ID: 1161460713

View in Genome Browser
Species Human (GRCh38)
Location 19:4395524-4395546
Sequence AGGTGAGCACCTGTATTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1008
Summary {0: 1, 1: 0, 2: 1, 3: 92, 4: 914}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161460713_1161460716 2 Left 1161460713 19:4395524-4395546 CCAGGAAATACAGGTGCTCACCT 0: 1
1: 0
2: 1
3: 92
4: 914
Right 1161460716 19:4395549-4395571 TGAAGGCTTATTCATACATATGG 0: 1
1: 0
2: 2
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161460713 Original CRISPR AGGTGAGCACCTGTATTTCC TGG (reversed) Intronic
902258827 1:15208496-15208518 TGGTGTGCACCTGTAATCCCAGG + Intronic
902341776 1:15788156-15788178 TGGTGCGCACCTGTAATCCCAGG + Intergenic
902405092 1:16178332-16178354 TGGTGGGCACCTGTAATCCCAGG - Intergenic
902747716 1:18484377-18484399 AGGAAAGCACCTGTCCTTCCAGG + Exonic
903208112 1:21798213-21798235 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
903915068 1:26757799-26757821 TGGTGGGCACCTGTAATCCCAGG - Intronic
904798649 1:33076960-33076982 TGGTGAGCACCTGTAATCCCAGG - Intronic
905090696 1:35429221-35429243 TGGTGGGCACCTGTAATCCCAGG + Intergenic
905118559 1:35663775-35663797 TGGTAAGCGCCTGTAGTTCCAGG + Intergenic
905845590 1:41228650-41228672 TGGTGCGCACCTGTGGTTCCAGG + Intronic
906386046 1:45369366-45369388 TGGTGGGCACCTGTAATCCCAGG + Intronic
906452828 1:45966587-45966609 TGGTGTGCACCTGTAATCCCAGG + Intronic
906513697 1:46425676-46425698 AGGTGTCCACCTTTATGTCCCGG + Intergenic
906534045 1:46541716-46541738 AGGTGCGCACCTGTAGTCCCAGG - Intergenic
906727012 1:48051522-48051544 TGGTGAACACCTGCAATTCCAGG + Intergenic
906895778 1:49769645-49769667 AGGTGTGCAGCTTTATTTCTGGG - Intronic
907011170 1:50964919-50964941 TGGTGCGCACCTGTAATCCCAGG + Intronic
907693879 1:56701260-56701282 TGGTGTGCACCTGTAATCCCAGG + Intronic
907743775 1:57192182-57192204 TGGTGGGCACCTGTAGTCCCAGG + Intronic
907897094 1:58702136-58702158 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
908204395 1:61830711-61830733 AGATGTGCACCTTTATTTCTAGG - Intronic
909053337 1:70794431-70794453 AGGTGTGCAGCTTTACTTCCAGG - Intergenic
909163063 1:72179313-72179335 AGGTGTGCAGCTTTATTTCTGGG + Intronic
909267620 1:73581001-73581023 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
909376303 1:74946130-74946152 TGGTGCGCACCTGTAATCCCAGG - Intergenic
909679198 1:78272583-78272605 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
909800199 1:79796952-79796974 AGGCCAGCCCCTATATTTCCAGG - Intergenic
909874940 1:80790082-80790104 AGGTGGGCAGCTTTATTTCTGGG - Intergenic
909934688 1:81537830-81537852 TGGTGAACACCTGTAATCCCAGG - Intronic
910184874 1:84527861-84527883 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
910664730 1:89712243-89712265 TGGTAGGCACCTGTAATTCCAGG - Intronic
911538250 1:99126404-99126426 AGGTGTGCAGTTTTATTTCCGGG + Intergenic
911736503 1:101342640-101342662 TGGTGGGCACCTGTAATCCCAGG - Intergenic
911748630 1:101469821-101469843 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
911785108 1:101936788-101936810 AGGTGCGCAGCTTTATTTCTGGG - Intronic
911801579 1:102145827-102145849 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
911900387 1:103495888-103495910 TGGTGGGCACCTGTAATCCCAGG + Intergenic
912249767 1:107999083-107999105 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
912588960 1:110794814-110794836 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
912857499 1:113183314-113183336 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
912871284 1:113309451-113309473 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
912957048 1:114162177-114162199 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
913693479 1:121301570-121301592 TGGTGCGCACCTGTAATCCCAGG - Intronic
914144077 1:144978510-144978532 TGGTGCGCACCTGTAATCCCAGG + Intronic
915207383 1:154280186-154280208 TGGTGGGCACCTGTAATCCCAGG + Intergenic
915402948 1:155637120-155637142 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
915817346 1:158982451-158982473 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
915849356 1:159304472-159304494 TGGTGGGCACCTGTAGTCCCAGG + Intronic
915929427 1:160050264-160050286 TGGTGTGCACCTGTAGTCCCAGG - Intronic
916038709 1:160943984-160944006 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
916410127 1:164539018-164539040 TGGTGTGCACCTGTAATCCCAGG + Intergenic
916689883 1:167180097-167180119 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
916690964 1:167189869-167189891 TGGCGTGCACCTGTAATTCCAGG - Intergenic
916969315 1:169993750-169993772 TGGTGTGCACCTGTAATCCCAGG + Intronic
917049256 1:170900420-170900442 TGGTGGGCACCTGTAATCCCAGG + Intergenic
917197859 1:172485306-172485328 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
917899702 1:179530160-179530182 TGGTGGGCACCTGTAATCCCAGG - Intronic
917944546 1:179955141-179955163 AGGTGAGCTCCTGTAGGACCTGG + Exonic
918024527 1:180730198-180730220 AGGTGTGCAGCTTTATTTCTGGG + Intronic
918184153 1:182112408-182112430 TGGTGGGCACCTGTAATCCCAGG - Intergenic
918947868 1:191093191-191093213 AGGTGGGCAGCTTTATTTCTGGG - Intergenic
918978222 1:191518836-191518858 TGGTGTGCACCTGTAGTGCCAGG - Intergenic
919035987 1:192309375-192309397 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
919282494 1:195509169-195509191 TGATGCGCACCTGTATTCCCAGG - Intergenic
919287522 1:195583089-195583111 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
919886044 1:201935687-201935709 TGGTGGGCACCTGTAATCCCAGG - Intronic
919999468 1:202786130-202786152 TGGTGTGCACCTGTATTCCCAGG - Intronic
920480803 1:206319939-206319961 TGGTGCGCACCTGTAATCCCAGG - Intronic
920609335 1:207422236-207422258 AGCTGAGCTCCAGTATTTCTTGG - Intergenic
921349509 1:214221411-214221433 TGGTGGGCGCCTGTAGTTCCAGG - Intergenic
922711229 1:227834534-227834556 TGGTGTGCACCTGTAATCCCAGG + Intronic
923574314 1:235144042-235144064 TGGCGAGCACCTGTAGTCCCAGG + Intronic
923596094 1:235361746-235361768 TGGTGAGCGCCTGTAATCCCAGG - Intergenic
923645535 1:235816744-235816766 AGGTGTGCAGCTTTATTTCTGGG - Intronic
923707903 1:236360187-236360209 TGGTGTACACCTGTAGTTCCAGG + Intronic
924324679 1:242883651-242883673 AGGTGTGCATCTTTATTTCTGGG - Intergenic
924533668 1:244915415-244915437 TGGTGCGCACCTGTAGTCCCAGG + Intergenic
924757888 1:246958189-246958211 TGGTGTGCACCTGTAGTCCCAGG - Intronic
924802168 1:247335490-247335512 AAGTGAGCACCTGTGTTTCAAGG + Intergenic
1062987261 10:1780285-1780307 AGGTGGGCAGGTGTATGTCCCGG + Intergenic
1063165630 10:3459344-3459366 TGGCGAGCACCTGTAGTCCCAGG + Intergenic
1063352860 10:5372680-5372702 TGGTGTGCACCTGCATTCCCAGG - Intronic
1064143462 10:12808982-12809004 TGGTGTGCACCTGTAATCCCAGG + Intronic
1064161588 10:12951241-12951263 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1064195306 10:13239360-13239382 TGGTGTGCACCTGTATTCCCAGG + Intergenic
1064200839 10:13283501-13283523 AGGTAAGCAAATATATTTCCTGG + Intronic
1064294311 10:14064708-14064730 TGGTGAGCACCTGTAGTCCCAGG - Intronic
1064377286 10:14808707-14808729 AGGGGAACACCTGGATTTCTGGG + Intergenic
1064776494 10:18783865-18783887 AGGTGGGCAACTTTATTTCTGGG + Intergenic
1064818846 10:19300539-19300561 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1065890918 10:30120340-30120362 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1067436160 10:46280316-46280338 AGGTGTGCACCTGTAGTCTCAGG - Intergenic
1068071450 10:52201364-52201386 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1068396456 10:56467930-56467952 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1068640546 10:59400431-59400453 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1068997449 10:63223884-63223906 TGGTGGGCACCTGTAATCCCAGG - Intronic
1069634821 10:69918711-69918733 ATTTGAGCACTTGTTTTTCCAGG - Intronic
1069684852 10:70311352-70311374 TGGTGTGCACCTGTAATCCCAGG - Intronic
1069685946 10:70318619-70318641 TGGTGTGCACCTGTGGTTCCAGG + Intronic
1070106378 10:73435800-73435822 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1070238141 10:74652172-74652194 TGGTGGGCACCTGTAATCCCAGG - Intronic
1070449815 10:76546851-76546873 AGGTGATCATCTGTTGTTCCAGG + Intronic
1070566065 10:77604848-77604870 AGGCCAGGACCTGCATTTCCAGG - Intronic
1071039664 10:81291521-81291543 AGGTGTGCAACTTTATTTCTAGG - Intergenic
1071163373 10:82778066-82778088 AGCAGAGCAGCTGTATTCCCTGG - Intronic
1071230829 10:83582579-83582601 AAGTGATCACCTGTATGCCCTGG - Intergenic
1072239993 10:93487180-93487202 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1072282287 10:93877721-93877743 TGGTGTGCACCTGTAGTCCCGGG + Intergenic
1072496962 10:95971254-95971276 TGGTGGGCACCTGTAATCCCTGG + Intronic
1072837451 10:98731140-98731162 AGGTGTGCACCTCTAATGCCTGG - Intronic
1072955982 10:99888341-99888363 TGGTGGGCACCTGTAATCCCAGG - Intronic
1073934234 10:108611661-108611683 TGGTGTGGGCCTGTATTTCCAGG + Intergenic
1073951381 10:108813543-108813565 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1073973827 10:109076437-109076459 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1074190686 10:111132965-111132987 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1074374206 10:112925667-112925689 TGGTGTGCACCTGTAATCCCAGG + Intergenic
1074718731 10:116246296-116246318 TGGTGGGCACCTGTAATCCCAGG + Intronic
1075067514 10:119299309-119299331 TGGCGGGCACCTGTAATTCCAGG + Intronic
1075186010 10:120258058-120258080 AGATGTGCAGCTTTATTTCCGGG + Intergenic
1076015479 10:127024244-127024266 AGGGCAGCACCTATGTTTCCAGG - Intronic
1076039265 10:127229100-127229122 TGGTGCGCACCTGTAATCCCAGG + Intronic
1076398527 10:130160448-130160470 AGGTGCACACCTGTGCTTCCAGG + Intronic
1076609786 10:131716703-131716725 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1076681300 10:132172878-132172900 TGGTTTGCACATGTATTTCCAGG - Intronic
1076757852 10:132583356-132583378 ATGTGAGCACCTTTTTCTCCAGG + Intronic
1077161635 11:1115597-1115619 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1077574136 11:3366930-3366952 CGGTGTGCCCCTGTAGTTCCAGG + Intronic
1078044199 11:7898463-7898485 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1078661240 11:13288062-13288084 AGGTGAGGACAGGTATTTCCAGG + Intronic
1078694368 11:13615624-13615646 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1078888061 11:15525805-15525827 AGGCCAGCACCTGTAACTCCAGG + Intergenic
1079992419 11:27260333-27260355 AGGTGTGCAACTTTATTTCTGGG - Intergenic
1080023523 11:27589597-27589619 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1080080776 11:28215882-28215904 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1080472640 11:32560945-32560967 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1080697463 11:34615342-34615364 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1080818291 11:35779916-35779938 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1081095724 11:38932003-38932025 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1081580969 11:44351493-44351515 GGCTGAGCACCTGGATGTCCTGG + Intergenic
1081857020 11:46310398-46310420 TGGTGGGCACCTGTAATCCCAGG - Intronic
1082294057 11:50416812-50416834 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1083388397 11:62329820-62329842 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1083444812 11:62700818-62700840 TGGTGGGCACCTGTAATCCCAGG + Intronic
1083538998 11:63498619-63498641 AGGTGAGCAACTGTGGTACCTGG - Intergenic
1083588406 11:63877241-63877263 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1083850620 11:65364406-65364428 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1084115216 11:67039168-67039190 TGGTGTGCACCTGTAATCCCGGG + Intronic
1084132419 11:67146639-67146661 TGGTAAGCACCTGTAGTCCCTGG - Intronic
1084690675 11:70724166-70724188 TGGTGTGCACCTGTAATCCCAGG - Intronic
1084788869 11:71460481-71460503 TGGTGTGCACCTGTAGTCCCGGG - Intronic
1084871061 11:72098771-72098793 AGGTGCTCACCTGTACTGCCTGG + Exonic
1084926347 11:72515619-72515641 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1085172369 11:74460225-74460247 AGATGAGAACGTGTATCTCCTGG - Intronic
1085567218 11:77525214-77525236 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1085595300 11:77803644-77803666 TGGTGCGCACCTGTAATCCCAGG + Intronic
1085876374 11:80411217-80411239 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1085901591 11:80706688-80706710 AGGTGTGCAGCTCTATTTCTGGG - Intergenic
1086045877 11:82530971-82530993 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1086361283 11:86062383-86062405 TGGTGGGCACCTGTAATCCCAGG + Intronic
1086393795 11:86393193-86393215 TGGCGCGCACCTGTAATTCCAGG - Intronic
1086523081 11:87693827-87693849 AGGTGTGCAGCTTTATTTCTTGG + Intergenic
1087380575 11:97399572-97399594 AGGTGAGCACTTGTAGTACCTGG - Intergenic
1087669356 11:101087262-101087284 AGGTGTGCACCTTTATTTCTGGG - Intronic
1088642599 11:111887703-111887725 TGGTGTGCACCTGTAATCCCAGG + Intergenic
1088643800 11:111899162-111899184 TGGTGCACACCTGTAGTTCCAGG - Intergenic
1088863756 11:113826440-113826462 TGGTGTGCACCTGTAGTCCCAGG - Intronic
1089158409 11:116419748-116419770 TGGTGTGCACCTGTAGTTCCAGG - Intergenic
1089302870 11:117509145-117509167 AGCTCAGCATCTGTATATCCAGG - Intronic
1089380333 11:118026103-118026125 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1089558928 11:119333785-119333807 TGGTGGGCACCTGTACTACCCGG + Intergenic
1090278773 11:125438544-125438566 AGGAGAGCAGCTGCATTCCCAGG - Intergenic
1090659854 11:128874188-128874210 AGGTGAGCAACTGTGGTTCAGGG - Intergenic
1091467010 12:693547-693569 TGGTGCGCACCTGTAGTCCCAGG + Intergenic
1091500379 12:1011146-1011168 AGGAGAGCCACTGTAATTCCAGG - Intronic
1092157753 12:6295387-6295409 AGGTGAGGCCCTGGATTTCCTGG + Intergenic
1092441204 12:8506318-8506340 AGGTGTGCAGCTTTATTTCTTGG + Intergenic
1092608699 12:10149195-10149217 AGGTGTGCAACTTTATTTCTGGG + Intergenic
1093019504 12:14189998-14190020 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1093394610 12:18665800-18665822 TGGTGCGCACCTGTAGTCCCAGG + Intergenic
1093491112 12:19705597-19705619 AGGTGTGTACCTCTATTTCTGGG - Intronic
1093545939 12:20348126-20348148 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1093753276 12:22825860-22825882 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1093786975 12:23203825-23203847 AGGGAAGAACCTGTATTTCTGGG - Intergenic
1093970633 12:25372609-25372631 TGGTGCACACCTGTAGTTCCAGG + Intergenic
1094385761 12:29891551-29891573 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
1095218594 12:39580100-39580122 AAGTGAGCAACTGTAGTTCATGG + Intronic
1095551420 12:43445717-43445739 TGGTGAACACCTGTAGTTCTAGG + Intronic
1095816465 12:46427961-46427983 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1096010209 12:48207248-48207270 AGGTGTGCAACTTTATTTCTGGG - Intergenic
1096221249 12:49829230-49829252 AGGTGAGAACCTACATTTCTGGG - Intergenic
1096429102 12:51528748-51528770 AGCTGAGCATCAGTATATCCTGG + Intergenic
1096944068 12:55384253-55384275 GGGTGAGCAACTTTATTTCTGGG + Intergenic
1097323967 12:58255041-58255063 AGGTGATCACCTCTTCTTCCTGG + Intergenic
1097439480 12:59592278-59592300 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1097751826 12:63363590-63363612 AGGTGTGCAACTTTATTTCTGGG + Intergenic
1097946710 12:65376919-65376941 AGGAGAGCACTTGTATTTACAGG - Intronic
1098104432 12:67054629-67054651 TGGTGCGCACCTGTAATCCCAGG + Intergenic
1098251064 12:68570032-68570054 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1098487153 12:71034709-71034731 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1100094442 12:91014889-91014911 AGGTGTTCACCTTTATTTCTCGG - Intergenic
1100564750 12:95784632-95784654 TGGTGTGCACCTGTAATCCCAGG + Intronic
1100928535 12:99579029-99579051 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1100972264 12:100082701-100082723 AGGTGTGCAGCTTTATTTCTAGG + Intronic
1101180273 12:102209183-102209205 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1102022171 12:109691314-109691336 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1102037227 12:109778393-109778415 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1102152392 12:110697782-110697804 TGGTGTGCACCTGTAATCCCAGG - Intronic
1102181243 12:110913883-110913905 TGGTGTGCACCTGTAGTCCCAGG - Intronic
1102595393 12:113988470-113988492 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1102672637 12:114633080-114633102 TGGTGCGCACCTGTAATTCCAGG - Intergenic
1102686229 12:114726919-114726941 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1103093490 12:118114497-118114519 TGTTGAGCACCTGTAATCCCAGG - Intronic
1103251112 12:119500719-119500741 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1103659706 12:122503947-122503969 TGGTGAGCACCTGTGGTCCCAGG + Intergenic
1104154878 12:126121628-126121650 TGGTGGGCACCTGTAGTTCCAGG + Intergenic
1104288225 12:127444854-127444876 AGGTGTGCACCTGTAGTCCTGGG - Intergenic
1104288695 12:127448477-127448499 TGGTGGGCACCTGTAATGCCAGG + Intergenic
1104297082 12:127526217-127526239 TGGTGTGCACCTGTAGTCCCGGG + Intergenic
1104582396 12:130020626-130020648 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1104907440 12:132221218-132221240 TGGTGGGCACCTGTAATCCCAGG + Intronic
1105235843 13:18552833-18552855 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1105300960 13:19134174-19134196 TGGTGCGCACCTGTAATCCCAGG - Intergenic
1105622741 13:22084613-22084635 AGGTGAACACCTGTGTTTGGTGG - Intergenic
1105802460 13:23919800-23919822 AGGTGTGCATCTTTATTTCTTGG - Intergenic
1105822445 13:24091676-24091698 TGGTGTGCACCTGTAATCCCAGG + Intronic
1105925067 13:25000579-25000601 TGGTGCGGACCTGTATTCCCAGG - Intergenic
1106372621 13:29150854-29150876 AGGTGTGCAGCTTTATTTCTAGG + Intronic
1106879648 13:34115242-34115264 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1107187021 13:37535264-37535286 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1107275058 13:38668635-38668657 TGGTGCGCACCTGTAATTCCAGG - Intergenic
1107309083 13:39057362-39057384 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1107457445 13:40567833-40567855 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1107471031 13:40691494-40691516 AGGTGTGCAGCTTTATTTCTCGG - Intergenic
1108155700 13:47582881-47582903 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1108605927 13:52038582-52038604 AGGTGAGCACCACTATGCCCAGG + Intronic
1108990575 13:56651953-56651975 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1109078715 13:57870444-57870466 ATGTGTGCAGTTGTATTTCCGGG - Intergenic
1109824192 13:67696786-67696808 AGGTGAGCACTTACATTACCTGG + Intergenic
1109982385 13:69924922-69924944 GGGTGAGCAGCTCTATTTGCTGG - Intronic
1110101376 13:71609656-71609678 TGGTGAGCACGTGTAATCCCAGG - Intronic
1110664357 13:78099197-78099219 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1110849918 13:80233091-80233113 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1110989932 13:82027259-82027281 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1110995417 13:82101816-82101838 TGGTGCGCACCTGTAGTTCCAGG - Intergenic
1111179269 13:84640655-84640677 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1111229179 13:85318513-85318535 TGGTGTGCACCTGTAATCCCAGG + Intergenic
1111762379 13:92481996-92482018 GGGTGGGCACCTGTAATCCCAGG + Intronic
1112499709 13:99933324-99933346 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1112789893 13:102991664-102991686 TGGTGTGCACCTGTACTTCCAGG + Intergenic
1113123707 13:106953162-106953184 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1113562030 13:111289162-111289184 TGGTGCGCACCTGTAATCCCAGG - Intronic
1113586056 13:111466379-111466401 AGGTGTGCAGCTTTATTTCAGGG + Intergenic
1113697965 13:112361436-112361458 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1113850727 13:113416214-113416236 ACCTGAGTATCTGTATTTCCTGG + Intergenic
1114154111 14:20079946-20079968 AGGTGTGCAACTTTATTTCTGGG - Intergenic
1114937251 14:27556074-27556096 AGGTGTGCAGTTTTATTTCCAGG - Intergenic
1115641038 14:35335763-35335785 GGGAAAACACCTGTATTTCCAGG + Intergenic
1115890929 14:38027984-38028006 AGGTGTGCAGCTTTATTTCAGGG - Intronic
1116024889 14:39503057-39503079 AGGTGTGCAGCTTTATTTCAGGG + Intergenic
1116131704 14:40862661-40862683 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1116238924 14:42315442-42315464 GGGTGTGCACCAGTAGTTCCAGG + Intergenic
1116450465 14:45059205-45059227 TGGTGTGCACCTGTAGTCCCAGG - Intronic
1116457246 14:45134134-45134156 AGGGGAGCAGCTTTATTTCTTGG - Intronic
1116813493 14:49562195-49562217 AGGTGTGCAGCTATATTTCTGGG + Intergenic
1116839356 14:49804135-49804157 TGGTGCGCACCTGTAATCCCAGG - Intronic
1116925048 14:50625775-50625797 AGGCGGGCACCTGTAGTCCCAGG + Intronic
1117265033 14:54077541-54077563 AGGTGAGCACTTATAGTACCTGG - Intergenic
1117345904 14:54832136-54832158 AGGTGTGCAGCTTTATTTCCGGG + Intergenic
1117671746 14:58114772-58114794 AGGTGTGCAGCTTTATTTCTTGG - Intronic
1117851159 14:59971239-59971261 AGGTGTGCAACCTTATTTCCAGG + Intronic
1118215576 14:63805051-63805073 AGGTGTGCAACTTTATTTCTGGG + Intergenic
1119490858 14:75031679-75031701 TGGTGCTCACCTGTAGTTCCAGG + Intronic
1119845782 14:77828658-77828680 TGGTGGGCACCTGTAATCCCAGG - Intronic
1119902991 14:78277156-78277178 TGGTCAGCACCTGGATTTCCTGG + Intronic
1119996415 14:79258335-79258357 TGGTGCGCACCTGTAATCCCAGG - Intronic
1121055877 14:90852225-90852247 TGGTGGGCACCTGTAGTCCCAGG - Exonic
1121091431 14:91185413-91185435 TGGTGCGCACCTGTAGTGCCAGG - Intronic
1121160016 14:91729204-91729226 TGGTGGGCACCTGTAATCCCAGG + Intronic
1121195646 14:92069201-92069223 TGGTGGGCACCTGTAATCCCAGG - Intronic
1121507610 14:94488708-94488730 AGGTGAGCACCTGACTGTCTGGG - Intronic
1121859680 14:97305451-97305473 AGTTCTGCAACTGTATTTCCAGG - Intergenic
1122010412 14:98741732-98741754 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1122749600 14:103922848-103922870 TGGTGCGCACCTGTAATTCCAGG + Intronic
1122914454 14:104851476-104851498 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1123050696 14:105540589-105540611 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1123147395 14:106146280-106146302 AGGTGAGCACCTCACTTACCAGG + Intergenic
1123769615 15:23515751-23515773 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1124426361 15:29566587-29566609 TGGTGGGCACCTGTAATCCCAGG - Intronic
1125559246 15:40614228-40614250 TGGTGTGCACCTGTAGTCCCAGG - Intronic
1125582423 15:40795760-40795782 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1125774890 15:42203504-42203526 TGGTGAGCACCTGTAATCCCAGG + Intronic
1125818405 15:42606586-42606608 TGGTGCGCACCTGTGTTCCCAGG - Intronic
1125833015 15:42729547-42729569 CGGTGAGCACCGGTCTTCCCTGG - Exonic
1126455188 15:48853669-48853691 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1127449620 15:59103942-59103964 TGGTGAGCACCTGTAGTCCCAGG - Intergenic
1127767882 15:62205427-62205449 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1128412381 15:67412529-67412551 TGGTGGGCACCTGTAATCCCAGG - Intronic
1128680934 15:69650894-69650916 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1128874623 15:71192033-71192055 TGGTGGGCACCTGTAATCCCAGG - Intronic
1129111196 15:73338304-73338326 GGTTGAGCACCTTCATTTCCAGG + Intronic
1129284615 15:74514495-74514517 TGGTGGGCATCTGTAATTCCAGG + Intergenic
1129560142 15:76557830-76557852 AGGTGAGCAGCTTTATTTCTGGG - Intronic
1130246758 15:82258416-82258438 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1130309118 15:82737473-82737495 TGGTGCGCACCTGTAATCCCAGG + Intergenic
1130397785 15:83518979-83519001 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1131073665 15:89481315-89481337 TGGTGTGCACCTGTAATTCCAGG + Intronic
1131148603 15:90032643-90032665 TGGTGGGCACCTGTAATCCCAGG + Intronic
1131380492 15:91959597-91959619 TGGTGGGCACCTGTAATCCCAGG + Intronic
1131929995 15:97431233-97431255 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1132046203 15:98564746-98564768 AGGTGAGGAAATGCATTTCCTGG + Intergenic
1132245213 15:100290686-100290708 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1132388463 15:101420056-101420078 TGGTGGGCACCTGTAATCCCAGG + Intronic
1132425664 15:101714470-101714492 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1133010648 16:2909290-2909312 TGGTGTGCACCTGTAGTGCCAGG + Intergenic
1133968662 16:10550840-10550862 TGGTGGGCACCTGTAATTCCAGG + Intronic
1134259667 16:12640815-12640837 ATGGAAGCACCTGTGTTTCCTGG + Intergenic
1134342654 16:13359348-13359370 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1134532664 16:14996722-14996744 TGGCGAGCACTTGTATTCCCAGG + Intronic
1134778437 16:16873240-16873262 TGGTGGGCACCTGTAATTCCAGG + Intergenic
1134816959 16:17213749-17213771 GGGTGGGCACCTGTAATCCCAGG - Intronic
1134842562 16:17413568-17413590 TGGTGAGCACCTGTAGTCCCAGG - Intronic
1135525514 16:23210892-23210914 AGGTGTGCACCAGTATGCCCAGG - Intronic
1135788882 16:25375393-25375415 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1136252958 16:29018665-29018687 TGGCGAGCACCTGTAGTCCCAGG - Intergenic
1136691345 16:32033164-32033186 AGGTGAGCACCTCACTTACCAGG - Intergenic
1136772652 16:32855373-32855395 AGGTGAGCTCCTCACTTTCCAGG - Intergenic
1136791933 16:32976729-32976751 AGGTGAGCACCTCACTTACCAGG - Intergenic
1136877884 16:33877179-33877201 AGGTGAGCACCTCACTTACCAGG + Intergenic
1136897962 16:34006146-34006168 AGGTGAGCTCCTCACTTTCCAGG + Intergenic
1137645796 16:50072835-50072857 AGCTCAGCACCTGTTTTTTCTGG + Intronic
1138003809 16:53311051-53311073 TGGTGTGCCCCTGTAGTTCCAGG + Intronic
1138483664 16:57321112-57321134 TGGTGTGCACCTGTAATCCCAGG + Intergenic
1138587937 16:57984034-57984056 TGGCGAGCACCTGTAATCCCGGG - Intronic
1139092998 16:63671750-63671772 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1139422638 16:66858100-66858122 TGGTGTGCACCTGTAATCCCAGG + Intronic
1139494477 16:67306396-67306418 TGGTGGGCACCTGTAATCCCAGG - Intronic
1139642791 16:68304918-68304940 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1139863368 16:70044011-70044033 TGGCGAGCACTTGTATTCCCAGG - Intergenic
1139945688 16:70640272-70640294 TGGTGTGCACCTGTAGTCCCAGG - Intronic
1139953732 16:70683833-70683855 AGCTGACCACCTGGATTTGCGGG - Intronic
1140075151 16:71691826-71691848 AAGTGTGCACCTGTAGTCCCAGG + Intronic
1140110038 16:71996391-71996413 TGGTGTGCACCTGTAGTCCCAGG - Intronic
1140226720 16:73083660-73083682 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
1140286826 16:73610881-73610903 AGCCGAGCAACTGTATTTCAGGG + Intergenic
1140363446 16:74363735-74363757 AGGAGATTACCTGTATTTGCGGG - Intergenic
1140913145 16:79471542-79471564 TGGTGCACACCTGTAGTTCCAGG + Intergenic
1141361001 16:83395013-83395035 TGGTGGGCACCTGTAATCCCAGG + Intronic
1141454426 16:84130451-84130473 AAGTGAGCATGTGTATTTCACGG + Intronic
1141732452 16:85832001-85832023 TGGTGTGCACCTGTAGTTCCAGG + Intergenic
1142329255 16:89440481-89440503 AGGTGTGCACCTGTAGTCCCAGG + Intronic
1203075077 16_KI270728v1_random:1117483-1117505 AGGTGAGCTCCTCACTTTCCAGG - Intergenic
1203094144 16_KI270728v1_random:1238193-1238215 AGGTGAGCACCTCACTTACCAGG - Intergenic
1142819226 17:2451486-2451508 TGGTGCGCACCTGTAGTTCCAGG + Intronic
1142860565 17:2758306-2758328 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
1142862919 17:2774400-2774422 AGCTGAGCAGTTGTATTTCTGGG + Intergenic
1143780166 17:9225127-9225149 TGGTGTGCACCTGTAATCCCAGG + Intronic
1143942800 17:10560207-10560229 TGGTGGGCGCCTGTAATTCCAGG - Intergenic
1143956252 17:10671857-10671879 GCGTGAGCACCTGTAATCCCAGG + Intergenic
1144061391 17:11585697-11585719 AGGTGAGCCCAAGTATTTTCAGG - Intergenic
1144542410 17:16157191-16157213 AAGGGAGCAACTGTATATCCTGG + Intronic
1145372725 17:22320574-22320596 GTGTGTGCACCTGTAATTCCAGG + Intergenic
1146036038 17:29407577-29407599 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1146040774 17:29452081-29452103 TGGTGCACACCTGTAGTTCCAGG + Intronic
1146049377 17:29536830-29536852 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1146085624 17:29825913-29825935 AGGTAAGCAGCAGTATTTCCTGG - Intronic
1146545912 17:33738385-33738407 AAGTCAGCACCTGCATTTTCTGG + Intronic
1147023649 17:37560795-37560817 TGGTGCGCACCTGTAGTCCCGGG - Intronic
1147255234 17:39177334-39177356 AGGTGAGCACCTGTACCTGGAGG + Exonic
1147365864 17:39958731-39958753 TGGTGCGCACCTGTAGTCCCAGG + Intergenic
1147591653 17:41687824-41687846 ATGTAAACACCTGGATTTCCTGG + Intergenic
1148181033 17:45605016-45605038 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1148267876 17:46240912-46240934 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1148651094 17:49250536-49250558 TGGTGCGCACCTGTAGTCCCAGG + Intergenic
1148901686 17:50883453-50883475 TGGCGTGCACCTGTAGTTCCAGG + Intergenic
1149886668 17:60347315-60347337 TGGTGCGCACCTGTATTCCCAGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150390986 17:64789788-64789810 AGGGGAGAACCTGGCTTTCCTGG - Intergenic
1152176702 17:78792623-78792645 AAGTGAGCACCAGAATTGCCAGG - Intronic
1152837437 17:82542883-82542905 TGGTGCGCACCTGTAGTCCCAGG + Intronic
1153680415 18:7495368-7495390 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1154513698 18:15137165-15137187 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1155480321 18:26279689-26279711 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1155620114 18:27768708-27768730 GGGTGCACACCTGTAGTTCCAGG - Intergenic
1155703443 18:28778689-28778711 AGGTGAGAACAGGTATTTCCCGG + Intergenic
1156070589 18:33202257-33202279 TGGTGCGCACCTGTAATTCCAGG + Intronic
1156674949 18:39516303-39516325 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1156689020 18:39684063-39684085 TGGTGAGCGCCTGTAATCCCAGG + Intergenic
1156954862 18:42950235-42950257 AGGTGTGCAGCTTTATTTCCGGG - Intronic
1158379506 18:56913660-56913682 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1158685872 18:59614004-59614026 AAGTGTGCACCTGTAATCCCAGG - Intronic
1158991600 18:62874374-62874396 TGGTGCGCACCTGTAATCCCAGG + Intronic
1159088935 18:63824707-63824729 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1159111370 18:64060286-64060308 AGGTGTGCACCTTTATTTCTGGG + Intergenic
1159641458 18:70867275-70867297 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1159949706 18:74474084-74474106 AGGAGTGCAACTATATTTCCAGG + Intergenic
1160109278 18:76010189-76010211 AGGTGTGCAGCTTTATTTCTTGG + Intergenic
1160850318 19:1188172-1188194 TGGTGGGCGCCTGTAGTTCCAGG - Intronic
1160983010 19:1825165-1825187 TGGTGGGCACCTGTAATCCCAGG + Intronic
1161018577 19:1996750-1996772 TGGTGAACACCTGTAATCCCAGG + Intronic
1161201730 19:3019029-3019051 TGGTGCACACCTGTATTCCCAGG - Intronic
1161363844 19:3867672-3867694 GGGTGGGCACCTGGGTTTCCAGG - Intronic
1161460713 19:4395524-4395546 AGGTGAGCACCTGTATTTCCTGG - Intronic
1161485385 19:4532799-4532821 TGGTGTGCACCTGTAATCCCAGG - Intronic
1162612107 19:11764460-11764482 AGGTGAGCAGCATTATTTCTAGG + Intergenic
1162613445 19:11775460-11775482 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1162689926 19:12421082-12421104 TGGTGGGCACCTGTAATCCCAGG + Intronic
1162989834 19:14294777-14294799 TGGTGGGCGCCTGTAGTTCCAGG + Intergenic
1163134686 19:15301426-15301448 TGGTGCGCACCTGTAATCCCAGG + Intronic
1163305901 19:16478684-16478706 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
1163788805 19:19293449-19293471 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1164651916 19:29896831-29896853 TGGTGCACACCTGTATTCCCAGG + Intergenic
1164786365 19:30934300-30934322 TGGTGGGCACCTATAGTTCCAGG - Intergenic
1164792370 19:30998336-30998358 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1165051670 19:33145665-33145687 TGGTGTGCACCTGTAGTCCCAGG - Intronic
1165241492 19:34472002-34472024 TGGTGAGCTCCTGTAGTTCCAGG - Intergenic
1165508312 19:36249246-36249268 TGGTGGGCGCCTGTATTCCCAGG + Intergenic
1165571747 19:36781106-36781128 GTGTGTGCACCTGTAATTCCAGG - Intergenic
1165589970 19:36960248-36960270 TGGTGAGCACCTGTAATCCCAGG - Intronic
1165663505 19:37604438-37604460 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1165971920 19:39638922-39638944 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1166052916 19:40271292-40271314 TGGTGTGCACCTGTAGTTTCAGG + Intronic
1166501929 19:43348023-43348045 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1166508187 19:43385428-43385450 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1166800974 19:45456693-45456715 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1166828368 19:45623399-45623421 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1166903514 19:46086454-46086476 TGGTGCGCACCTGTAATTCCAGG - Intergenic
1166991148 19:46693567-46693589 TGGTGCACACCTGTAGTTCCAGG - Intronic
1167128760 19:47570442-47570464 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1167375769 19:49110468-49110490 TAGTGAGCACCTGTAATCCCAGG + Intergenic
1168264556 19:55215151-55215173 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1168482090 19:56729149-56729171 AGGTGAGTAGCTTTATTTCTGGG - Intergenic
1168622695 19:57891884-57891906 TGGTGCGCACCTGTAGTCCCAGG - Intronic
925017274 2:540228-540250 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
925545381 2:5010172-5010194 ATGTGGGCACCTCTATTTCATGG - Intergenic
925680885 2:6420340-6420362 AGGGAAGCTCCTGTATTTACTGG - Intergenic
926697086 2:15778323-15778345 TGGTGCACACCTGTAATTCCAGG - Intergenic
926891782 2:17644877-17644899 GGTTGAGCAACTGTATTTCAGGG + Intronic
927953806 2:27193498-27193520 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
928080890 2:28311126-28311148 TGGTGGGCACCTGTAGTCCCAGG + Intronic
928347345 2:30512600-30512622 ATGTGAGTACATGTATTTCTAGG - Intronic
928375779 2:30772177-30772199 AGGCCACCACCTGCATTTCCTGG + Intronic
928559082 2:32460407-32460429 TGGTGGGCACCTGTAATCCCAGG - Intronic
928597607 2:32870870-32870892 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
928630634 2:33188286-33188308 TGGTGGGCACCTGTAATCCCAGG + Intronic
928693816 2:33828006-33828028 AGGTGTACAGCTGTATTTCTGGG + Intergenic
928952890 2:36830180-36830202 TGGCGAGCACCTGTAGTCCCAGG + Intergenic
929118275 2:38463263-38463285 GGGTGTGCACCTGTAATCCCAGG - Intergenic
929153903 2:38772536-38772558 TGGTGGGCACCTGTAATCCCAGG - Intronic
929407003 2:41653913-41653935 TGGTGGGCACCTGTAATCCCAGG - Intergenic
930211215 2:48639379-48639401 AGGTGTGCAGCCTTATTTCCTGG - Intronic
930528988 2:52568124-52568146 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
930598698 2:53418951-53418973 AGGTGTGCAACTTTATTTCTAGG + Intergenic
930616570 2:53600252-53600274 TGGTGCGCACCTGTAGTTCCAGG - Intronic
930748956 2:54913968-54913990 AGGTGTGCAGCTTTATTTCTGGG + Intronic
931583826 2:63805985-63806007 TGGTGAGCACCTGTAGTCCCAGG + Intronic
931913570 2:66928590-66928612 AGGTGGTCACCTGTACTTTCTGG + Intergenic
932046392 2:68354785-68354807 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
932141744 2:69284757-69284779 TGGTGAGCACCTGTAATCCCAGG - Intergenic
932389497 2:71373575-71373597 TGGCGAGCACCTGTAGTCCCAGG - Intronic
932498888 2:72162825-72162847 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
932880479 2:75496868-75496890 AGGTGTGCAGCTTTATTTCTGGG - Intronic
933516736 2:83313384-83313406 TGGTGGGCACCTGTAATCCCAGG + Intergenic
933605694 2:84380427-84380449 AGGTGCGCAGCTTTATTTCTGGG - Intergenic
933642096 2:84774374-84774396 AGGTGTGCAGCTTTATTTCTGGG + Intronic
935004313 2:99056070-99056092 TGGTGGGCACCTGTAGTCCCAGG + Intronic
935323747 2:101915299-101915321 TGGTGGGCACCTGTAATCCCAGG + Intergenic
935474711 2:103504493-103504515 AGGTGTGCAGTTGTATTTCTGGG - Intergenic
935993033 2:108738759-108738781 TGGTAGGCACCTGTAATTCCAGG - Intronic
937128439 2:119489147-119489169 AGGTGAGTCCCTGTCTTCCCTGG - Intronic
938124710 2:128663557-128663579 AGGGGAGCACCTGTCTCCCCTGG - Intergenic
938513939 2:131981776-131981798 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
939417221 2:141915179-141915201 AGGTGCGCTGCTTTATTTCCAGG - Intronic
939613865 2:144340740-144340762 TGGTGTGCTCCTGTAGTTCCAGG - Intergenic
939782017 2:146460634-146460656 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
940308093 2:152247843-152247865 TGGCGAGCACCTGTAATCCCAGG + Intergenic
940314639 2:152314975-152314997 TGGTGTGCACCTGTAATCCCAGG - Intergenic
940464330 2:154009209-154009231 AGGTGTGCAGCTTTATTTCTGGG + Intronic
940577242 2:155525099-155525121 AGGTGAGAAGATGTAGTTCCAGG + Intergenic
940597305 2:155811857-155811879 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
940615401 2:156043095-156043117 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
940973369 2:159918085-159918107 TGGTGGGCACCTGTAATCCCAGG + Intergenic
941194601 2:162433459-162433481 AGGTGTGCAGCTTTATTTCTGGG - Intronic
941304474 2:163845465-163845487 AGGTGTGCAGCTTTATTTCCAGG - Intergenic
941384059 2:164831718-164831740 AGGACAATACCTGTATTTCCTGG - Intronic
941413436 2:165188653-165188675 TGGTGTGCACCTGTAATCCCAGG + Intronic
941498049 2:166231693-166231715 AGGTGAGCACCACTATGCCCGGG + Intronic
941783635 2:169475849-169475871 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
942007594 2:171721017-171721039 TGGTGTGCACCTGTAGTCCCAGG + Intronic
942325368 2:174771893-174771915 TGAGGAGCACCTGTAGTTCCTGG - Intergenic
942400553 2:175597709-175597731 AGGTGTGCACCTTTATTTCTGGG + Intergenic
942414537 2:175745208-175745230 AGGTGAGCAGATGGATATCCAGG - Intergenic
942574316 2:177347208-177347230 AGTTTAGAACCTATATTTCCAGG + Intronic
942680239 2:178471008-178471030 TGGTGTGCACCTGTAATCCCAGG - Intronic
942835092 2:180285835-180285857 AGGTATGCACCTTTATTTCTGGG - Intergenic
942865705 2:180672021-180672043 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
943188021 2:184639204-184639226 TGGTGGGCACCTGTAATCCCAGG - Intronic
943193285 2:184708478-184708500 AGGTGTGCAGCTTTATTTCTGGG - Intronic
943307079 2:186276099-186276121 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
943945096 2:194050883-194050905 AGGTATGCACCTTTATTTCTGGG - Intergenic
943959795 2:194249832-194249854 TGGCGTGCACCTGTAGTTCCAGG - Intergenic
944081195 2:195790521-195790543 AGGTGTGCAGCTTTATTTCTGGG - Intronic
944092585 2:195929553-195929575 AGGTGTGCACCTTTATTTCTGGG - Intronic
944098537 2:195996556-195996578 TGGTGGGCACCTGTAATCCCAGG - Intronic
944146497 2:196512820-196512842 TGGTGTGCACCTGTAATCCCAGG - Intronic
944335981 2:198535498-198535520 AGGTGTGCAGCTTTATTTCTGGG - Intronic
944667002 2:201967112-201967134 AGGAGAGGCCCTTTATTTCCCGG + Intergenic
945015919 2:205516105-205516127 AGGTGTGCACCCTTATTTCTGGG + Intronic
945193130 2:207211019-207211041 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
945346801 2:208727746-208727768 AGGTGTGCAGCTTTATTTCCGGG + Intronic
945487419 2:210413448-210413470 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
945637403 2:212372614-212372636 TGGTGTGCACCTGTAGTCCCAGG + Intronic
946380172 2:219342459-219342481 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
946783399 2:223216961-223216983 ACGTGAGCGCCTATTTTTCCAGG - Intergenic
947047937 2:226009230-226009252 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
947198193 2:227590244-227590266 AGGTGAGCAGCATTATTTCTGGG + Intergenic
947204611 2:227648843-227648865 AGGTGAGAATTTATATTTCCAGG + Intergenic
947709141 2:232300783-232300805 TGGTGTGCACCTGTAGTACCAGG - Intronic
948442120 2:237999955-237999977 TGGTGTGCACCTGTAATCCCAGG - Intronic
948475001 2:238211825-238211847 TGGCGGGCACCTGTAATTCCAGG - Intergenic
948476433 2:238223480-238223502 TGGTGGGCGCCTGTATTCCCAGG - Intergenic
948483756 2:238267201-238267223 AGGTGAGCACCTACAGTTCCTGG + Intronic
948911405 2:241005334-241005356 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1168741902 20:199274-199296 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1169456566 20:5757733-5757755 TGGTGGGCACCTGTAATCCCAGG - Intronic
1169667110 20:8049982-8050004 TGGTGAGTGCCTGTAATTCCTGG - Intergenic
1169782199 20:9321764-9321786 TGGTGCGCACCTGTAGTCCCAGG - Intronic
1171096283 20:22335240-22335262 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1171219117 20:23378189-23378211 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1171472284 20:25381788-25381810 TTGTGAGCACCTGTAATCCCAGG - Intronic
1171546760 20:26008176-26008198 GTGTGTGCACCTGTAATTCCAGG + Intergenic
1171937700 20:31291456-31291478 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1172074875 20:32288013-32288035 TGGTGTGCACCTGTAATCCCAGG - Intronic
1172238374 20:33394282-33394304 TGGTGGGCACCTGTAATCCCAGG - Intronic
1172967786 20:38850833-38850855 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1173358479 20:42317987-42318009 AAGTGAGGATCTGTATTACCTGG + Intronic
1173982955 20:47239070-47239092 GGGTGAGCACCGGTGTTTCCGGG + Exonic
1174609304 20:51786050-51786072 TGGTGTGCACCTGTAGTCCCAGG - Intronic
1174928692 20:54789281-54789303 AGGTGTGCACCATTATTTCTGGG + Intergenic
1174932993 20:54835997-54836019 ACGTGCGCACCTGTAATCCCAGG - Intergenic
1175122559 20:56727379-56727401 TGGTGAGCACCTGTAGTCCCAGG + Intergenic
1175366884 20:58461750-58461772 AGGTCAGCCCCTGTATCCCCCGG + Intronic
1175462498 20:59162603-59162625 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1175741154 20:61420560-61420582 AGCTGAGCGTGTGTATTTCCAGG + Intronic
1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG + Intergenic
1176164170 20:63664258-63664280 AGGTCCTCACCTGGATTTCCAGG + Intronic
1176779844 21:13181119-13181141 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1177493301 21:21856195-21856217 AGGTGGGCAGCCTTATTTCCGGG + Intergenic
1177742840 21:25174679-25174701 TGGTGGGCACCTGTAGTTCCAGG - Intergenic
1177837206 21:26197715-26197737 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1177977493 21:27870146-27870168 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1178613591 21:34109986-34110008 GGGTGAGTACCAGAATTTCCAGG - Intronic
1179303868 21:40137039-40137061 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1179527934 21:41996000-41996022 ATGAGAACACCTGTATATCCAGG + Intronic
1179604290 21:42503380-42503402 TGGTAGGCACCTGTATTCCCAGG - Intronic
1179711498 21:43266100-43266122 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1180053118 21:45342565-45342587 AGGTGTGCGCCTGTAATCCCAGG + Intergenic
1180678187 22:17603381-17603403 TGGTGAGCACCTGTAGTCCCAGG + Intronic
1181387497 22:22557063-22557085 ACCTGAGCACCAGTGTTTCCTGG + Exonic
1181661700 22:24355148-24355170 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1181799118 22:25332734-25332756 TGGTGGGCACCTGTAATGCCAGG + Intergenic
1181834743 22:25594743-25594765 CGGTGGGCACCTGTAGTCCCAGG + Intronic
1182303966 22:29355102-29355124 TGGTAAGCACCTGTAGTCCCAGG + Intronic
1182372558 22:29821864-29821886 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1182671796 22:32002325-32002347 TGGTGAGCAACTGTAGTTCCAGG - Intergenic
1182903620 22:33919654-33919676 CGGTGAGCACCTGTGGTTCGCGG - Intronic
1183342705 22:37290639-37290661 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1183419537 22:37703126-37703148 TGGTGGGCACCTGTAATCCCAGG - Intronic
1183434360 22:37784818-37784840 AGGTGAGGAAGTGAATTTCCAGG - Intergenic
1184263291 22:43332153-43332175 TGGTGCGCACCTGTAGTCCCAGG + Intronic
1184476592 22:44725340-44725362 AGGTGAGCCCCTGTGCTTTCTGG - Intronic
1184806090 22:46795839-46795861 AGCTGAGCACCTTTAATTCTGGG + Intronic
1184862653 22:47182975-47182997 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1185188133 22:49415464-49415486 AGGTGAGCAGCTGTAGTTGCCGG - Intronic
949605504 3:5648456-5648478 AGAGTAGCACCTGTAATTCCTGG + Intergenic
949663987 3:6315670-6315692 TGGTGAGCACGTTTATTTCAGGG + Intergenic
949753968 3:7387597-7387619 AGGTGTGCAGCTTTATTTCGGGG + Intronic
949957303 3:9279644-9279666 TGGTGGGCACCTGTAATCCCAGG - Intronic
950229826 3:11266710-11266732 TGGTGTGCATCTGTAATTCCAGG + Intergenic
950285976 3:11744994-11745016 TGGTGGGCACCTGTAATCCCAGG - Intergenic
950292533 3:11797327-11797349 AGGTGTGCAGCCTTATTTCCGGG - Intronic
950588792 3:13919477-13919499 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
950597827 3:14000347-14000369 TGGTGCGCGCCTGTAATTCCAGG + Intronic
950608074 3:14102213-14102235 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
951192092 3:19783015-19783037 AGGTGAGAAACTGTAAGTCCCGG - Intergenic
951270913 3:20622822-20622844 AGGTGAGCAACTATACTACCTGG - Intergenic
951677496 3:25258700-25258722 AGATGAGCAGCTGCATCTCCTGG + Intronic
951959889 3:28305996-28306018 AGGTATGCAGCTTTATTTCCAGG + Intronic
952019093 3:28995438-28995460 AGGTGTGCAACTTTATTTCTGGG + Intergenic
952205705 3:31180290-31180312 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
952311391 3:32193650-32193672 TGGTGTGCACCTGTAATCCCAGG - Intergenic
952787410 3:37168907-37168929 TGGTGTGCACCTGTAATTCCAGG - Intronic
953267493 3:41406278-41406300 AGGTGTGCAGCTTTATTTCTGGG + Intronic
954052784 3:47995381-47995403 TGGTGTGCACCTGTAATCCCAGG - Intronic
954320265 3:49827795-49827817 AGGAGTTCACCTGTTTTTCCAGG - Intergenic
954558962 3:51539439-51539461 AGCTGAGCTCCTGCCTTTCCAGG - Intergenic
954791672 3:53137696-53137718 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
955604156 3:60682102-60682124 TGGTGGGCACCTGTAATCCCAGG - Intronic
955692474 3:61604189-61604211 TGGTGGGCACCTGTATTCCCAGG + Intronic
955703811 3:61707919-61707941 TGGTGTGCACCTGTAGTCCCAGG - Intronic
956400845 3:68878096-68878118 AGGTGTGCCCCAGTTTTTCCAGG + Intronic
956570145 3:70685408-70685430 ATGTGAGCAGCTGTACTTTCTGG + Intergenic
956691728 3:71884620-71884642 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
956752805 3:72357302-72357324 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
957509352 3:81167673-81167695 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
957525308 3:81372014-81372036 AGCTGAGCAACAGTATATCCAGG - Intergenic
957545532 3:81631612-81631634 TGGTGTGCACCTGTAGTCCCAGG + Intronic
957842100 3:85685117-85685139 TGGTGGGCACCTGTAGTGCCAGG + Intronic
958594601 3:96205341-96205363 AGGTGTGCAGCTTTATTTCTAGG - Intergenic
959035284 3:101355521-101355543 AGGTGTGCAGCTTTATTTCCAGG + Intronic
959693284 3:109222398-109222420 AGGTGTGCAGCTTTATTTCAGGG - Intergenic
959753025 3:109860757-109860779 AGGTGTGCAACTTTATTTCTGGG - Intergenic
959795103 3:110417531-110417553 AGGTGTGCAACTTTATTTCTGGG - Intergenic
960895411 3:122499624-122499646 TGGTGTGCACCTGTAGTTCCAGG + Intronic
961421422 3:126807984-126808006 AGGTCAGGCCCTGTGTTTCCTGG + Intronic
961867619 3:129965217-129965239 ATTTGAGCGCCTCTATTTCCTGG + Intergenic
962123691 3:132591315-132591337 AGGTGAGCAGCCTTATTTCTGGG + Intronic
962510042 3:136089392-136089414 AGGTGTGCAGCTTTATTTCTGGG + Intronic
962915402 3:139897636-139897658 TGGTGGGCACCTGTAATCCCAGG + Intergenic
963295793 3:143544979-143545001 AGGTGTGCAGCTTTATTTCCGGG + Intronic
963354449 3:144193231-144193253 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
963777811 3:149457492-149457514 TGGTGTGCACCTGTAATTCCAGG + Intergenic
964511619 3:157458933-157458955 AGGTGTGCAGCTTTATTTCTGGG + Intronic
964513685 3:157481981-157482003 AGGTGTGCAGCTTTATTTCTAGG + Intronic
964593524 3:158395011-158395033 AGGTGTGCAGCTTTATTTCTGGG - Intronic
964868328 3:161286372-161286394 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
965408737 3:168303006-168303028 TGGTGCACACCTGTAATTCCCGG + Intergenic
965964544 3:174470779-174470801 AGGTGTGCAGCTTTATTTCAGGG + Intronic
966062811 3:175780141-175780163 TGGTGGGCACCTGTAGTCCCAGG + Intronic
966617564 3:181928394-181928416 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
967080603 3:186046142-186046164 AGCTGTGCACATCTATTTCCAGG + Intergenic
967122372 3:186394043-186394065 AGGTGAGCAGCTTTATTTCTGGG - Intergenic
967145663 3:186603900-186603922 TGGTGGGCACCTGTAATCCCAGG + Intergenic
967255078 3:187582959-187582981 AGTTGTGCAGCTTTATTTCCGGG + Intergenic
967527222 3:190508752-190508774 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
967600779 3:191385934-191385956 AGGTGTGCAGCTTTATTTCAAGG + Intronic
967702069 3:192604884-192604906 AGGTGTGCAGCTTTATTTCTGGG - Intronic
968052870 3:195668122-195668144 TGGTGCACACCTGTATTCCCAGG + Intergenic
968205430 3:196795334-196795356 TGGTGTGCACCTGTACTCCCAGG + Intronic
969382982 4:6818907-6818929 AGGTGTACACCTTTATTTCTGGG - Intronic
969698664 4:8752351-8752373 TGGTGTGCACCTATAATTCCAGG - Intergenic
970206288 4:13658740-13658762 TGGTGAGCACATGTAGTCCCAGG + Intergenic
971312296 4:25535931-25535953 TGGTGGGCACCTGTAATCCCAGG - Intergenic
971691744 4:29845510-29845532 CGGCGGGCACCTGTAATTCCAGG + Intergenic
971922930 4:32967465-32967487 AGGTGTGCAACTTTATTTCTGGG - Intergenic
972235004 4:37121747-37121769 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
972256591 4:37362500-37362522 AGGTGTGCAGCTTTATTTCTGGG - Intronic
972433654 4:39010598-39010620 AGGTGTGCAGCTTTATTTCAGGG - Intronic
972497043 4:39643758-39643780 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
972950823 4:44320037-44320059 TGGTGAGCACCTGTAATTCCAGG + Intronic
972968910 4:44548323-44548345 AGGTGAGCAGCTGTATGTTGTGG + Intergenic
973012244 4:45091600-45091622 AGGTGTGCAGCTTTATTTCTAGG - Intergenic
973307349 4:48667778-48667800 TGGTGTGCACCTGTAATCCCAGG - Intronic
973753960 4:54053921-54053943 TGGCGAGCACCTGTAATCCCAGG - Intronic
973767312 4:54174599-54174621 AGGTGTGCAGCTTTATTTCTGGG - Intronic
974383140 4:61168737-61168759 AGGTGTGCAGCTCTATTTCTGGG - Intergenic
974801478 4:66824368-66824390 TGGTGGGCACCTGTAATCCCAGG + Intergenic
975040622 4:69741197-69741219 AGGTGTGCATCTTTATTTCTAGG + Intronic
975242664 4:72080295-72080317 TGGTGAGCACCTCTAATCCCAGG - Intronic
975343407 4:73266722-73266744 AGGTGAATTCCTGTATTTCAAGG - Intergenic
975671752 4:76787310-76787332 AGCTGAGCAGCTGTGATTCCAGG + Intergenic
975706788 4:77119904-77119926 TGGTGGGCACCTGTAATCCCAGG - Intergenic
976278478 4:83302840-83302862 TGGTGTGCACCTGTAGTTCCAGG + Intronic
977020547 4:91753750-91753772 TGGTGGGCACCTGTAATCCCAGG + Intergenic
977194874 4:94046028-94046050 TGGCGAGCACCTGTAGTCCCAGG + Intergenic
977374963 4:96190523-96190545 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
977777861 4:100943018-100943040 AGGTGTGCACCTCTATTTCTGGG + Intergenic
978030491 4:103936448-103936470 AGGTGAGCACTTATAGTACCTGG + Intergenic
978381159 4:108130595-108130617 TGGTGTGCACCTGTAATCCCAGG + Intronic
978589467 4:110309269-110309291 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
978601750 4:110435485-110435507 AGGTGTGCAGCTTTATTTCTGGG + Intronic
979334891 4:119452424-119452446 TGGTGGGCACCTGTAATCCCGGG + Intergenic
979765926 4:124463730-124463752 AGGGGAGAAGCTGTGTTTCCTGG - Intergenic
980288722 4:130815695-130815717 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
980344323 4:131593351-131593373 TGGTGGACACCTGTAATTCCAGG - Intergenic
980383018 4:132050250-132050272 TGGTGAACACCTGTAATCCCAGG - Intergenic
980515286 4:133850147-133850169 TGGTGAACACCTGTAGTTCCAGG - Intergenic
981622745 4:146722503-146722525 AGGTGTGCAGCTTTATTTTCAGG - Intronic
981826543 4:148948772-148948794 AAGTTAGAACCAGTATTTCCTGG + Intergenic
981977930 4:150753932-150753954 TGGCGAGCACCTGTAGTCCCAGG + Intronic
982062279 4:151616579-151616601 TGGCGGGCACCTGTAGTTCCAGG - Intronic
982962728 4:161860813-161860835 AGGTGAGTACTTGTATTACAGGG - Intronic
983201754 4:164868511-164868533 TGGTGGGCACCTGTAATCCCAGG - Intergenic
983339455 4:166439827-166439849 AGGTGTGCAGCTTTATTTCATGG + Intergenic
983589508 4:169392169-169392191 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
983778143 4:171634181-171634203 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
984146119 4:176063839-176063861 TGGCGGGCACCTGTACTTCCAGG - Intergenic
984204183 4:176766452-176766474 TGGTGAGTACCTGTAGTCCCAGG + Intronic
984368875 4:178835203-178835225 CGGTGGGCACCTGTAGTCCCAGG + Intergenic
984685784 4:182666764-182666786 TGGTGTGCACCTGTAGTCCCAGG + Intronic
984782538 4:183538843-183538865 TGGTGTGTACCTGTAGTTCCAGG + Intergenic
985929732 5:3047453-3047475 AGGTGAGGGCCTGGCTTTCCGGG - Intergenic
988022249 5:25635989-25636011 AGGTGTGCAGCTGTATTTCTGGG + Intergenic
988106873 5:26761744-26761766 AGGTCAGCTCCGCTATTTCCAGG - Intergenic
988141086 5:27241649-27241671 AGGTGGGCAGCTTTATTTCTGGG - Intergenic
988404670 5:30808831-30808853 AGGTGAGCATCTGTACTCCTAGG + Intergenic
988914711 5:35880892-35880914 TGGTGTGCACCTGTAATTCCAGG - Intergenic
988979843 5:36556203-36556225 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
989299359 5:39870835-39870857 AGGTGTGCAGCTTTATTTCAGGG + Intergenic
990071964 5:51793435-51793457 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
990214934 5:53520007-53520029 AGGTGCGCACCTTTATTTCTGGG - Intergenic
990215486 5:53527261-53527283 AGGTCTGCACCTTTATTTCTGGG + Intergenic
990390971 5:55320345-55320367 TGGTGAGCACCTGTAGTCCCAGG - Intronic
991324729 5:65418050-65418072 AGGTGTGCAGCTTTATTTCTAGG - Intronic
991659934 5:68940634-68940656 AGGTGTGCAGCTTTATTTCTAGG - Intergenic
992374936 5:76179558-76179580 AGGTCAGCACCTGAATATCTGGG + Intronic
992520881 5:77549925-77549947 AGGTGTGCAGCTTTATTTCTGGG - Intronic
992689994 5:79232949-79232971 TGGTGGGCACCTGTAATCCCAGG - Intronic
993991932 5:94668271-94668293 TGGTGGGCACCTGTAGTCCCAGG - Intronic
994257731 5:97619518-97619540 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
994315163 5:98324840-98324862 TGGTGGGCACCTGTAATCCCAGG - Intergenic
994543570 5:101132140-101132162 TGGCGAGCACCTGTATTCCCAGG - Intergenic
994561504 5:101379540-101379562 AGGTGTGCAACTTTATTTCAAGG + Intergenic
994627639 5:102241890-102241912 AGGTGAGCACTTATAATACCTGG + Intronic
994803814 5:104417087-104417109 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
995237757 5:109849609-109849631 AAGTGACTTCCTGTATTTCCTGG + Intronic
995275832 5:110276835-110276857 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
995610458 5:113904077-113904099 AGGTGAGCACCTCTCCTTCTTGG - Intergenic
995733224 5:115268400-115268422 TGGTGTGCACCTGTAGTCCCAGG - Intronic
996469319 5:123841693-123841715 AGGTGGGCAGCTTTATTTCTGGG - Intergenic
996734846 5:126749144-126749166 TGGTGCGCACCTGTAATCCCAGG - Intergenic
997183543 5:131858267-131858289 AGGTGTGCAGCTTTATTTCTGGG - Intronic
997509387 5:134443045-134443067 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
997784053 5:136690732-136690754 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
997898121 5:137738277-137738299 AGGTGAACAGCTTTATTTCTGGG - Intergenic
997935350 5:138105639-138105661 TGGTGCACACCTGTAATTCCAGG + Intergenic
997953831 5:138263096-138263118 TGGTGGGCACCTGTAATCCCAGG - Intronic
998291381 5:140917704-140917726 AGGTGTGCAGCTTTATTTCTGGG + Intronic
998927824 5:147146276-147146298 AGGTGTGCAGCTTTATTTCTTGG - Intergenic
999905437 5:156136243-156136265 TGGTGTGCACCTGTAGTCCCAGG - Intronic
999999483 5:157124081-157124103 TGGTGCACACCTGTATTTCCAGG - Intronic
1000171190 5:158704732-158704754 AGGTGGGCACCAGTTTTTCAGGG - Intronic
1000267065 5:159647821-159647843 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
1000270652 5:159680249-159680271 ATGTAAGCACCTGGATGTCCAGG + Intergenic
1000612806 5:163393481-163393503 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1001210437 5:169805925-169805947 GGGTGAGCAACTGTCTTTGCTGG + Intronic
1001330451 5:170758850-170758872 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1001767699 5:174265492-174265514 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1002133010 5:177092783-177092805 AGGTGAGCACCTGAAGGGCCAGG + Exonic
1002328699 5:178427065-178427087 TGGTGGGCACCTGTAATCCCAGG + Intronic
1002880746 6:1250126-1250148 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1003951608 6:11121472-11121494 AGGTGAGCATATGTATTTTGGGG - Intronic
1004053814 6:12114142-12114164 AGGAGAGCGCCTGTATTTGCGGG + Intronic
1004342178 6:14817494-14817516 AGGTGAGCACAGGTGTCTCCAGG + Intergenic
1004519534 6:16348567-16348589 TGGTGAGTGCCTGTAATTCCAGG + Intronic
1004712362 6:18184405-18184427 TGGTGCGCACCTGTAATCCCAGG - Intronic
1006044501 6:31283275-31283297 TGGTGGGCGCTTGTATTTCCAGG + Intronic
1006195474 6:32238732-32238754 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1006351556 6:33524934-33524956 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1006532906 6:34672224-34672246 TGGTGCACACCTGTAGTTCCAGG - Intronic
1006787063 6:36675569-36675591 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1007378653 6:41472672-41472694 AGGTGAGCCCCTGCACTTCCTGG - Intergenic
1007488025 6:42195738-42195760 AGGTGAGCAACTCTCTTCCCAGG + Intergenic
1007799314 6:44378636-44378658 TGGTGGGCACCTGTAATCCCTGG + Exonic
1007994304 6:46289810-46289832 AGATGAGCAGCTGTGTTCCCTGG - Intronic
1008062740 6:47015541-47015563 TGGTGTGCACCTGTACTCCCAGG - Intronic
1008087310 6:47258572-47258594 TGGTGAACACCTGTAGTCCCAGG - Intronic
1008499574 6:52167535-52167557 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1009822367 6:68819604-68819626 AGGTGTGCACTGGTACTTCCAGG - Intronic
1009849323 6:69175449-69175471 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1010391196 6:75339813-75339835 TGGTGGGCACCTGTAGTTCCAGG + Intronic
1010483700 6:76383509-76383531 AGGTGAGCACTCATATTACCTGG - Intergenic
1010571591 6:77479520-77479542 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1010656176 6:78514326-78514348 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1010708151 6:79138888-79138910 AGGTGTGCACCCTTATTTCTGGG - Intergenic
1010995087 6:82523617-82523639 AGGTGAGGACAGGCATTTCCTGG + Intergenic
1011681126 6:89784182-89784204 TGGTGGGCACCTGTAATCCCAGG + Intronic
1011978145 6:93334087-93334109 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1012134229 6:95536006-95536028 AGGTGTGCAGCTCTATTTCTGGG + Intergenic
1012250895 6:96979448-96979470 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1012714099 6:102647578-102647600 AGGTGTTCAGCTGTATTTCTGGG - Intergenic
1013292380 6:108730471-108730493 TGGTGCGCACCTGTAATCCCAGG + Intergenic
1013341001 6:109215722-109215744 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1013465337 6:110413008-110413030 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1013495371 6:110692159-110692181 TGGTGAGCGCCTGTAGTCCCAGG + Intronic
1013600968 6:111704619-111704641 TGGTGGGCACCTGTAATCCCAGG + Intronic
1014852333 6:126357239-126357261 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1015069810 6:129078265-129078287 TGGCGCGCACCTGTAGTTCCAGG - Intronic
1015926212 6:138312542-138312564 CAGTGAGCAGGTGTATTTCCGGG - Intronic
1015947119 6:138514183-138514205 TGGTGAGCACCTGTAGTGCCAGG + Intronic
1016107250 6:140178118-140178140 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1016868109 6:148789728-148789750 TGGTGGGCACCTGTAATTCCAGG - Intronic
1017598623 6:156057918-156057940 TGGCCAGCACCTGTATTTCTTGG + Intergenic
1017856325 6:158352527-158352549 TGGTGGGCACCTGTAATCCCAGG - Intronic
1018196900 6:161363107-161363129 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1019349358 7:546614-546636 TGGTGAGCACCTGTAATCCCAGG - Intergenic
1020124665 7:5526780-5526802 TGGTTGGCACCTGCATTTCCTGG - Intergenic
1020219891 7:6227880-6227902 AAGTGAGCACTTGTATACCCTGG - Intronic
1020651090 7:10877305-10877327 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1020804681 7:12774072-12774094 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1021589580 7:22246408-22246430 AGGTGTGCAGCTTTATTTCTAGG - Intronic
1021732213 7:23606963-23606985 TGGTGTGCACTTGTAGTTCCAGG + Intronic
1021994061 7:26162843-26162865 TGGTGCGCACCTGTAATCCCAGG - Intronic
1022019396 7:26383746-26383768 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1022729937 7:33012978-33013000 TGGTGCGCACCTGTGGTTCCAGG - Intergenic
1022765764 7:33409464-33409486 AGGTGTGCAGCTCTATTTCTGGG + Intronic
1022984806 7:35641648-35641670 AGGTGTGCAGCCTTATTTCCGGG - Intronic
1023058544 7:36308797-36308819 TGGTGCGCACCTGTAGTCCCAGG - Intergenic
1023370671 7:39509321-39509343 TGGTGCACACCTGTAGTTCCAGG + Intergenic
1023785365 7:43702405-43702427 AGGTATGCAGCTTTATTTCCAGG + Intronic
1023978184 7:45048628-45048650 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1025705118 7:63856099-63856121 TGGTGAGCACCTGTAATCCCAGG - Intergenic
1025836801 7:65102035-65102057 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1025906579 7:65791471-65791493 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1026035577 7:66828117-66828139 AGGCGAGCACCTGTAGTCCCAGG - Intergenic
1026206546 7:68262662-68262684 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1026245788 7:68618293-68618315 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1026544108 7:71306954-71306976 TGGTGGGCACCTGTAATCCCAGG - Intronic
1026777172 7:73237795-73237817 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1027018020 7:74791167-74791189 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1027047845 7:75002953-75002975 TGGTGTGCACCTGTAATCCCGGG + Intronic
1027070006 7:75154745-75154767 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1027554285 7:79643769-79643791 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1027651549 7:80874597-80874619 TGGTGGACACCTGTAATTCCAGG - Intronic
1027812414 7:82921425-82921447 AGGTGTGCAACTTTATTTCTGGG - Intronic
1028149941 7:87360471-87360493 TGGTGCGCACCTGCAATTCCAGG - Intronic
1028748784 7:94358426-94358448 AGATGTGCAGCTTTATTTCCAGG - Intergenic
1029338821 7:99926199-99926221 TGGTGCGCACCTGTAGTCCCAGG + Intronic
1029385154 7:100238693-100238715 TGGTGTGCACCTGTAATCCCGGG - Intronic
1029586816 7:101478113-101478135 TGGTGAGCACCTGTAATCCCAGG - Intronic
1029698941 7:102233652-102233674 TGGCGAGCACCTGTAGTCCCAGG + Intronic
1030152759 7:106423121-106423143 GGGTGAGCATCAGAATTTCCTGG + Intergenic
1030599231 7:111573528-111573550 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1031238074 7:119201941-119201963 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1032758736 7:134917479-134917501 TGGTGCGCACCTGTAATCCCAGG - Intronic
1033725552 7:144112578-144112600 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1034019651 7:147627557-147627579 TGGTGGGCACCTGTAATCCCAGG + Intronic
1034112542 7:148551806-148551828 AGGTGTGCAACTTTATTTCTAGG + Intergenic
1034630902 7:152529874-152529896 TGATGCGCACCTGTAATTCCAGG - Intergenic
1034631823 7:152536988-152537010 AGGTGGGCACCTGTAATTCTAGG + Intergenic
1035375063 7:158402234-158402256 AAGTCAGCACCTGTATACCCTGG - Intronic
1036552136 8:9825273-9825295 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1037075666 8:14714098-14714120 TGGTGGGCACCTGTAATCCCAGG - Intronic
1037903143 8:22699930-22699952 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1038524292 8:28259999-28260021 TGGTGTGCACCTGTAATCCCAGG + Intergenic
1038562560 8:28593057-28593079 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1038682095 8:29678400-29678422 AGGTGAGCACTTGAATCACCTGG + Intergenic
1038960728 8:32516216-32516238 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1039074068 8:33672987-33673009 TGGTGCGCACCTGTAATCCCAGG - Intergenic
1039121953 8:34157540-34157562 AGGGAAACACCTGGATTTCCAGG + Intergenic
1039183031 8:34887753-34887775 TGGTGTGCACCTGCAGTTCCTGG + Intergenic
1039403864 8:37296170-37296192 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1039559421 8:38500764-38500786 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1039964503 8:42274161-42274183 TGGTGCACACCTGTAATTCCAGG - Intronic
1040080871 8:43283652-43283674 AGGTGTGCAGCTTTATTTCTTGG + Intergenic
1040551975 8:48444840-48444862 AAGTGAGAAGCTGTCTTTCCTGG + Intergenic
1040882479 8:52221775-52221797 AAGTCAGCAACTGTAGTTCCTGG + Exonic
1041074316 8:54155392-54155414 AGGTGCGCACCTGTAATCCCAGG - Intergenic
1041164837 8:55081009-55081031 AGGAGAGCAGCTGAATTACCTGG - Intergenic
1041397792 8:57409553-57409575 TGGCGGGCACCTGTAATTCCTGG - Intergenic
1041803713 8:61826832-61826854 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1041832646 8:62173022-62173044 AGGTGTGCAGCTTTATTTCAGGG + Intergenic
1041834141 8:62192764-62192786 AGCTGAGCAGTAGTATTTCCTGG + Intergenic
1041873732 8:62664086-62664108 AGGCCAACACCTCTATTTCCTGG + Intronic
1042122708 8:65506243-65506265 GGGTGCGCACCTGTAGTCCCAGG - Intergenic
1042433747 8:68739934-68739956 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1042703850 8:71645950-71645972 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1043135209 8:76514559-76514581 AGGTGCGCAGCTTTATTTCTGGG - Intergenic
1043169745 8:76950680-76950702 AGGTGTGCAGCTCTATTTCTGGG - Intergenic
1043237484 8:77886755-77886777 AGGTGAGCAGCCTTATTTCTGGG - Intergenic
1043525497 8:81092248-81092270 TGGTGTGCACCTATAGTTCCAGG + Intronic
1043569536 8:81587103-81587125 AGGTGTGCACCTTTATTTCTTGG + Intergenic
1043680413 8:83018358-83018380 TGGTGGGTGCCTGTATTTCCAGG - Intergenic
1043789004 8:84438893-84438915 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1043929462 8:86074397-86074419 AGGTGTGCACTTGTAGTCCCAGG - Intronic
1044201231 8:89440571-89440593 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1044315090 8:90740841-90740863 AGGTGTGCAGCTTTATTTCAGGG + Intronic
1044473381 8:92598466-92598488 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1044793922 8:95876954-95876976 AGGTGTGCAGCCTTATTTCCAGG - Intergenic
1045087378 8:98701034-98701056 TGGTGTGCACCTGTAGTTCCAGG + Intronic
1045095758 8:98796324-98796346 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1045109030 8:98921822-98921844 TGGTGCGCACCTGTAGTCCCAGG - Intronic
1045258703 8:100552015-100552037 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1045463989 8:102452261-102452283 TGGTGTGCACCTGTAGTTCCAGG - Intergenic
1045756363 8:105547407-105547429 TGGTGGGCACCTGTAATCCCAGG + Intronic
1046353030 8:113041071-113041093 TGGTGTGCACCTGTAATCCCAGG + Intronic
1046411524 8:113849611-113849633 AGGTGTACACCTTTATTTCTGGG - Intergenic
1046573554 8:115996912-115996934 AGGTGACCCACTGAATTTCCAGG - Intergenic
1047396739 8:124507027-124507049 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1047436777 8:124841345-124841367 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1047462556 8:125081368-125081390 TGGTGGGCGCCTGTAATTCCAGG - Intronic
1047857048 8:128922234-128922256 TGGCGAGCACCTGTAGTCCCAGG - Intergenic
1047939966 8:129820097-129820119 TGGAGAGCACCACTATTTCCTGG - Intergenic
1048212513 8:132467181-132467203 AGGTGAGAGCCTGGGTTTCCTGG + Intronic
1048780480 8:137993958-137993980 ATGTGTGCAGCTTTATTTCCAGG + Intergenic
1048799618 8:138184033-138184055 CGGTGAGCTCCTGTGTTTCATGG - Intronic
1048857222 8:138695466-138695488 TGGTGAGGACCTGTAGTTCCAGG - Intronic
1049149529 8:141025652-141025674 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1049638652 8:143704049-143704071 TGGTGGGCACCTGTAATTTCAGG - Intronic
1049722990 8:144129378-144129400 TGGTGTACACCTGTAGTTCCAGG - Intergenic
1049831811 8:144705543-144705565 CAGTGAGCACCTGTGATTCCAGG + Intergenic
1050177939 9:2888631-2888653 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1050481591 9:6093371-6093393 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1050617917 9:7421835-7421857 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
1050909261 9:11046525-11046547 TGGTGTGCACCTGTAATTCCAGG + Intergenic
1051456160 9:17260984-17261006 AGGTGTGCAACTTTATTTCTGGG + Intronic
1051616270 9:19009957-19009979 TGGTATGCACCTGTAGTTCCTGG - Intronic
1051677064 9:19569307-19569329 AGGTAAGAACCTGTGGTTCCAGG - Intronic
1051886639 9:21899860-21899882 AGGTGTGCAGCTTTATTTCTGGG - Intronic
1052259970 9:26503185-26503207 AGGTGAATAGCTTTATTTCCAGG - Intergenic
1053798046 9:41743981-41744003 CTGTGTGCACCTGTAATTCCAGG - Intergenic
1053823609 9:41995596-41995618 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1053941850 9:43258312-43258334 ATGTTAGCACTTGTATTTCTAGG + Intergenic
1054147154 9:61570961-61570983 GTGTGTGCACCTGTAATTCCAGG + Intergenic
1054186460 9:61956033-61956055 CTGTGTGCACCTGTAATTCCAGG - Intergenic
1054438475 9:65236627-65236649 ATGTTAGCACTTGTATTTCTAGG + Intergenic
1054466889 9:65502014-65502036 GTGTGTGCACCTGTAATTCCAGG + Intergenic
1054491929 9:65785321-65785343 ATGTTAGCACTTGTATTTCTAGG - Intergenic
1054606964 9:67191770-67191792 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1054652044 9:67632487-67632509 GTGTGTGCACCTGTAATTCCAGG + Intergenic
1055204606 9:73712742-73712764 TGGTGTGCACCTGTAGTCCCAGG + Intergenic
1056556107 9:87689245-87689267 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1056575255 9:87851502-87851524 AGGTCAGCAGCTGTCTGTCCTGG + Intergenic
1056887374 9:90456447-90456469 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1057647622 9:96891689-96891711 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1058056892 9:100457736-100457758 ATGTGGTCACCTTTATTTCCAGG + Intronic
1058517532 9:105791592-105791614 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1058742788 9:107960563-107960585 TGGTGGGCACCTGTAATTCCAGG + Intergenic
1058888869 9:109343854-109343876 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1059134482 9:111792467-111792489 TGGTGTGCACCTGTAGTCCCAGG + Intronic
1059501958 9:114762457-114762479 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1059615838 9:115949945-115949967 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1059807513 9:117818879-117818901 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1060229472 9:121815934-121815956 AGGTGGGCAGACGTATTTCCTGG + Intergenic
1060452779 9:123758931-123758953 TGGCGGGCACCTGTAGTTCCAGG - Intronic
1060635515 9:125196941-125196963 TGGTGCGCACCTGTAGTCCCAGG + Intergenic
1060922514 9:127431891-127431913 AGGTGTGCAACTTTATTTCCGGG + Intronic
1061082677 9:128381561-128381583 TGGTGGGCACCTGTAATCCCAGG + Intronic
1061453288 9:130680498-130680520 TGGTGCACACCTGTATTCCCAGG + Intronic
1061789124 9:133049279-133049301 AGGTGACCACCCGGTTTTCCTGG + Intronic
1061888998 9:133607905-133607927 AGGTGAGAACCAGCACTTCCTGG - Intergenic
1062118568 9:134822064-134822086 AGGTGATAACCTGCATTTTCTGG + Intronic
1062246901 9:135573745-135573767 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1062620767 9:137420956-137420978 AGGTGAGCACCACTATGCCCAGG + Intronic
1062731122 9:138109926-138109948 TGGTGTGCACCTGTAGTCCCTGG + Intronic
1185488900 X:504278-504300 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1185562408 X:1069892-1069914 TGGTGCGCACCTGTAATCCCAGG + Intergenic
1185686597 X:1933897-1933919 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1185734042 X:2484103-2484125 TGGTGGGCACCTGTAATCCCAGG - Intronic
1185766704 X:2731455-2731477 TGGTGCACACATGTATTTCCAGG + Intronic
1185817957 X:3173767-3173789 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1185887813 X:3798307-3798329 TGGTGGGCGCCTGTAATTCCAGG - Intergenic
1186040651 X:5474164-5474186 AGGTGGTCACCTGTGTTCCCTGG - Intergenic
1186413631 X:9364649-9364671 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1186696856 X:12044320-12044342 AGCAGAGCTCATGTATTTCCAGG - Intergenic
1187277899 X:17832394-17832416 AGGCGAGCAGCTGTATGTACAGG - Intronic
1187392023 X:18892295-18892317 AGGTGAGCATTTGTCTTTCAAGG + Exonic
1187456123 X:19442853-19442875 TGGTGCGCACCTGTAATCCCAGG - Intronic
1187546271 X:20255653-20255675 TGGTGGGCACCTGTAATCCCAGG + Intronic
1187730154 X:22244467-22244489 CGGTGTGCACCTGTAATCCCAGG + Intronic
1187954352 X:24501579-24501601 TGGTGGGCACCTGTAATCCCAGG + Intronic
1188087514 X:25919009-25919031 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1188132791 X:26458170-26458192 TGGTGTGCACCTGTAATACCGGG + Intergenic
1188221166 X:27543293-27543315 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1188478707 X:30614747-30614769 CGGTGTGCACCTGTAGTCCCAGG + Intergenic
1188739165 X:33755950-33755972 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1189861577 X:45277315-45277337 AGGTGTGCACCTTTGTTTCTGGG + Intergenic
1190243277 X:48674297-48674319 TGGCGAGCACCTGTAATTCCAGG - Intergenic
1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG + Intronic
1190689567 X:52902188-52902210 TGGTGGGCACCTGTAATCCCAGG - Intronic
1190693448 X:52931741-52931763 TGGTGGGCACCTGTAATCCCAGG + Intronic
1190696416 X:52953604-52953626 TGGTGGGCACCTGTAATCCCAGG + Intronic
1190767730 X:53489227-53489249 TGGCGGGCACCTGTAGTTCCAGG + Intergenic
1190770065 X:53506687-53506709 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1191593341 X:62913135-62913157 AGGTGAGCAATTGTACTACCTGG - Intergenic
1191738465 X:64412198-64412220 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1192596774 X:72417899-72417921 AGTTGTGCAGCTGTATTTCAGGG - Intronic
1192916996 X:75662939-75662961 AGGTGTGCAGCTTTATTTCTAGG + Intergenic
1192966996 X:76187921-76187943 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1193417897 X:81246616-81246638 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1193422794 X:81304094-81304116 AAGTGTGCAGCTGTATTTCTTGG + Intergenic
1193524626 X:82573718-82573740 AGGTGAACCCTTGTAGTTCCTGG - Intergenic
1193774503 X:85625375-85625397 AGGTGTGCAGCTTTATCTCCGGG - Intergenic
1193915356 X:87356469-87356491 AGATGAGCACTTATATTACCAGG + Intergenic
1193917386 X:87381897-87381919 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1193949046 X:87775644-87775666 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1194199535 X:90937854-90937876 TGGTGCGCACCTGTAGTCCCAGG + Intergenic
1194320834 X:92443839-92443861 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1194333165 X:92610905-92610927 AGGTGTGCAACTTTATTTCTGGG + Intronic
1194359608 X:92933449-92933471 AGGTGTGCAGCTTTATTTCTAGG - Intergenic
1194394115 X:93359157-93359179 AGGTGTGCAGCTTTATTTCTGGG - Intergenic
1194406425 X:93501829-93501851 AGGTGCGCAGCCGTATTTCTGGG - Intergenic
1194689752 X:96969034-96969056 AGGTGTGCAGCTTTATTTCTTGG + Intronic
1194801211 X:98275688-98275710 AGGTGTGTACCTTTATTTCTGGG - Intergenic
1194981335 X:100444196-100444218 TGGTGGGCACCTGTAATCCCAGG - Intergenic
1195505971 X:105657744-105657766 AGGTGGGCGCCTGTAATCCCAGG - Intronic
1195610306 X:106859019-106859041 AGGTGTGCAGCTTTATTTCTGGG + Intronic
1196590684 X:117483055-117483077 AGGTGAGTACCTATAATACCTGG + Intergenic
1196719765 X:118842503-118842525 TGGTGTGCACCTGTAGTCCCAGG - Intergenic
1196866947 X:120078628-120078650 TGGTGCGCACCTGTAGTTCCAGG - Intergenic
1196874162 X:120142460-120142482 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1196876152 X:120157654-120157676 TGGTGCGCACCTGTAGTTCCAGG + Intergenic
1197348141 X:125349787-125349809 AGGTGAGCACTTATAGTACCTGG + Intergenic
1197465339 X:126798524-126798546 AGGTGAGCACTTACAGTTCCTGG + Intergenic
1197497264 X:127200232-127200254 AGGTGTGCAGCTTTATTTCTGGG + Intergenic
1197608301 X:128609704-128609726 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1197784929 X:130189763-130189785 TGGTGTGCACCTGTAATCCCAGG - Intergenic
1197950157 X:131886199-131886221 AGGTGAGCAGCTTTATTTCTGGG + Intergenic
1199739867 X:150724888-150724910 AGGTGTGCACCCTTATTTCTGGG + Intronic
1199891025 X:152082164-152082186 AGGTGTGTGCCTGTATTTCTGGG - Intergenic
1200641850 Y:5729930-5729952 AGGTGTGCAACTTTATTTCTGGG + Intronic
1201052749 Y:9955800-9955822 TGGTGAGCAACTGTAGTCCCTGG - Intergenic
1201067741 Y:10115134-10115156 TGGTGGGCACCTGTAATCCCAGG + Intergenic
1201222212 Y:11782647-11782669 AGGTGTGCATCTTTATTTCTGGG - Intergenic
1201348903 Y:13016876-13016898 AGGTGTGCAACTTTATTTCTGGG + Intergenic
1201899958 Y:19038872-19038894 TGGTGGGCACCTGTATTCCCAGG + Intergenic
1202250211 Y:22863620-22863642 TGGTGCACACCTGTAGTTCCAGG - Intergenic
1202403200 Y:24497368-24497390 TGGTGCACACCTGTAGTTCCAGG - Intergenic
1202467581 Y:25172713-25172735 TGGTGCACACCTGTAGTTCCAGG + Intergenic