ID: 1161459666

View in Genome Browser
Species Human (GRCh38)
Location 19:4389275-4389297
Sequence CATCTGGGTGGGGGACCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161459656_1161459666 18 Left 1161459656 19:4389234-4389256 CCGATGGGAGGAGAGCACCTCAC 0: 1
1: 0
2: 2
3: 9
4: 138
Right 1161459666 19:4389275-4389297 CATCTGGGTGGGGGACCCCGAGG 0: 1
1: 0
2: 1
3: 17
4: 176
1161459657_1161459666 1 Left 1161459657 19:4389251-4389273 CCTCACACGAACACCAGCGTGTG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1161459666 19:4389275-4389297 CATCTGGGTGGGGGACCCCGAGG 0: 1
1: 0
2: 1
3: 17
4: 176
1161459655_1161459666 22 Left 1161459655 19:4389230-4389252 CCGTCCGATGGGAGGAGAGCACC 0: 1
1: 0
2: 1
3: 8
4: 61
Right 1161459666 19:4389275-4389297 CATCTGGGTGGGGGACCCCGAGG 0: 1
1: 0
2: 1
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161459666 Original CRISPR CATCTGGGTGGGGGACCCCG AGG Intronic
900224993 1:1528835-1528857 CATGGGGGTGGGGGAGCCCAGGG - Intronic
900573609 1:3372171-3372193 GAGCTGGGTGAGGGACCCCAGGG + Intronic
902286289 1:15410408-15410430 CACCGGGGTTGGGGACCCGGCGG + Intronic
902569123 1:17335737-17335759 CCTTGGGGTGGGGGACCCAGCGG - Intronic
902581879 1:17412988-17413010 CATCAGGGAGGGGCACCCCATGG + Intronic
902919362 1:19657087-19657109 CCTCTGTGTGGGGGGCCCCAGGG - Exonic
903970208 1:27113918-27113940 CATCTCGGCCGTGGACCCCGTGG - Exonic
905732020 1:40304142-40304164 AAGTTAGGTGGGGGACCCCGTGG - Intronic
906697065 1:47830150-47830172 CATCTGGGAGGGGGACATCCTGG - Intronic
911720531 1:101186586-101186608 CATGTGGCTGGGGGACACCTCGG - Intergenic
913061328 1:115211114-115211136 CATCTGTGTGGGGGCCCTGGTGG + Intergenic
915948768 1:160173761-160173783 CATCTGGGTGGGGCAGGCTGGGG - Intronic
916231250 1:162543628-162543650 CTTCTGGGTGGGGGCCACAGAGG + Intergenic
920867941 1:209768801-209768823 CTTCAGTGTGGGGGACCCTGGGG + Intronic
921676550 1:217982735-217982757 CATCTAGTTGGGGGACCACGGGG + Intergenic
924198894 1:241639918-241639940 CGGCTGGGTGTGGGACACCGTGG - Exonic
924230536 1:241958537-241958559 GATCTGGGTGGAGGGCCCCTTGG + Intergenic
1062975274 10:1678257-1678279 CCTCAGGGTGAGGGACCTCGGGG + Intronic
1063270704 10:4507586-4507608 CATCTGGTTGGGGGAGGCCCGGG + Intergenic
1069749701 10:70737306-70737328 CATTTGCCCGGGGGACCCCGTGG + Intronic
1069866422 10:71506500-71506522 TCTCTGGCTGGGGGACCCTGGGG - Intronic
1075702155 10:124476662-124476684 CATCAGTGTGGGCGTCCCCGGGG + Intronic
1076215280 10:128688247-128688269 CATCTGGGTGGGGAAGTCGGAGG + Intergenic
1077466092 11:2734429-2734451 CAGCTGGCTGCGGGGCCCCGGGG - Intronic
1083625350 11:64069408-64069430 CATCTGGCTCAGGGACCCTGGGG + Intronic
1083681175 11:64352546-64352568 CTTCTGGGTTGGGCTCCCCGTGG + Intronic
1084117375 11:67050115-67050137 CTTCTGGGTGGGAGCCCCCAGGG - Exonic
1084426316 11:69086199-69086221 CATGGGGGTGGGGGAGCCCCGGG + Intronic
1087459181 11:98423893-98423915 CATCAGGGTGGGGGACTACCTGG - Intergenic
1089328622 11:117674583-117674605 TATCTGGGTGGGGTACCTTGCGG - Intronic
1089384723 11:118060177-118060199 CACATGGGTGGGGGACCTGGAGG - Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1091723212 12:2827984-2828006 CACCTGGGTTGGGGGCCCAGGGG + Exonic
1096113663 12:49042785-49042807 CATCTGGGTTGTGGAACCCCTGG - Exonic
1096214604 12:49792308-49792330 CCTCTGGGAGGAGGACCCCTGGG - Intronic
1096598501 12:52713589-52713611 GAGCTGGGAGGGGGACCCTGGGG - Intergenic
1097233914 12:57527208-57527230 CACCTGGGGGGGTGTCCCCGAGG - Exonic
1099060374 12:77900802-77900824 ACTCTTGGTGGGTGACCCCGTGG - Intronic
1101444759 12:104729831-104729853 CATCTGGATGGGGGAGCCCCTGG + Intronic
1102248283 12:111368826-111368848 CAGGTGGCCGGGGGACCCCGAGG + Intronic
1103316874 12:120063312-120063334 CATCTGGGTAGGGGACCAAAAGG - Intronic
1103927137 12:124429351-124429373 CATCTGGATGGGGGAGCGCCAGG + Intronic
1104400578 12:128472682-128472704 CACCTGGGTTGGGGACTCTGTGG + Intronic
1107913123 13:45124035-45124057 CAACAGGGTGGGGGACCTCATGG - Intronic
1110500668 13:76224194-76224216 CATGTGTGTGAGGGACCCCGTGG + Intergenic
1113523407 13:110955980-110956002 CATCTGGGTGGGAGAGGCCTGGG - Intergenic
1113664382 13:112131295-112131317 CCCGTGGCTGGGGGACCCCGTGG - Intergenic
1113701897 13:112394516-112394538 CATCTGGGTGGGAGAGGCCTGGG + Intronic
1113793054 13:113040869-113040891 CACATGGGTGGGGGACCATGGGG + Intronic
1113799940 13:113081042-113081064 GAGCTGGGAGGGGAACCCCGAGG + Intronic
1114643802 14:24242361-24242383 CATCCGGGTGAGGAACCCGGAGG - Exonic
1119768778 14:77207197-77207219 CATCTCTGTGGGGGTCCCAGAGG + Intronic
1122629049 14:103099100-103099122 CACCTGGGTGGGGGGCCCTGGGG + Intergenic
1123117241 14:105900259-105900281 CATCAGGGTCGGGGTCCCCCAGG + Intergenic
1123119323 14:105909528-105909550 CATCAGGGTTGGGGTCCCCCAGG + Intergenic
1125717504 15:41827602-41827624 CATGTGGGTGGGGGGCCTCGTGG + Exonic
1126823776 15:52529337-52529359 CTTCGGGGTGGGGGCGCCCGGGG - Intergenic
1128309722 15:66622442-66622464 CACCTGGGAGGGGCAGCCCGGGG - Intronic
1131119652 15:89814495-89814517 CATCTGGGGAGGGGGCCCCAGGG - Intronic
1131304148 15:91226413-91226435 CATCTGGGTGAGGGATACCCTGG - Exonic
1132610496 16:813639-813661 CATCTGGCTGGTGGAGCCCGGGG + Exonic
1132986008 16:2768022-2768044 CATCAGAGTGGGGCACCCCAGGG - Exonic
1133130659 16:3674470-3674492 CATCTGGATGATGGACCCCAAGG - Exonic
1133788298 16:8989763-8989785 CATCTGGGTGTGGCAGCCAGAGG - Intergenic
1136342935 16:29656788-29656810 CATCTGGGTGGGGAGCCCTGGGG + Intergenic
1139485618 16:67255070-67255092 CATCTCGGCGGTGGACCCCGTGG + Exonic
1141731793 16:85827881-85827903 CATGGGGGTGGGGGCCCCCAGGG + Intergenic
1142143939 16:88484912-88484934 CATCGGGGTGGGGGAACTCCAGG - Intronic
1142262423 16:89049213-89049235 CATGTGGGCGGAGGACCTCGGGG - Intergenic
1142645681 17:1312570-1312592 CAGATGGCTGGGGGACCCCCTGG + Intergenic
1143462113 17:7110358-7110380 CAGCTTGGTGGGGAACACCGTGG - Intronic
1145976198 17:28985832-28985854 CATGTCGGTGGGGGACACAGCGG + Intronic
1146054343 17:29573739-29573761 CAGCTGAGTCGGGGACCCCGGGG + Exonic
1147591997 17:41689502-41689524 CAGCTGGGTGGGGCACCGCCTGG + Intronic
1147962612 17:44177259-44177281 CTCCTGTGTGGGGGAGCCCGCGG + Intronic
1151369305 17:73637861-73637883 CATCTGGGTTGGGCAGCCCCTGG - Intronic
1151621087 17:75245424-75245446 CATCGGGGTGGGGGTCCTCCTGG - Intronic
1152178289 17:78802083-78802105 CAAGGGGGTGGGGGACCGCGTGG - Intronic
1153381707 18:4447583-4447605 CATCTGGGTGGTGGACACAAAGG + Intronic
1153995616 18:10439232-10439254 CTTCTGTGTGGGGGTCCCCATGG + Intergenic
1154390716 18:13934132-13934154 CCTGAGGGTGGGGGACCCTGGGG - Intergenic
1156362834 18:36399541-36399563 TATCTTGGTGGGTGACCCTGAGG + Intronic
1161030927 19:2057495-2057517 CTCCAGGGTGGGGGACCCGGGGG - Intergenic
1161459666 19:4389275-4389297 CATCTGGGTGGGGGACCCCGAGG + Intronic
1163026858 19:14517837-14517859 CATGGGGGTGGGGGAGCCGGGGG - Intronic
1163379024 19:16952127-16952149 CAGCTGGGTGGGTGAGGCCGTGG - Exonic
1163710830 19:18845762-18845784 CAGCTGTGTGGGGGACCGGGGGG + Intronic
1164692610 19:30222517-30222539 AAGCTGAGTGGGGGTCCCCGGGG - Intergenic
1164903635 19:31949117-31949139 CAGCAGGGAGGGGGACCCTGGGG + Intergenic
1166371970 19:42306940-42306962 CATGCGTGTGGGGGAGCCCGAGG + Intronic
1166722666 19:45006046-45006068 CATCTAGGTAGGGAACCCCAGGG - Intronic
1167249560 19:48392899-48392921 CATCTGGGTGTGGGACCCCCGGG + Intergenic
1167281796 19:48573513-48573535 CATGTGGGTGGGGGACAGGGGGG + Intronic
925508087 2:4592116-4592138 CATCTGGGTGGAAGAGCCCTGGG - Intergenic
925836633 2:7952689-7952711 GGTGTGGGTGGGTGACCCCGGGG + Intergenic
925844716 2:8024816-8024838 CAGCTGGGTGAGGCAGCCCGTGG - Intergenic
927698206 2:25251783-25251805 TTTCTGGCTGGGGGACCACGCGG - Intronic
929670963 2:43876202-43876224 CAAATGTGTGGGTGACCCCGTGG + Intronic
929833783 2:45375266-45375288 CTTCTGGGTGGGGGAGCCTCAGG + Intergenic
932779913 2:74553607-74553629 GTTCTGGGTTGGGGACCCAGGGG + Intronic
935146593 2:100399665-100399687 GAGCTGGGTGGGGGGCCCTGAGG - Intronic
942781426 2:179647948-179647970 CATGGGGGTGGGGGACCCTTGGG + Intronic
944221909 2:197311064-197311086 CATATGGGTGGGGAAGCCCGCGG + Intronic
945033732 2:205686655-205686677 CATCTGGGTTGGGGAACCTTCGG + Intronic
945168967 2:206976052-206976074 CTTCTGGGTGGGGGCCACAGAGG + Intergenic
947807647 2:232979619-232979641 CTTCAGGGTGGGGGAGCCTGGGG + Intronic
1169431455 20:5539968-5539990 CCTCTGAGTGGGGGTCCCAGAGG - Intergenic
1175265342 20:57699768-57699790 CACCTGCCTGGGGGAACCCGGGG + Intronic
1175754007 20:61517896-61517918 CATTTGGGGGAGGGACCCTGAGG - Intronic
1175889636 20:62310498-62310520 CATCCGTGTGGGGGCCCCCAGGG + Exonic
1175994229 20:62805149-62805171 GGTCTGGGGGGGGGTCCCCGGGG - Intronic
1178520916 21:33287951-33287973 CAACTGGTTGGAGGACCCAGAGG - Intronic
1179655329 21:42841397-42841419 CAGGTGGGTGTGGGACCCAGGGG - Intergenic
1180988311 22:19918525-19918547 CTTCTGGGAAGGGGACCACGTGG - Intronic
1181085795 22:20438764-20438786 CAGCAGGGTGCGGGTCCCCGGGG + Intronic
1181428331 22:22858420-22858442 CAGCTGGATGTGTGACCCCGAGG + Intronic
1181469506 22:23129109-23129131 CCTCTGGGTGGGGGGCCTGGGGG - Intronic
1182714104 22:32341224-32341246 GGTCTGGGTGGGGGTCCCCAGGG + Intergenic
1183832198 22:40424203-40424225 CACCTGGGTGGGGGATGCAGAGG + Exonic
1184406523 22:44303813-44303835 CACCCGGGTGGGAGACCCTGAGG + Intronic
1185097696 22:48820736-48820758 CCTGTGGGTTGAGGACCCCGGGG + Intronic
1185154867 22:49187500-49187522 CAGCTGTGTGGGGGATTCCGGGG - Intergenic
950426698 3:12928217-12928239 GATCTGGGTGGGGGTGGCCGAGG + Intronic
950446625 3:13042471-13042493 CATGTGAGTGGGGGCCGCCGTGG - Intronic
951761108 3:26148340-26148362 GATCTGGGTGGGGCAGCCAGTGG + Intergenic
952176455 3:30868875-30868897 CATCTGGTTGGGGGAGGCCAAGG + Intronic
958535626 3:95399159-95399181 AATCTGGATAGGGGACCCCAGGG - Intergenic
959551403 3:107663462-107663484 AATCTGGGTGGGGCACACTGTGG - Intronic
961828713 3:129612284-129612306 AATGTGGGTGGGGGCCCCCGCGG - Intergenic
962263295 3:133928363-133928385 CATCTGGGTGCTGGAACCCAAGG - Exonic
963127231 3:141827318-141827340 CAGCTGAGTCGGGGACCCCGGGG + Intergenic
968521885 4:1037816-1037838 CTTCTGGCTGGGAGACCCCAGGG + Intergenic
968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG + Intronic
973754928 4:54064843-54064865 CTTCTGGGTGGCGGACCCTGGGG + Intronic
976060494 4:81122818-81122840 CATCTGGGTGATGGACACTGTGG - Intronic
977600430 4:98929021-98929043 CTTCTGACTGGGGGACTCCGCGG - Intronic
981237851 4:142439009-142439031 CATCTGAGTGGTGCACCCCATGG - Intronic
981270978 4:142846815-142846837 AGTCTGGGTGGGCGACCCAGCGG - Intronic
985528756 5:421461-421483 CATCTGGGTGGGGTCCCGCGGGG + Intronic
985579580 5:689761-689783 CATCTGGGTGGGGGCTGCCCCGG + Intronic
985579618 5:689857-689879 CATCTGGGTGGGGGATCATCTGG + Intronic
985579624 5:689873-689895 CATCTGGGTGGGGGATCATCTGG + Intronic
985579634 5:689905-689927 CATCTGGGTGGGGGATCAACTGG + Intronic
985594426 5:781820-781842 CATCTGGGTGGGGGCTGCCCCGG + Intergenic
985594464 5:781916-781938 CATCTGGGTGGGGGATCATCTGG + Intergenic
985594470 5:781932-781954 CATCTGGGTGGGGGATCATCTGG + Intergenic
985594480 5:781964-781986 CATCTGGGTGGGGGATCAACTGG + Intergenic
985680454 5:1253235-1253257 CACCTGGATGGGGGTCCCTGTGG - Exonic
986321273 5:6633955-6633977 CATCTGGGTGGGGGAGGCTTCGG - Intronic
990594708 5:57301123-57301145 CTTCTGGGTGGGGGCCACAGAGG + Intergenic
997256960 5:132436247-132436269 CATCTTGGTGGGGAAACCCTAGG - Intronic
997606976 5:135182288-135182310 CAGCTGGCTGTGGGACCACGTGG - Intronic
1002288303 5:178180259-178180281 CTGCTGGCTGGGGGACCCCTAGG - Intergenic
1002291331 5:178203034-178203056 CATATGGGTGGTGGGCCCCAAGG - Intergenic
1002874996 6:1202732-1202754 CATCTGGCTGGGGGAAACTGGGG - Intergenic
1017752968 6:157505591-157505613 CATGTGGTTGGGGGAACCAGTGG + Intronic
1019379468 7:713310-713332 CAGGTGGGTGGAGGACCCCGGGG - Intronic
1021498820 7:21306874-21306896 CATCTGGGTGAGGGGCCACAGGG - Intergenic
1025932084 7:66003566-66003588 CATCTAGTTGGGGGAGCCCCGGG + Intergenic
1029456568 7:100675028-100675050 GAGCTGGGTGGGGGACGCCTGGG + Intronic
1031560330 7:123230702-123230724 CTTCTGGGCAGTGGACCCCGTGG + Intergenic
1032745948 7:134786140-134786162 CCTCTGGGTGGTGGATCCCTGGG + Intronic
1033155668 7:138954880-138954902 CATCTGGAAGGGGGACCCAGGGG + Intronic
1033883551 7:145916923-145916945 CATCTAGGTGGGGGTGCCTGTGG - Intergenic
1036979349 8:13451495-13451517 CATCAGGGTGGGGGACTGTGGGG - Intronic
1038019308 8:23539478-23539500 GCTGTGGGTGGGGGACCCGGAGG + Intronic
1038672803 8:29595973-29595995 CAGATGGGTGGGGGACACCTGGG + Intergenic
1039868838 8:41528912-41528934 CTTCTGGGTGGGACCCCCCGGGG + Intergenic
1040482792 8:47841761-47841783 CATCTGCCTGAGGGACCCTGTGG + Intronic
1040939525 8:52818226-52818248 CATCTGGGTGTGAGAGCCTGGGG - Intergenic
1041024544 8:53670328-53670350 CATCTGGGATGGGGCCACCGTGG - Intergenic
1041920671 8:63179726-63179748 CATCTGGGAGGTGTACCCAGCGG - Intronic
1043099903 8:76030833-76030855 CAGCTGTGTGGGGCACCCAGAGG - Intergenic
1045105505 8:98888629-98888651 CATCTGGATGTGGGACCCTCAGG - Intronic
1050906309 9:11011386-11011408 CATCTGAGTAGGGGGCCGCGAGG - Intergenic
1053071906 9:35106743-35106765 CATCCGAGTAGGGGACCCCAGGG - Intronic
1054813040 9:69449901-69449923 CATCTGGGTTGGTGTCCCCAGGG - Intronic
1055332599 9:75199278-75199300 CTTCTGGGTGGGGGCCACAGAGG + Intergenic
1056892900 9:90512800-90512822 CATTTGGGTTGGTGACCCCTTGG + Intergenic
1060281670 9:122219485-122219507 CAGCCGGGTGGCGGAACCCGGGG - Intronic
1060815465 9:126632838-126632860 CTTCTGGGTGTGGGGCCCAGTGG - Intronic
1060827472 9:126695241-126695263 GAGCTGGGTGGGGGTCCCCGAGG - Intronic
1061394565 9:130337018-130337040 CATGGGGGTGGGGGACTCCAAGG - Intronic
1061513238 9:131073390-131073412 CTTCTGGGTGGGGGCACCTGTGG - Intronic
1061878902 9:133558637-133558659 CATCTGGGCGAAGGACCCTGAGG + Intronic
1061908938 9:133712745-133712767 GACATGGGTGGGGGACCCTGGGG - Intronic
1062539308 9:137034574-137034596 CCTCTGGCAGGGGGCCCCCGGGG + Intronic
1185633051 X:1529928-1529950 CATCTGGTGGGTGGATCCCGGGG + Intronic
1186426440 X:9466416-9466438 CAGCTGGCTGGGGGAACACGAGG - Intronic
1187291690 X:17960739-17960761 CATCTTGGTGGGGGCACCCTTGG + Intergenic
1190004582 X:46723253-46723275 TGTCTGGGTGGGGCAGCCCGTGG + Intronic
1190245655 X:48688794-48688816 CCTGGGGGTGGGGGTCCCCGGGG - Exonic
1192928996 X:75784938-75784960 CATGGAGGTGGGGGACCCGGAGG + Exonic
1199748304 X:150790382-150790404 CAGGTGGGTGGGGGACTCCCAGG + Intronic
1200344499 X:155435359-155435381 CATCTATGTTGGGGATCCCGGGG - Intergenic