 TATGGAAGACAGGGAGAGGCAGG + Intergenic
1116324048 14:43508818-43508840 AAGGAGAGACAGAGAGAGACAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117271259 14:54146203-54146225 CATGGCAGAGAGGGAGAGGCAGG + Intergenic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1118038056 14:61889611-61889633 GAGGGGAGAGAGAGAGAGGGAGG - Intergenic
1118746885 14:68780757-68780779 CAGGATGCACAGAGAGAAGCAGG + Intergenic
1118842513 14:69523910-69523932 CAGAGAAGACAGGGTGAGGCTGG + Intronic
1118900413 14:69981115-69981137 AAGGGAGGAGAGAGAGAGGCTGG + Intronic
1118959221 14:70513566-70513588 CAGGGAAGACAGAGAGGAACAGG + Intergenic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119518382 14:75266516-75266538 TGGGGGAGAGAGAGAGAGGCAGG - Intronic
1119643242 14:76330109-76330131 ATGGGTACACAGAGAGAGGGAGG - Intronic
1119744080 14:77032168-77032190 CAGTGAAGACAGAGACAGACAGG - Intergenic
1119858739 14:77921597-77921619 CAGCATAGACAGAGACAGGAGGG - Intronic
1119920613 14:78442592-78442614 AAGGGAAGACAGGGAGAGGCAGG + Intronic
1120698887 14:87676119-87676141 CAGTGAAGACATAGAGAGACAGG + Intergenic
1120920119 14:89747124-89747146 CAGGGTATAAACAGAGAGGCAGG + Intergenic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121870106 14:97399600-97399622 CAGGAGAGAGAGAGAGAGGTGGG + Intergenic
1121993136 14:98580890-98580912 CAGAGAAGAAAGAGAGAAGCTGG + Intergenic
1122102546 14:99424826-99424848 CAGGGAAGTGAGAGAGAAGCCGG + Intronic
1122154026 14:99739558-99739580 CAGGGCAGACAGAGCCAGCCTGG - Intronic
1122171051 14:99876130-99876152 CAGAGGAGACAGAGAGGGGAAGG + Intronic
1122448021 14:101782541-101782563 AAGGGGAGAAAGAGAGAGGGAGG - Intronic
1123760102 15:23425283-23425305 CAAGGGAGGCACAGAGAGGCTGG - Intergenic
1125135532 15:36336957-36336979 CAGGGGAGAAAGAGGTAGGCTGG - Intergenic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1125750841 15:42027172-42027194 CAGTGTTGACAGGAAGAGGCAGG + Intronic
1125996982 15:44171675-44171697 AGGGGTAGAAAGACAGAGGCTGG - Intronic
1126665126 15:51069005-51069027 TAGGGTAGGGAGGGAGAGGCAGG + Intronic
1126912237 15:53429262-53429284 AAGTGAAGACAAAGAGAGGCTGG + Intergenic
1127019124 15:54726294-54726316 GAGGGTAGAGGGAGAGAGGGGGG - Intergenic
1127166510 15:56249436-56249458 CTGGGGAGAGAGAGAGAGGGAGG + Intronic
1127526133 15:59793248-59793270 GAGAGGAGAGAGAGAGAGGCAGG + Intergenic
1127886649 15:63207385-63207407 CAGAGGAGTCTGAGAGAGGCCGG - Intronic
1128128274 15:65208885-65208907 CAGGGTGGAAAGAGCAAGGCAGG + Intronic
1128382644 15:67124807-67124829 CAGGGCAGCCGGGGAGAGGCTGG + Intronic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1128690534 15:69721436-69721458 AAGGGGAGACAGAGAGAGGGAGG - Intergenic
1129166845 15:73783329-73783351 CAGTCCAGACAGAGTGAGGCTGG - Intergenic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129901669 15:79156361-79156383 GAGGGGAGACAGAGAGATGAGGG - Intergenic
1130029374 15:80297777-80297799 GAGGGAAGACAGAGAGAGGGAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130214052 15:81952056-81952078 GAGGGGAGACAGGGAGAGGTTGG - Intergenic
1130225615 15:82056293-82056315 CTGGCCACACAGAGAGAGGCGGG + Intergenic
1131005534 15:88974429-88974451 CAGGGCAGACGGTGAGAGGTTGG - Intergenic
1131441642 15:92464141-92464163 CAGGGTATACATCAAGAGGCCGG - Exonic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1131692129 15:94838586-94838608 CAGGGTAGAGAGAGAGAGGTGGG + Intergenic
1131827650 15:96333467-96333489 GAGGGCGGAGAGAGAGAGGCCGG - Intronic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132452862 15:101977872-101977894 CTGGGTCGACAGACAGGGGCTGG - Intergenic
1132454033 16:12754-12776 CTGGGTGGACAGACAGGGGCTGG + Intergenic
1132664596 16:1075863-1075885 CAGGGTAGGGGGAGAGAGGGAGG - Intergenic
1132908919 16:2298611-2298633 TAGGGGAGACAGAGAGGGGGTGG - Intronic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1133452924 16:5918625-5918647 CAGGGTAGACAGTGAGCTGTAGG + Intergenic
1134295240 16:12939705-12939727 CACAATAGACAGGGAGAGGCAGG - Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136072101 16:27793749-27793771 CTGGGTAGCCAGAGAAAGGGAGG - Intronic
1136540267 16:30924525-30924547 CGGGGAAGGTAGAGAGAGGCCGG - Intronic
1136543520 16:30942405-30942427 CAGGGCAGAGACAGAGAGCCAGG - Exonic
1136788856 16:32952370-32952392 CAGGCAAGAGAGACAGAGGCTGG - Intergenic
1136880956 16:33901564-33901586 CAGGCAAGAGAGACAGAGGCTGG + Intergenic
1137023228 16:35450897-35450919 CAGTGTAGGCAGGGACAGGCAGG + Intergenic
1137239415 16:46642249-46642271 AAGGGCAGCCAGAGAAAGGCTGG + Intergenic
1137535231 16:49316624-49316646 CATGAGAGACAGAGAGAGACAGG + Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138496560 16:57412567-57412589 CAGGGTGGACTGTGAGAGGGTGG + Intronic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1138828531 16:60351209-60351231 CAGGTTACACAGACAGAGGTTGG + Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139820607 16:69718257-69718279 CAGAGAAGAAAAAGAGAGGCTGG + Intronic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140710385 16:77672107-77672129 CAGGGTAGAAAGATGAAGGCTGG - Intergenic
1140833451 16:78772184-78772206 GAGGGTAGAGGGAGAGAGGAAGG - Intronic
1141411250 16:83834638-83834660 CAGGAGAGACAGAGAAAGCCCGG - Intergenic
1141669903 16:85486183-85486205 AAGGGGAGAGGGAGAGAGGCAGG - Intergenic
1203091053 16_KI270728v1_random:1213859-1213881 CAGGCAAGAGAGACAGAGGCTGG - Intergenic
1142772740 17:2111273-2111295 TAAGGGAGACAGAGAGCGGCAGG + Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1144552960 17:16257579-16257601 CAGGGTTGACAGTAATAGGCAGG + Intronic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144754072 17:17668914-17668936 GAGTGCAGACAGAGACAGGCAGG + Intergenic
1146065031 17:29627939-29627961 GAGAGGAGAGAGAGAGAGGCAGG + Exonic
1146500504 17:33360468-33360490 AAGGGTATTCAGAGAGAAGCTGG - Intronic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1147149246 17:38504521-38504543 CAGGCAAGAGAGACAGAGGCTGG - Intronic
1147384161 17:40071887-40071909 CTGGGTACCCAGAAAGAGGCTGG - Intronic
1147975656 17:44246889-44246911 CAGGGCAAAGAGAGAGTGGCTGG - Intergenic
1148197932 17:45728223-45728245 CAGGATAGACAGACACAGGGAGG - Intergenic
1148378271 17:47170187-47170209 AAAGGAAGACAGAGAGAGGGAGG - Intronic
1148494290 17:48043435-48043457 CAGGAGGGATAGAGAGAGGCTGG - Intergenic
1148514272 17:48201328-48201350 CAAGGAAGAGAGAGAGAGGGAGG - Intronic
1148571097 17:48669765-48669787 GAAGAGAGACAGAGAGAGGCGGG + Intergenic
1148617709 17:49013514-49013536 CCGGGAAGCCAGGGAGAGGCTGG - Intronic
1148644347 17:49210697-49210719 CTGGGGAGCCAGACAGAGGCTGG + Exonic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149652384 17:58284077-58284099 GAGGGTGGACAGGGTGAGGCTGG + Intergenic
1151805787 17:76404447-76404469 CATGGAAGACAAAGAAAGGCTGG + Intronic
1152251669 17:79215768-79215790 CAGGGCAGGCTGAGAGAGGGCGG - Intronic
1152373157 17:79903108-79903130 GAGGGAAGAAAGAGAGAGGGAGG - Intergenic
1153055294 18:939769-939791 AAGGGGAGAAAAAGAGAGGCAGG + Intergenic
1155022468 18:21909281-21909303 TAGGGTAGATAGAAAGAAGCTGG - Intergenic
1155176783 18:23307931-23307953 CAGGGCAGACCGGGACAGGCAGG - Intronic
1157221349 18:45830292-45830314 CAGGGTAGGCAGAGAGCTCCAGG - Intronic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157830484 18:50852718-50852740 CAAGTTTGACAGAGAGAGGGAGG - Intergenic
1158703441 18:59770124-59770146 TGGGGCAGACAGGGAGAGGCAGG + Intergenic
1159489896 18:69118693-69118715 GAGGGTGGACAGTGAGAGGAGGG - Intergenic
1159644661 18:70903287-70903309 CAGGGTAGTCAGATAGAAGGAGG + Intergenic
1159664432 18:71140809-71140831 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
1160956257 19:1693405-1693427 CTGGGGAGTCAGAGAGAGACTGG - Intergenic
1161458292 19:4381070-4381092 GAGAGGGGACAGAGAGAGGCAGG - Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161983564 19:7642676-7642698 CAGGGGGGACAGGGAGAGGTGGG - Intronic
1162357663 19:10196132-10196154 CCGGGGTGACAGAGTGAGGCAGG - Intronic
1163213101 19:15856408-15856430 ATGGGAAGACAGACAGAGGCAGG - Intergenic
1163234989 19:16024843-16024865 CTGGGGTGAGAGAGAGAGGCAGG + Intergenic
1163648607 19:18504181-18504203 CAGGGACGGCACAGAGAGGCTGG + Intronic
1164716257 19:30392415-30392437 CAGGGTAGCCAGAGAAGGGTTGG + Intronic
1164802692 19:31090752-31090774 AAGGGGAGACAGAGAGAAGGAGG + Intergenic
1164936819 19:32221155-32221177 GCTGGAAGACAGAGAGAGGCCGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165786970 19:38467428-38467450 CAGAAAAGTCAGAGAGAGGCAGG - Intronic
1165797407 19:38526970-38526992 CTGGGGAGACAGAGCCAGGCTGG - Intronic
1166079440 19:40434373-40434395 CAGGGCAGGCAGAGAGCTGCAGG + Intergenic
1166136033 19:40777911-40777933 CAGGATTGACAGAAAGAGGCTGG - Intronic
1166147076 19:40845234-40845256 CTGGGGACACAGAGAGGGGCTGG + Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166339752 19:42130597-42130619 CAGTGTAGACACAGAGATCCAGG - Intronic
1166377316 19:42334844-42334866 AAAGGGAGACAGAGAGAGACAGG - Intronic
1166453744 19:42922909-42922931 CAGGTGAGGCAGAGAGAGGGAGG + Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166734222 19:45075258-45075280 CAGAATTGACAGAGAGAGACAGG + Intronic
1166855226 19:45779938-45779960 AAGGGGAGACAGACAGAGGGTGG - Exonic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1166914109 19:46182859-46182881 GAGAGATGACAGAGAGAGGCAGG - Intergenic
1167304419 19:48698908-48698930 CAGAAGACACAGAGAGAGGCAGG - Intronic
1167497575 19:49828575-49828597 CAGGCCAGGCAGAGAGAGACCGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168327539 19:55545931-55545953 GAGGGTGGAGAGAGAGAGACGGG - Intergenic
1168351203 19:55677081-55677103 TAGGGATGACGGAGAGAGGCTGG - Exonic
925188727 2:1866564-1866586 AAGGGGAGAGAGAGAGAGGCAGG + Intronic
925622580 2:5808147-5808169 CAGGGAAGATGGAGATAGGCTGG - Intergenic
925641600 2:5990586-5990608 CCGGGTGGTCAGAGTGAGGCTGG - Intergenic
926001872 2:9339835-9339857 CAGGCTGGACACAGAGAGGTGGG - Intronic
926176935 2:10602014-10602036 CAGTGTAGACAGAGAAGGGCAGG - Intronic
926436818 2:12846662-12846684 GAGGTTAGAGAGTGAGAGGCAGG + Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927333461 2:21892890-21892912 CAGGGTAGAAAGTGAGAGGAGGG - Intergenic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
928671803 2:33610428-33610450 CAAGGTAGAATGAGAGGGGCTGG + Intergenic
930304340 2:49659439-49659461 CAGGGTAGGAAGATATAGGCTGG - Intergenic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
932218490 2:69982681-69982703 CAGGGAAGACAGAGTCATGCAGG + Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
934150121 2:89138434-89138456 GAGGATAGACAGAGTGAGGCTGG - Intergenic
934217175 2:90043595-90043617 GAGGATAGACAGAGTGAGGCTGG + Intergenic
934729410 2:96647153-96647175 AAGGTGAGGCAGAGAGAGGCAGG + Intergenic
935065148 2:99641037-99641059 CAGGGTGGACAGGGAGTGGCAGG - Intronic
935902871 2:107811274-107811296 CTGGGGAGGGAGAGAGAGGCAGG - Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
936569079 2:113600343-113600365 CTGGGTGGACAGACAGGGGCTGG - Intergenic
936573410 2:113634674-113634696 GACGGTAGACAGAGTCAGGCAGG - Intronic
937206642 2:120240900-120240922 TTGGGTAGACAGAGAGAGCTGGG + Intronic
937288317 2:120766935-120766957 CAGGGCAGCTGGAGAGAGGCTGG + Intronic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937989382 2:127653901-127653923 CAGGGCTCACAGACAGAGGCCGG + Intronic
938461826 2:131502242-131502264 GAGGGGAGAAAGGGAGAGGCAGG + Intergenic
939223862 2:139339892-139339914 GAGGGGAGAGAGAGAGAGGAGGG + Intergenic
939801355 2:146714045-146714067 CGGGGTGGACAGTGAGAGGAGGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
942526188 2:176855611-176855633 CAAGGCAGCCAGAGAGAAGCAGG + Intergenic
943983745 2:194592090-194592112 CATAGTAGAGAGAGAGAGACAGG + Intergenic
944008125 2:194936876-194936898 CAGGAGAGAGAGAGAGAGGGAGG + Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944634048 2:201657183-201657205 CAGGGTAGAAAGAGTGGAGCAGG + Intronic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
944968230 2:204960889-204960911 TAGTGTAGCCAGAGAAAGGCTGG + Intronic
945021956 2:205582693-205582715 TAGGGAAGAGTGAGAGAGGCAGG + Intronic
945654593 2:212607659-212607681 CAAAGTAGAAAAAGAGAGGCAGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946114943 2:217453172-217453194 CATGGGAGACAGGTAGAGGCTGG - Intronic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
946849354 2:223890017-223890039 AGGGATACACAGAGAGAGGCAGG - Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948282958 2:236762577-236762599 CAGGATCCAGAGAGAGAGGCCGG + Intergenic
948677632 2:239608139-239608161 GAGGAGAGACAGAGAGAGGGAGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
948848388 2:240693894-240693916 GAGGAGAGACAGAGAGAGACAGG - Intronic
948987849 2:241536275-241536297 CAGGGGAGACACAGAGGAGCTGG + Intergenic
949007053 2:241655716-241655738 CCGGGTAGAGTGAGAAAGGCAGG - Intronic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1169505779 20:6209468-6209490 GAGGGAGGAAAGAGAGAGGCAGG - Intergenic
1170506217 20:17028256-17028278 TAGGGAAGACAGAGAGAAGTTGG + Intergenic
1170545980 20:17436235-17436257 CAGGGGACAGAGAGAGGGGCAGG - Intronic
1170554162 20:17502426-17502448 CATGGAAGACAGAGAAAGACTGG + Intronic
1171205495 20:23276168-23276190 AAGGTGAGACAGAGAGATGCGGG - Intergenic
1171249635 20:23638083-23638105 CAGGGGAGGCGGGGAGAGGCAGG - Intronic
1171298040 20:24035947-24035969 CAGGGTAGTGAGACAGAGGAGGG + Intergenic
1171464103 20:25315846-25315868 AAGGGAACACAGACAGAGGCAGG - Intronic
1172778923 20:37424223-37424245 CAGGGAGGAGAGAGAGAGGGAGG + Intergenic
1173733193 20:45342480-45342502 AAGGGGAGGCAGGGAGAGGCTGG - Intronic
1173853036 20:46230984-46231006 TAGGTGAGACAGAGAGAGGGAGG + Intronic
1174106627 20:48166804-48166826 AAGGGTGGATGGAGAGAGGCTGG + Intergenic
1174336828 20:49868381-49868403 CAGGGTTTTCAGAGAGGGGCAGG + Intronic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174729367 20:52900317-52900339 TAGTGAAGACAGAAAGAGGCAGG - Intergenic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175158975 20:56994085-56994107 CAGGGAGGTCAGAGAGGGGCAGG - Intergenic
1175663377 20:60836824-60836846 GAGGTAAGGCAGAGAGAGGCTGG - Intergenic
1175674338 20:60933960-60933982 CAGGGGAGAGAGAGAGGGCCAGG - Intergenic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176276770 20:64276858-64276880 CATGGGAGAAAGATAGAGGCCGG + Intronic
1176719126 21:10379135-10379157 CAGGGGAGAGAGAGAGAGTGGGG - Intergenic
1178115519 21:29412576-29412598 GAATGTAGACAGTGAGAGGCTGG - Intronic
1178258856 21:31080174-31080196 CAGGGTAGAGAGAGGTGGGCTGG + Intergenic
1178958514 21:37043952-37043974 TGGGGAAGGCAGAGAGAGGCAGG - Intergenic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179576234 21:42310158-42310180 CACGGGAGACAGAGAAAGACGGG + Intergenic
1179711150 21:43263956-43263978 CAGGGTACAATGAGAGAGGAAGG + Intergenic
1181024542 22:20120552-20120574 CAGAGTCGTCTGAGAGAGGCAGG + Intronic
1181754374 22:25012959-25012981 CAGGATAGACTGAGTGGGGCAGG - Intronic
1181960313 22:26617904-26617926 AAAGGGAGACAGAGAGAGGGAGG - Intronic
1182014976 22:27032109-27032131 CAAGGGAGACAGAGAGAAGCTGG + Intergenic
1182078183 22:27509406-27509428 AGTGGTAGGCAGAGAGAGGCTGG - Intergenic
1182302228 22:29343381-29343403 CAGGGAAGGCTGACAGAGGCAGG + Intronic
1182518406 22:30871749-30871771 CAGGGTGGGAAGATAGAGGCTGG + Intronic
1182766328 22:32760606-32760628 TAGGGTAGACGGTGGGAGGCTGG - Intronic
1182980813 22:34669088-34669110 CAGGGTAGATAAAGAGAGTGAGG - Intergenic
1183202479 22:36395285-36395307 TGTGGTTGACAGAGAGAGGCTGG - Intergenic
1183255581 22:36759474-36759496 CAGGGTGCACAGGGACAGGCTGG + Intronic
1183291194 22:37002919-37002941 CGTGGGAGACAGGGAGAGGCGGG - Intronic
1184021433 22:41824352-41824374 GAGGGTAGGAACAGAGAGGCGGG + Intronic
1184088680 22:42281257-42281279 CAAGGCAGCCTGAGAGAGGCTGG + Intronic
1184351708 22:43948567-43948589 TAGGGAAGACAGAGAGAGGTTGG - Intronic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1185039167 22:48495646-48495668 CAGCCCAGACAGAGAGAGGACGG - Intronic
1185276353 22:49951652-49951674 GAGTGGAGACCGAGAGAGGCAGG + Intergenic
1185330185 22:50248913-50248935 GAGGGTCGACAGAGAGGGGCTGG + Intronic
1185344249 22:50304486-50304508 CCTGGTAGGCAGAGAAAGGCAGG + Intronic
1185426772 22:50776206-50776228 GACGGTAGACAGAGTCAGGCAGG + Intronic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949509655 3:4757148-4757170 CTGGGTAGGCAGAGAGTGCCTGG - Intronic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950908512 3:16562186-16562208 GAGGGTACACAGAGACAGACAGG + Intergenic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
951398863 3:22204910-22204932 GAGGATAGAGAGAGAGAGCCTGG + Intronic
951752968 3:26057518-26057540 CAGGGCAGAGATACAGAGGCAGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953214170 3:40902218-40902240 GAGGGCAGACAGCAAGAGGCAGG + Intergenic
953565352 3:44027625-44027647 CAGGGCAGGAAGTGAGAGGCAGG - Intergenic
954265170 3:49465996-49466018 CAGGCCTGACAGAGAGGGGCAGG - Intergenic
954688701 3:52384452-52384474 CAGGGCTCTCAGAGAGAGGCAGG + Intronic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955430573 3:58840418-58840440 CAAGGTAGACACACAGAGGGTGG + Intronic
956932781 3:74064402-74064424 GAGGGGAGACAGAGAAAGGAGGG + Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
958000112 3:87739794-87739816 GAGGGGAGAGAGAGAGAGACAGG - Intergenic
960080443 3:113534579-113534601 CACGCTAGATAGAAAGAGGCTGG - Intronic
960155344 3:114292738-114292760 TTGGGTAGGCAGAGAGAAGCTGG + Intronic
960188810 3:114677844-114677866 AAGAGTAGGCAGAGAGAGGAAGG - Intronic
960205575 3:114893354-114893376 CAGGCTAGACAGACAGTGGGTGG + Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960860375 3:122146726-122146748 CAGAGCAGCAAGAGAGAGGCAGG - Intergenic
961006072 3:123406245-123406267 CAGGGAAGGAACAGAGAGGCGGG - Intronic
961018701 3:123486298-123486320 CAGGGGAGACAGAGAAAGGTTGG + Intergenic
961335274 3:126172835-126172857 CAGTGAAGCCAGGGAGAGGCAGG + Intronic
961379530 3:126487974-126487996 CAGGGGAGACCCAGAGAGGTGGG + Intronic
961514363 3:127423514-127423536 GGGGGGAGACAGAGAGAGGGAGG - Intergenic
961516934 3:127443867-127443889 CTGGGGAGTCAGACAGAGGCAGG + Intergenic
962014885 3:131429552-131429574 CAGGGTAGATGTACAGAGGCTGG + Intergenic
962340063 3:134575175-134575197 GAGGGAAGAGAGAGAGAGACAGG - Intergenic
962929014 3:140020464-140020486 AGGGGTAGAAAGAGAGAGGTAGG - Intronic
964299228 3:155269761-155269783 CAGGAGAGACAGAGAGAGAGTGG - Intergenic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965179196 3:165379380-165379402 GAGGGTAGAGAGAGAAAGGAAGG - Intergenic
965464680 3:169013337-169013359 CAGTGCAGATAGAGAGAAGCAGG - Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966542156 3:181103885-181103907 CAGAGTGGAAAGAGTGAGGCAGG + Intergenic
966924524 3:184635774-184635796 CAGCGTGGGGAGAGAGAGGCAGG + Intronic
967529058 3:190528833-190528855 CAGGTTGGACAGAGAGAGATTGG + Intronic
968084668 3:195868940-195868962 CAGCTTAGACGGAGCGAGGCGGG - Intronic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969318546 4:6396415-6396437 CAGGGCTGACGGAGATAGGCAGG + Intronic
969340295 4:6536080-6536102 CAGGCTACACAGAGTGAGGTGGG - Intronic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969510541 4:7615061-7615083 ATGGGTAGACAGAGAGATGGTGG - Intronic
969686258 4:8675982-8676004 CAGGGGAGACAGAGAGGTGGGGG + Intergenic
970044853 4:11840577-11840599 CAGGGAAGAAAGAGAGGGGAAGG - Intergenic
970523548 4:16909345-16909367 CAGGGGAGGGAAAGAGAGGCAGG - Intergenic
971328871 4:25665886-25665908 CAGGGCAGAGAGACAGAGACAGG + Intronic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971630771 4:28990346-28990368 ATGGGAAGACAGAGAGAGACTGG - Intergenic
972883320 4:43452965-43452987 CAGGGGAGAAAGATATAGGCTGG + Intergenic
972894077 4:43597504-43597526 GAGGGTAGAAGGAGAGAGGGAGG - Intergenic
973557976 4:52105275-52105297 CAGGGGAGAGAGAGAGATACTGG + Intergenic
974005899 4:56556950-56556972 AATGCTAAACAGAGAGAGGCCGG + Intronic
974323531 4:60385339-60385361 AAGGGAAGAGAGAGAGAGGGAGG - Intergenic
974857366 4:67476706-67476728 CAGGGTAGGCAGCAAGGGGCAGG + Intronic
974874999 4:67693095-67693117 AAGGGTAGGGAAAGAGAGGCAGG - Intronic
975072163 4:70155474-70155496 CTGGGTAGGCTGAGTGAGGCAGG - Intronic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
975307200 4:72864029-72864051 CATCCTAGACAGAAAGAGGCAGG + Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975452363 4:74544148-74544170 GAGGGTGGACAGGGAGAGACTGG + Intergenic
976221061 4:82757170-82757192 CAGGGTAACCAGAGAGTGACGGG - Intronic
976444566 4:85116023-85116045 CTGGGGGGACAGAGAGAGGCAGG - Intergenic
976446458 4:85135614-85135636 CAGGCAAGACAGAGAAAGGCTGG + Intergenic
977930871 4:102747318-102747340 CATGGGAGAAAGATAGAGGCTGG + Intronic
979046329 4:115870280-115870302 GAAGGAAGATAGAGAGAGGCTGG - Intergenic
979930761 4:126627620-126627642 CAGGTGAGACAGAGACATGCTGG - Intergenic
980763384 4:137266549-137266571 CATGGGAGAAAGACAGAGGCCGG - Intergenic
981681035 4:147398299-147398321 AAGGGAAGAAAGAGAGAGGGAGG + Intergenic
982271342 4:153592528-153592550 TAGGGTACAAGGAGAGAGGCAGG - Exonic
982310128 4:153975706-153975728 CAGGAGAGAGAGAGAGAGGGAGG - Intergenic
982344643 4:154344040-154344062 CTGGGGAGAGAGAGAGAGACGGG + Intronic
982602655 4:157470895-157470917 CAGGTTGCACAGAGAGAGGGAGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983252172 4:165357726-165357748 AAGGGAAGAAGGAGAGAGGCAGG - Intergenic
984959094 4:185077327-185077349 CAGGGTGGAAAGAGAGAGGTCGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985425791 4:189828828-189828850 CAGGTAAGGTAGAGAGAGGCAGG - Intergenic
985425802 4:189828906-189828928 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985425809 4:189828951-189828973 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985932810 5:3072392-3072414 AAGGAGAGAGAGAGAGAGGCAGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
987065763 5:14288328-14288350 CTGGGTGGGGAGAGAGAGGCTGG - Intronic
987593597 5:19965740-19965762 GCAGGTAGAAAGAGAGAGGCGGG + Intronic
987593599 5:19965758-19965780 GCGGGTAGAAAGAGAGAGGCAGG + Intronic
987729606 5:21752017-21752039 CGAGGTAAACAGAGAGAGTCTGG + Exonic
987982515 5:25104735-25104757 CAAGGTAAACACAGAGAGTCAGG + Intergenic
989017344 5:36954208-36954230 AAGGGTAGAAAGTGAGAGGATGG + Intronic
990028547 5:51226159-51226181 TAGGGGAAACAGAGAGGGGCAGG + Intergenic
990078423 5:51880865-51880887 TAGGGTAGAGAGAGAAAGACAGG + Intergenic
990389766 5:55307350-55307372 CAGGGCAGACAGCCAGGGGCTGG + Intronic
990466238 5:56074375-56074397 CAAGAAAGAAAGAGAGAGGCTGG - Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991227827 5:64293023-64293045 CAGAGTAGACAGGGTGAGGAGGG - Intronic
991304201 5:65159405-65159427 GAGGCTACAGAGAGAGAGGCAGG - Intronic
991404642 5:66289819-66289841 CAGGGCTGGCAGAGAGAGGTAGG - Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
992022140 5:72635101-72635123 CAGGGTAGAAAGAGAAATTCTGG + Intergenic
992388939 5:76312707-76312729 GAAGGTAGGCAGAGAAAGGCAGG - Intronic
992660504 5:78955484-78955506 CAAGGTAGAGAAACAGAGGCTGG + Exonic
993868812 5:93225590-93225612 CAAGGGAGAAAGAGAGAGCCCGG + Intergenic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
995315583 5:110768303-110768325 GAGAGTAGTCAGAGAAAGGCTGG - Intergenic
995446933 5:112254930-112254952 CAGGGTCTTCAGAGAGAGCCAGG - Intronic
995837183 5:116410571-116410593 CAGGACAGGCAGAGAAAGGCAGG - Intronic
997068944 5:130596128-130596150 CACGGTAGAAAGATATAGGCTGG - Intergenic
997422701 5:133781657-133781679 CAGGGTACACACAGTGTGGCAGG - Intergenic
998167743 5:139854141-139854163 CTGGGTGGGCAGAGAGAGACAGG - Intronic
998513855 5:142735581-142735603 CAAGGCAGGCAGAGAGAGGGTGG + Intergenic
999201354 5:149818708-149818730 CATGGTAGGCAGAGAGGAGCGGG - Intronic
999234605 5:150082971-150082993 CAGGGTCTAGAGAGACAGGCTGG - Intronic
999264095 5:150255335-150255357 CAGGACAGTCAGAGAGGGGCAGG + Intronic
999622913 5:153490571-153490593 CAAGGGAGGGAGAGAGAGGCAGG + Intronic
999631000 5:153571300-153571322 CGGGGTAGCCAGTGACAGGCAGG + Intronic
999699720 5:154217413-154217435 CAAGGGAGACAGTGAGAGGGTGG + Intronic
1000197687 5:158975522-158975544 AATGAAAGACAGAGAGAGGCAGG + Intronic
1000359573 5:160434539-160434561 CAGGGGAGAGAGGGAAAGGCAGG + Intergenic
1001132554 5:169076508-169076530 CAAGCTAGAGAGAGAGAGGTAGG - Intronic
1001159281 5:169300029-169300051 AAGGGCAGCCAGAGAGCGGCTGG + Intronic
1001284385 5:170411913-170411935 CAGGGTAGATGGAGAGAGAGAGG + Intronic
1001756309 5:174173010-174173032 CAGGGTAGAAAGAGAGTCACAGG + Intronic
1001960083 5:175874716-175874738 GAGGGGAGGCAGAGAGAGGGAGG + Intronic
1001971353 5:175957409-175957431 GAGGGAAGACAGAGAGAATCTGG - Intronic
1002057500 5:176606971-176606993 CAGGGTAGGGACAGAGAGCCTGG + Intronic
1002078500 5:176723844-176723866 CTGTGTACACAGAGAGGGGCTGG - Intergenic
1002246089 5:177886368-177886390 GAGGGAAGACAGAGAGAATCTGG + Intergenic
1002279521 5:178122297-178122319 CAGGTCAGAGGGAGAGAGGCTGG + Exonic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1002426697 5:179180943-179180965 CAGGGGAGCCAGGGAGAGGCAGG + Intronic
1002518693 5:179777934-179777956 CAGGGCAGCCTGGGAGAGGCTGG + Intronic
1002551353 5:179995197-179995219 CTGGAGAGAGAGAGAGAGGCAGG - Intronic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003091146 6:3104633-3104655 CAGGGTACAAGCAGAGAGGCTGG + Intronic
1004312965 6:14562223-14562245 TAGGGCAGAGAGAGATAGGCTGG + Intergenic
1004725648 6:18308917-18308939 AAGGGAAGAGAGAGAGAGGAAGG - Intergenic
1006219858 6:32479579-32479601 CAGTGTAGAGAGCCAGAGGCTGG - Intergenic
1006603279 6:35239573-35239595 CAGGAAAGAGAGAGAGAGACAGG + Intronic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007957882 6:45933746-45933768 CTGGGTGGACAGAGAGGGGCAGG + Intronic
1008475532 6:51931886-51931908 AAGGGGAGAGAGAGAGAGGAGGG + Intronic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008713224 6:54255137-54255159 CAGGGAAGACAGAGAGACAGGGG - Intronic
1009330646 6:62415519-62415541 AAGGGTAGACGGTGAGAGGAGGG + Intergenic
1009820697 6:68797433-68797455 GAAGGTAGAGAGAGAGATGCTGG + Intronic
1011303542 6:85901827-85901849 GAGAGTAGGCAGAGTGAGGCAGG + Intergenic
1012627887 6:101426687-101426709 TAGATTAGAAAGAGAGAGGCAGG - Intronic
1013415920 6:109924424-109924446 AAGGGTGGAAAGAGACAGGCTGG + Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1014801015 6:125778009-125778031 AAGAGTAGTCAGAGAGGGGCCGG - Intergenic
1015395863 6:132733954-132733976 GAGGGGAGAGAGAGAGAGGAAGG + Intronic
1015468642 6:133576976-133576998 CAGCTTAGGCAGAGAGAAGCTGG - Intergenic
1016413093 6:143804243-143804265 CTGGGTAGATAGAGAGAGAGAGG - Intronic
1016998214 6:149976176-149976198 CAGTGAAGACAGGGAGAGACTGG + Intergenic
1017127598 6:151080383-151080405 CAGGGCAGCCAGTGAGAGGATGG + Intronic
1017143664 6:151214737-151214759 AAGGGTAGATGAAGAGAGGCTGG + Intergenic
1017493238 6:154962347-154962369 CAGGGTAGAAGGAGAGAGGGAGG + Intronic
1017988854 6:159469086-159469108 GAGGGAAGAGAGAGAGAGGCAGG + Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018941441 6:168310804-168310826 CAGGGAAGAAAGAGAGAGACAGG - Intronic
1019414107 7:919700-919722 CAGGGGAGAAAGAGACAGGTGGG + Intronic
1019556593 7:1634516-1634538 CAGGGAAGACATAGAGGGGCAGG - Intergenic
1019560455 7:1653533-1653555 CAGGGCACACAGACAGGGGCAGG - Intergenic
1020032052 7:4940287-4940309 CAGGCCAGAGAGAGAGAGGGAGG - Intronic
1020875769 7:13691868-13691890 CACGGGAGAAAGACAGAGGCTGG - Intergenic
1021960575 7:25868937-25868959 CAGGGATGGCAGAGAGAAGCAGG + Intergenic
1022991751 7:35715188-35715210 CAGGATAGAAGGAGACAGGCAGG + Intergenic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024751443 7:52470272-52470294 ACGGGGAGAGAGAGAGAGGCAGG + Intergenic
1025638173 7:63342847-63342869 CAGTGAAGACAGAGTGAAGCAGG + Intergenic
1025644523 7:63405242-63405264 CAGTGAAGACAGAGTGAAGCAGG - Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026098947 7:67368946-67368968 CAGGGTAGAAAAAGTGAGGGAGG - Intergenic
1026140713 7:67703945-67703967 CAGGGGAGAAAGATATAGGCTGG + Intergenic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1027228826 7:76260761-76260783 GAGGGTGGACAGAGAGATTCGGG - Intronic
1028437394 7:90820492-90820514 CAGGAGAGACAGAGCGAGGCAGG - Intronic
1028455606 7:91035140-91035162 GAGGGTAGACAGGGAGAAGTGGG - Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1030113059 7:106042714-106042736 GTGGGGAGATAGAGAGAGGCTGG + Intergenic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030959966 7:115906174-115906196 CAGGGCAGAAAGAGAGAGTGGGG + Intergenic
1031657199 7:124372505-124372527 AACGGAAGCCAGAGAGAGGCAGG + Intergenic
1032485758 7:132286311-132286333 CAGGGTGGACAGACAGGGCCAGG - Intronic
1033652271 7:143352264-143352286 AGGGGGAGGCAGAGAGAGGCAGG - Intergenic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034543686 7:151776313-151776335 CGGGGTAGACAGCCAGGGGCCGG - Intronic
1034689142 7:153000030-153000052 CAGGAGAGAGAGAGAGAGGGAGG + Intergenic
1035235802 7:157497070-157497092 CAGGGTGGGCAGGGAGGGGCAGG - Intergenic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035366987 7:158355434-158355456 CAGGAGAGTGAGAGAGAGGCAGG - Intronic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036926978 8:12916400-12916422 GAGGGAGGACAGAGAGAGGATGG - Intergenic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1037838204 8:22227034-22227056 CAGGGTACAAACAGAGAGCCAGG + Intronic
1037905643 8:22714574-22714596 CAGGGTGGAGAGAGAGTGCCTGG + Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1037963479 8:23116618-23116640 CTGGGTACACACAGAGAGGGAGG - Intronic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1038675716 8:29621060-29621082 CAGGGTGGAGGGAGAGAGGTTGG + Intergenic
1039479049 8:37858280-37858302 CATTGTAGAGAGACAGAGGCAGG - Intergenic
1039736281 8:40336313-40336335 CATGTAAAACAGAGAGAGGCAGG - Intergenic
1041203456 8:55473894-55473916 AAGGAAAGACAGAGAGAGGGAGG - Intronic
1041478737 8:58295068-58295090 CAAGTTAGAATGAGAGAGGCTGG + Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1042786332 8:72550900-72550922 CAGGGCTGACAGAGACAGGCAGG + Intronic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044258449 8:90092637-90092659 AAGTGAAGACAAAGAGAGGCTGG + Intronic
1044965251 8:97568187-97568209 CAGGGAGAAGAGAGAGAGGCTGG + Intergenic
1045347354 8:101305036-101305058 CAGGGTGGGCAGGGAAAGGCAGG + Intergenic
1045664421 8:104469601-104469623 AAGGAGAGACGGAGAGAGGCTGG + Intergenic
1045784414 8:105903743-105903765 AAGGACAGACAGAGAGAAGCAGG + Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1047394391 8:124481587-124481609 CAAGGTAGCCAAAAAGAGGCAGG - Intronic
1048455144 8:134570940-134570962 CAGCGAAGACAGACAGAGACAGG + Intronic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049242889 8:141547637-141547659 CAGGGGTGACCGAGTGAGGCTGG + Intergenic
1049309594 8:141926617-141926639 CAGGCTAGACAGGGAGGGCCAGG - Intergenic
1049328633 8:142038108-142038130 CAGGGGTGGCAGGGAGAGGCTGG - Intergenic
1049337418 8:142093804-142093826 CGGGGTAGACAGGGAGAGGAAGG + Intergenic
1049376308 8:142290931-142290953 CAGTGCAGACACAGAGGGGCAGG + Intronic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1049697129 8:143989911-143989933 CTCGGCAGACAGTGAGAGGCGGG + Intronic
1049883451 9:13186-13208 CTGGGTGGACAGACAGGGGCTGG + Intergenic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1052161560 9:25266961-25266983 AGGGGTAGAGAGAGAGAGGGAGG + Intergenic
1052760425 9:32584810-32584832 GTGGGTAGACAGAGAGATGTTGG - Intergenic
1052829332 9:33202356-33202378 CAGGGCAGACAGAGCAAGGGTGG + Intergenic
1053474492 9:38372334-38372356 CAGTGCAGAAACAGAGAGGCAGG + Intergenic
1055297105 9:74844954-74844976 CAAGGTAGAGGGAGAGAGACAGG + Intronic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1056861522 9:90188871-90188893 GAGGGTAGAGAGGGACAGGCAGG - Intergenic
1056918847 9:90768440-90768462 CATGGAAGACAGGAAGAGGCAGG + Intergenic
1057367323 9:94435032-94435054 CAGGGGTGACAGTGAAAGGCAGG - Intronic
1057453109 9:95183016-95183038 CAGGGATGAAAGAGAAAGGCAGG - Intronic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058309393 9:103483160-103483182 CAGGAGAGAGAGAGAGAGGTTGG - Intergenic
1058480231 9:105385553-105385575 CAGTGAAGACAGAGAGAGAGAGG - Intronic
1058589249 9:106544544-106544566 GAGGGGAGATAGAGAGAGACTGG + Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059137506 9:111821263-111821285 CAGGGTAGAGACAAAGAAGCTGG - Intergenic
1059733263 9:117077117-117077139 CAGGGGAGAGAGACAGAGGTTGG + Intronic
1059841060 9:118217095-118217117 GAGGGCAGAGAGAGAGAGGGAGG - Intergenic
1060016416 9:120090244-120090266 CAGGTGAGACAGAGACAAGCAGG + Intergenic
1060255209 9:122021311-122021333 CAGGGAAGACTGAGATAGCCAGG + Intronic
1060407766 9:123381340-123381362 CTGGGCAGAGAGAGAGTGGCGGG + Exonic
1060434211 9:123579750-123579772 CAGGGGACACAAAGACAGGCAGG + Intronic
1060442683 9:123656223-123656245 CAGGGAAGAGAGTGAGAGGCAGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1061078428 9:128355617-128355639 CAGGGTAGACACTGAGTAGCTGG - Intronic
1062424611 9:136500335-136500357 CAGGGAAGTCAGGCAGAGGCGGG - Intronic
1062437867 9:136554624-136554646 CTGGGAAGACAGGCAGAGGCTGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062601108 9:137318944-137318966 CAGGGTTCCCAGAGCGAGGCTGG - Intronic
1062627239 9:137448841-137448863 CAGTGTAGACAGAGCCAGGCTGG + Exonic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186494580 X:10002071-10002093 CAAAAAAGACAGAGAGAGGCGGG + Intergenic
1186783605 X:12938638-12938660 CAAGGTAGAGAGAGAGAGTCTGG + Intergenic
1187416413 X:19097084-19097106 GAGGGGAGGCAGAGAGGGGCTGG - Intronic
1187428451 X:19200199-19200221 CAGGGTAGAGTGAGAGATGAGGG + Intergenic
1187462846 X:19503050-19503072 CAGGGCATATAGAGAGAAGCGGG + Intronic
1187514484 X:19955138-19955160 CAAGTTAGAAAGGGAGAGGCTGG - Intronic
1187813161 X:23202815-23202837 CAGGAGGGACAGATAGAGGCAGG + Intergenic
1187824891 X:23325029-23325051 CAGCTCAGACAGAGAGAGGCAGG + Intergenic
1189153422 X:38730453-38730475 CAGTTTACACAGAGAGAGGCAGG - Intergenic
1190302704 X:49065728-49065750 GGGGCTAGACAGAGACAGGCAGG - Exonic
1190866244 X:54387125-54387147 GAGAGAAGAAAGAGAGAGGCCGG - Intergenic
1192524729 X:71831682-71831704 AAGGGAAGACAGAGAAAGGTAGG + Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194022355 X:88707672-88707694 GAGGGTAGAAAGTGAGAGGAGGG - Intergenic
1194308372 X:92275490-92275512 AAGTGAAGACAAAGAGAGGCTGG + Intronic
1194351457 X:92827779-92827801 AAGTGAAGACAAAGAGAGGCTGG - Intergenic
1194409954 X:93544999-93545021 CAGGGGAGAGAGAGAGAAGGGGG + Intergenic
1195022809 X:100846634-100846656 CAGGAGAGAGAGAGAGAGGGAGG - Intronic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1198733232 X:139756818-139756840 CAGGGTGGAGAGTGAGAGGAGGG + Intronic
1199259910 X:145760341-145760363 CAGGCTAGAGGGAGAGGGGCGGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1200402365 X:156026963-156026985 CTGGGTGGACAGACAGGGGCTGG - Intergenic
1200659779 Y:5944471-5944493 AAGTGAAGACAAAGAGAGGCTGG - Intergenic
1200871217 Y:8100881-8100903 AAGGGCAGACAGAGAAAGGTCGG - Intergenic
1201244279 Y:11987294-11987316 CAGGCCAGACGGAGAGACGCTGG + Intergenic
1201249298 Y:12039908-12039930 CGGGGTCTACAGAGACAGGCAGG - Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic