ID: 1161464791

View in Genome Browser
Species Human (GRCh38)
Location 19:4422908-4422930
Sequence CTCACGAAGGAGAAATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161464791_1161464799 0 Left 1161464791 19:4422908-4422930 CCTTCCCATTTCTCCTTCGTGAG 0: 1
1: 0
2: 2
3: 19
4: 275
Right 1161464799 19:4422931-4422953 GTGCCCGTGGGGCCCTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 110
1161464791_1161464804 9 Left 1161464791 19:4422908-4422930 CCTTCCCATTTCTCCTTCGTGAG 0: 1
1: 0
2: 2
3: 19
4: 275
Right 1161464804 19:4422940-4422962 GGGCCCTGACGTGGGAGCGGTGG 0: 1
1: 0
2: 2
3: 28
4: 357
1161464791_1161464803 6 Left 1161464791 19:4422908-4422930 CCTTCCCATTTCTCCTTCGTGAG 0: 1
1: 0
2: 2
3: 19
4: 275
Right 1161464803 19:4422937-4422959 GTGGGGCCCTGACGTGGGAGCGG 0: 1
1: 0
2: 2
3: 24
4: 267
1161464791_1161464800 1 Left 1161464791 19:4422908-4422930 CCTTCCCATTTCTCCTTCGTGAG 0: 1
1: 0
2: 2
3: 19
4: 275
Right 1161464800 19:4422932-4422954 TGCCCGTGGGGCCCTGACGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161464791 Original CRISPR CTCACGAAGGAGAAATGGGA AGG (reversed) Intronic
900424972 1:2573194-2573216 CACACAAAAGAGAAATGGGCTGG + Intergenic
900967606 1:5969766-5969788 CGCACGAAGCAGCACTGGGAAGG - Intronic
901710628 1:11111881-11111903 GTCACGAAGGAAAAAAGGGGTGG + Intronic
901847736 1:11994946-11994968 CTCAAGAAGCAGAAATGGTGGGG + Intronic
902533874 1:17107761-17107783 CTCTGGCAGGAGAATTGGGAAGG + Intronic
902558077 1:17258818-17258840 CCCACTAAGGAGACATGTGATGG + Intronic
903576005 1:24340242-24340264 CGCATGCAGGAGAAATGCGAAGG + Intronic
903642870 1:24871647-24871669 CTCACGAAGGAAGACAGGGAAGG + Intergenic
904040323 1:27580493-27580515 TTCAGGAAGAAGAAATGGCAGGG - Intronic
904626834 1:31811017-31811039 CTCTTGGAGGAGAGATGGGAGGG - Intronic
904918532 1:33987639-33987661 CTCATGAAGGAGATCTGGGTGGG - Intronic
905536533 1:38726651-38726673 CTCTGGAAGCAGAAATGGGTAGG + Intergenic
905848855 1:41258046-41258068 CCCACTGAGGAGGAATGGGATGG + Intergenic
905858518 1:41330718-41330740 CACACGCAGGAGAAAAGGAAAGG - Intergenic
906348515 1:45036904-45036926 CTCAGGAAGCTGAAGTGGGAGGG - Intronic
907728240 1:57040542-57040564 CTCACAAAGGAGATAAGGCAAGG - Intronic
910975185 1:92898868-92898890 CTCGGGAAGGTGAAGTGGGAGGG - Intronic
912415531 1:109506035-109506057 CTCTCGATGGAGGAATGGGGTGG + Exonic
913340970 1:117757950-117757972 CCCCCAAAGGAGACATGGGAAGG - Intergenic
914365572 1:146975159-146975181 CTCACTAAGGGTAAGTGGGATGG - Intronic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
920196747 1:204232909-204232931 CCCAACAAGGAGAAATTGGAAGG - Intronic
920386602 1:205574335-205574357 CTCAGGAGGCAGAAGTGGGAGGG + Intronic
922567953 1:226613211-226613233 CTCAGAAAGGACAAAAGGGATGG - Intergenic
1062993571 10:1843745-1843767 CTCACGAAGCACTAAAGGGAAGG + Intergenic
1063163006 10:3433466-3433488 CTCAAGAATGAGACAGGGGAAGG + Intergenic
1063828463 10:9925289-9925311 CTCAGGAAGCTGAAGTGGGAGGG - Intergenic
1063977519 10:11429225-11429247 CTGATGAAACAGAAATGGGAGGG + Intergenic
1064889684 10:20156497-20156519 TTCATGAGGGAGAAATTGGAGGG - Intronic
1064913897 10:20435079-20435101 CCAAGGAAGGAGAAATGGCATGG + Intergenic
1065460012 10:25950702-25950724 CTGAGGAAGGAGAAATGAGTAGG + Intronic
1065789424 10:29246442-29246464 CTCAGGAAGCTGAAATGGAAGGG + Intergenic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1067841910 10:49687909-49687931 TTTAAGAAGGAGAAATGGCAGGG + Intronic
1068485696 10:57655572-57655594 GTCTGGAAGGTGAAATGGGAAGG + Intergenic
1068615658 10:59112894-59112916 CCCAAGAACGAGAAATGTGAAGG - Intergenic
1070841372 10:79490314-79490336 CACAAGATGGAGAAAGGGGAAGG + Intergenic
1073449812 10:103602699-103602721 CCCACCAAGAAGGAATGGGAAGG - Exonic
1073535508 10:104273162-104273184 ATCAAGAAGGACAAATTGGATGG - Intronic
1073635983 10:105199620-105199642 TGCATTAAGGAGAAATGGGAAGG + Intronic
1074903535 10:117840212-117840234 CTCAGGAAGGAGACATGGTGTGG - Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1077662459 11:4082058-4082080 CCCAGGAAGGAGAAAAGGTAAGG - Intronic
1079064897 11:17281222-17281244 CTCAGGAAGCTGAGATGGGAGGG - Intronic
1079140468 11:17805956-17805978 TTCTTGAAGGACAAATGGGATGG - Intronic
1080728892 11:34926936-34926958 CTCATGTAGCAGAAATGGCAGGG + Intronic
1084736114 11:71106806-71106828 CTCAAGAAGAAGGAAGGGGAGGG + Intronic
1086873116 11:92063363-92063385 CACATGAAGGAGAACAGGGAGGG + Intergenic
1089677133 11:120097685-120097707 TTCAGGAAGGGGTAATGGGAAGG - Intergenic
1091498812 12:995335-995357 CTGACCAAGGTGAAATGGGGAGG + Intronic
1092112501 12:5973705-5973727 CTCAGGAAGAAGAAGAGGGAGGG - Intronic
1099255804 12:80309840-80309862 TTCAGGAAGGAGATGTGGGATGG + Intronic
1101755912 12:107620527-107620549 TTCAGGAAGGAGGAATGGGAGGG + Intronic
1102364739 12:112322518-112322540 ATTACGAAGGAGAAACAGGAAGG + Intronic
1103978645 12:124721107-124721129 AGCATGAATGAGAAATGGGAAGG + Intergenic
1104265865 12:127231972-127231994 CTCAGGAAGGAGAGCTGGAAAGG - Intergenic
1104635121 12:130433696-130433718 CCCAAGAAGGAAAAAAGGGATGG - Intronic
1105309885 13:19196930-19196952 CTCAGGAAGCTGAGATGGGAGGG + Intergenic
1105804229 13:23940829-23940851 CTTAAGAGGGAGAAATGGGAAGG - Intergenic
1106769853 13:32951577-32951599 CTTCCTAAGGAGAAAGGGGAGGG + Intergenic
1107985105 13:45768869-45768891 CTCAGGAAGCATAAATGGGTTGG + Intergenic
1108098348 13:46928558-46928580 ATCAAGAAAGAAAAATGGGATGG + Intergenic
1108732510 13:53249272-53249294 CTAAAGAAGGAGAGATGAGATGG + Intergenic
1108939078 13:55926738-55926760 GTCAAGAAGGATAAATGGGAAGG + Intergenic
1110193833 13:72762783-72762805 CTTACGAACAAGAAATGGAAAGG + Intronic
1112703719 13:102041897-102041919 CTTGTGAAGGAGAAATGTGAAGG - Intronic
1115106871 14:29771909-29771931 TTCAAAAGGGAGAAATGGGAAGG - Intronic
1115641443 14:35337923-35337945 CTAATGAAGGAGAGGTGGGAGGG + Intergenic
1118231498 14:63954749-63954771 GTCAAGTTGGAGAAATGGGATGG + Exonic
1119310894 14:73645271-73645293 CTCAGACAGGAGAAAAGGGAGGG + Intronic
1119588978 14:75867319-75867341 CTAATGAATCAGAAATGGGATGG - Intronic
1119856043 14:77901775-77901797 CTCAGGAAGGACAAATGTGTTGG - Intronic
1120082540 14:80232050-80232072 CTTAAGAAGGAGAAATGGGTTGG - Intronic
1120851407 14:89175449-89175471 CTCAGGAAGGAAACCTGGGAAGG + Intronic
1122131883 14:99608958-99608980 CTCAAGAAGGAGGAATGGGGTGG + Intergenic
1122708573 14:103638221-103638243 CACATTAAGGAAAAATGGGATGG - Intronic
1122782143 14:104148155-104148177 CACACGCAGGAGAAAATGGAAGG + Intronic
1123947352 15:25245228-25245250 CTCACGTATGAGCAAGGGGAAGG - Intergenic
1126431215 15:48587024-48587046 CTCCCCAAGAAGACATGGGATGG + Intronic
1126793506 15:52241851-52241873 CTCAGGGAGCTGAAATGGGAGGG - Intronic
1126915683 15:53463756-53463778 CTCAGGAAGGTGAATTGGAAGGG - Intergenic
1127585955 15:60378147-60378169 ATCAAGAAATAGAAATGGGATGG - Intronic
1127590233 15:60415323-60415345 CACAATAAGGAAAAATGGGACGG + Intergenic
1128539467 15:68516322-68516344 CCCAGGAAGCAGAAATGGTATGG + Intergenic
1129038589 15:72665611-72665633 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129211301 15:74071619-74071641 CTCCCGAAGGAGAAGGCGGACGG - Exonic
1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129402709 15:75293744-75293766 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1130205292 15:81869890-81869912 CTCCTGAAGGAGAAAAGAGAAGG - Intergenic
1132093141 15:98961753-98961775 CCCACGAAGGAGACCTGGGGTGG - Exonic
1133489466 16:6253064-6253086 ATCAAGAAGGAGAGATGGCAGGG - Intronic
1135920808 16:26647364-26647386 CTAGCGAAGGAGAGAGGGGAGGG - Intergenic
1139130064 16:64132315-64132337 CTCACCAAGGAGAAACAGGGAGG + Intergenic
1139435655 16:66935175-66935197 CCCCAGATGGAGAAATGGGAAGG - Exonic
1139984026 16:70882978-70883000 CTCACAAAGGAGAATTGTGGAGG + Intronic
1142519584 17:495468-495490 CTCAGGAGGCAGAAGTGGGAGGG - Intergenic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144108519 17:12008845-12008867 CTCCCAAAAGAGAAATAGGAAGG + Intergenic
1146831090 17:36070146-36070168 CTCCCCAAGGAGAGATGGGATGG + Intronic
1147533670 17:41303370-41303392 TTCAGGAATGATAAATGGGAAGG - Intergenic
1147538543 17:41336411-41336433 CTCACTAAGGTGGCATGGGAGGG - Intergenic
1147873653 17:43605434-43605456 CTCATGAGTGAGAAATGGCAGGG + Intergenic
1149389785 17:56177099-56177121 TTCACCAAGGAGAAAAGGGCAGG - Intronic
1149752167 17:59155913-59155935 GACACGAAGGGGAAATGGAAAGG + Intronic
1149876485 17:60238862-60238884 CTCACGAAGCTGAGGTGGGAGGG + Intronic
1150249336 17:63697648-63697670 CACACCATTGAGAAATGGGAGGG - Exonic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150769580 17:68029871-68029893 ATAACGAAGTAGAAGTGGGATGG - Intergenic
1151132260 17:71909293-71909315 CTCACGCAGGGAACATGGGATGG + Intergenic
1151167833 17:72220002-72220024 CTCTCCAGGGAGAAAGGGGATGG + Intergenic
1151412544 17:73940917-73940939 CTCACGCAGGAGAGATGGGATGG + Intergenic
1151515455 17:74592072-74592094 CTCAGGAAGGAGACATGTCAGGG - Exonic
1153045711 18:854099-854121 CTCCAGAAGAAGAACTGGGATGG + Intergenic
1154273070 18:12936655-12936677 CTCAGGAAGCTGAGATGGGAGGG - Intergenic
1154417151 18:14184539-14184561 CTTAAGAGGGAAAAATGGGAAGG + Intergenic
1156940173 18:42757818-42757840 CTCACTGAGGTGAAATAGGAGGG - Intronic
1157446565 18:47750890-47750912 CTCAGTAAGGGGAACTGGGAGGG + Intergenic
1157481291 18:48055595-48055617 CTCACAAAGCACAAAAGGGAGGG - Intronic
1158235205 18:55304771-55304793 CTCATGAACTAGATATGGGAAGG + Intronic
1160886110 19:1349089-1349111 CACAGGAAGGACAAATGGGGGGG - Intergenic
1161411521 19:4120824-4120846 CACACGGAAGAGAAATGTGAAGG + Intronic
1161464791 19:4422908-4422930 CTCACGAAGGAGAAATGGGAAGG - Intronic
1164738972 19:30562820-30562842 CTCAGGATGGAAAAGTGGGATGG - Intronic
1166662994 19:44659344-44659366 CTCCAGAAGGAGCCATGGGAGGG - Intronic
1167456243 19:49597810-49597832 CCCACGAAGGCGAAACGTGATGG + Exonic
1167806393 19:51789262-51789284 ATCAAAAAGGAGAAATAGGAAGG + Intronic
925253294 2:2460896-2460918 TTCCCCAAGGAGAAAAGGGATGG - Intergenic
925731708 2:6923666-6923688 CGCACGGAGCAGAACTGGGACGG + Intronic
925761444 2:7188422-7188444 CTCTCGAAGGAGCCATGGGTAGG - Intergenic
926241541 2:11092699-11092721 GGCAAGAAGGGGAAATGGGAGGG + Intergenic
926574461 2:14564705-14564727 CTCAAGAAGAAGAAACAGGAGGG + Intergenic
930257219 2:49106138-49106160 CTCAGGAAGGAGAGATAGGCAGG - Intronic
930384000 2:50669043-50669065 TCTACGCAGGAGAAATGGGAGGG + Intronic
931238312 2:60430530-60430552 GTCCAGAAGGAGAACTGGGAGGG - Intergenic
932604883 2:73158254-73158276 TTCAGGAAGGAGCAATGGCATGG + Intergenic
932965559 2:76471041-76471063 CTCATGAAGGAGAGATTGAATGG + Intergenic
933854913 2:86403750-86403772 CTCATGAATGGGGAATGGGAAGG - Intergenic
933969630 2:87459730-87459752 CTCAGGAAGGAGGAGTGGGCAGG + Intergenic
934500096 2:94852733-94852755 CTTAAGAGGGAAAAATGGGAGGG - Intergenic
934544745 2:95205694-95205716 CTTCCGCAGGAGATATGGGATGG - Intergenic
935354728 2:102187668-102187690 CAGACGAAGGAGACAGGGGAAGG + Intronic
935369593 2:102331498-102331520 CTCAGGAAAAAGAAATGGGCTGG - Intronic
936169896 2:110161056-110161078 CTCAGGAAGCTGAAGTGGGAGGG + Intronic
936324156 2:111490767-111490789 CTCAGGAAGGAGGAGTGGGCAGG - Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
938338720 2:130521308-130521330 CTCAGCCAGGAGAAACGGGATGG - Exonic
938351120 2:130599442-130599464 CTCAGCCAGGAGAAACGGGATGG + Exonic
938759001 2:134406785-134406807 TTCAGGAAGCTGAAATGGGAGGG + Intronic
938938939 2:136152245-136152267 GGAAAGAAGGAGAAATGGGAAGG - Intergenic
940293635 2:152100393-152100415 ATCAAGATGGAGAAATGAGATGG - Intergenic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
944426084 2:199584744-199584766 CTCATGAAGTGGAGATGGGAAGG - Intergenic
945435344 2:209811020-209811042 TTTAAGAAGGAGAAATGGGATGG + Intronic
946469203 2:219940662-219940684 CTCACCTAGGAGAAAGAGGAAGG - Intergenic
947224071 2:227823137-227823159 GGCACAAAGGAGAATTGGGACGG + Intergenic
948085872 2:235247200-235247222 CTCAGGAAGAAGAAATGCTATGG + Intergenic
1168852504 20:986206-986228 CACACGTGGGAGAAAGGGGAGGG + Intronic
1169129105 20:3154573-3154595 CTCAGGAGGTAGAAGTGGGAAGG + Intronic
1169360269 20:4942699-4942721 CACCTGAAGGAGAAATGTGATGG + Intronic
1169419253 20:5446167-5446189 CTCAAGAAGAAGAATTGAGAGGG + Intergenic
1170923598 20:20702343-20702365 CCCATGAAGGATAAATGAGAAGG + Intronic
1171190886 20:23158642-23158664 CTCAGCATGGAGAAATGGGCTGG - Intergenic
1171203184 20:23257892-23257914 CTGACAGAGGAGAAAAGGGATGG - Intergenic
1176523180 21:7840729-7840751 CACACCAATGAGAAATAGGAGGG + Intergenic
1177908889 21:27005967-27005989 CTCACTGAGGAGGAGTGGGAGGG - Intergenic
1178141564 21:29689922-29689944 CTGACGGAGGAGCTATGGGAAGG + Exonic
1178657200 21:34470741-34470763 CACACCAATGAGAAATAGGAGGG + Intergenic
1179361476 21:40713456-40713478 CTCACTAAGGAGAGATGGGAAGG + Intronic
1182972669 22:34592476-34592498 ATCACGAAGGAGGAAAAGGAAGG + Intergenic
1184149842 22:42631527-42631549 GACACAAAGGAGGAATGGGATGG - Intronic
1184310024 22:43635217-43635239 CTGACGAGGGAGACAGGGGAGGG + Intronic
1185125333 22:49007345-49007367 CTCAGTAAGGAGGACTGGGAGGG + Intergenic
949159698 3:865940-865962 CACATGAAGGAGAAATATGAAGG - Intergenic
949677201 3:6469301-6469323 CTCACATAGCAGAAGTGGGAGGG - Intergenic
950507804 3:13406517-13406539 CTCACTAAGCAGAAAAGGCAGGG + Intronic
953778461 3:45843251-45843273 CTCACTAAACAGAAATGGGGAGG - Intronic
954114778 3:48460402-48460424 CTCACGCAGGAGGAATGTGTCGG - Exonic
955493210 3:59503847-59503869 CTCAGGAAGGAGATTTGGGCTGG - Intergenic
955826893 3:62957097-62957119 CTCAGGAAGCTGAGATGGGAGGG - Intergenic
955892796 3:63667871-63667893 CACACAAAGGAAAAATGGGAGGG + Intronic
958732740 3:97975954-97975976 CTCACGTGGTAGAAGTGGGAAGG + Intergenic
958744699 3:98118757-98118779 CTCACCATGGAGAAACTGGAAGG - Intergenic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
962196152 3:133365407-133365429 CTCAGGAAAGAGAAAAGGGAGGG + Intronic
965027616 3:163323656-163323678 CACACAAAGGAGAAATAGAAAGG - Intergenic
965190622 3:165523556-165523578 CTCAAGAAGGAGAAGTCAGAGGG - Intergenic
965807443 3:172556834-172556856 CTCAGTAAGGAGAATTGGGCCGG + Intergenic
966855813 3:184193262-184193284 GGCAAGAAGGGGAAATGGGAGGG - Intronic
967751882 3:193124491-193124513 CCCAAGAAGGAGAAATGGAAAGG + Intergenic
969686000 4:8674636-8674658 CTCATGCTGGAGAGATGGGAGGG + Intergenic
970342917 4:15125583-15125605 CTCAGGAAGGAGTCAGGGGAGGG - Intergenic
971607119 4:28671919-28671941 CTCACTGAGGAGAAAGGGGCAGG - Intergenic
974459702 4:62171707-62171729 ACCACGAAGGAGACAGGGGAAGG - Intergenic
974495768 4:62624594-62624616 ATCAGGTAGGAGAAAGGGGACGG + Intergenic
974581009 4:63801590-63801612 CCCACAAAGGGTAAATGGGAGGG + Intergenic
975486311 4:74936845-74936867 CTCAAGAAGGACAAAAAGGAAGG + Intronic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
977439092 4:97038748-97038770 CTCAAGAACGAGAAAAGGGTAGG + Intergenic
979031976 4:115660455-115660477 CATACCAAGGAGTAATGGGATGG - Intergenic
980646361 4:135646845-135646867 CTCACATGGGAGAAATGGCAGGG - Intergenic
981973535 4:150695428-150695450 CTCATGAGGCTGAAATGGGAGGG - Intronic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986827640 5:11539353-11539375 CTCACAAAGCAGACATGGGCTGG - Intronic
988665541 5:33323458-33323480 ATCACGAAGGGAAAATGGGAGGG - Intergenic
988878190 5:35471435-35471457 CTGACTAAGGAGAAATTGAATGG - Intergenic
989344448 5:40413521-40413543 CTCAAGAAAGAGAAATAGGAAGG + Intergenic
990544628 5:56810660-56810682 CTCAGGAAGCTGAGATGGGACGG - Intergenic
993607185 5:90006205-90006227 CTCAGGAAGGAGTGGTGGGAAGG + Intergenic
995321086 5:110834979-110835001 CTCAGGAAAGATAAATGAGAGGG - Intergenic
998096286 5:139397179-139397201 CTCAGGAAGGAGCCCTGGGATGG - Intronic
999085762 5:148888131-148888153 CTCTGGAAGGAGCAATGGCAGGG + Intergenic
999884520 5:155906250-155906272 CTCAAGAAGAGGAAATGAGAGGG - Intronic
1001169077 5:169400767-169400789 CTCACGTAGGAGAATGTGGATGG + Intergenic
1002394116 5:178940304-178940326 CTCAGGAAGGAAAGATGAGAGGG - Intergenic
1003660818 6:8059737-8059759 CTCAGGAAGGCCAAATGGGGAGG + Intronic
1004000623 6:11593812-11593834 ATTAAGAAGGAGAAATGGGCCGG - Intergenic
1004293990 6:14393796-14393818 CTCACCAAGGAACAAAGGGAGGG + Intergenic
1004714919 6:18207599-18207621 CTCACGCAGGAGAATGGGGCTGG + Intronic
1005274010 6:24197262-24197284 CTCAGGAAGGGGAGTTGGGAGGG - Intronic
1005459440 6:26054531-26054553 CCCAAGAAAGAGAAAGGGGAGGG - Intergenic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006635712 6:35459889-35459911 CTCATAAAGGAGAAAGAGGATGG - Intronic
1007072370 6:39047254-39047276 AGCAGGAAGGAGGAATGGGAAGG - Intergenic
1007728395 6:43930849-43930871 CCCCTGAAGGAGACATGGGAGGG + Intergenic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1008078053 6:47166647-47166669 CTCAGGAAGGTGAGATGGGAGGG - Intergenic
1008326296 6:50185943-50185965 TCTAAGAAGGAGAAATGGGATGG - Intergenic
1009409653 6:63351135-63351157 CTCACATGGTAGAAATGGGAAGG - Intergenic
1011541295 6:88433212-88433234 TTCATGTAGGAGAAATTGGAGGG - Intergenic
1013780178 6:113720127-113720149 CTCACAAGGGAGAAATGGGGAGG - Intergenic
1013828969 6:114250156-114250178 CCCATGATGGTGAAATGGGATGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1016818319 6:148324157-148324179 CTCAAGAATGGCAAATGGGAGGG + Intronic
1017434969 6:154407121-154407143 CTCTGGAAGCAGAAATGGGAAGG + Intronic
1018496444 6:164351178-164351200 CTTAAGAAGGAGGAGTGGGAGGG + Intergenic
1019219230 6:170461763-170461785 CTCAGGACGGAGACATGGGAAGG + Intergenic
1020170725 7:5842950-5842972 CACACGAAGGTGAGCTGGGAGGG - Intergenic
1020905024 7:14053569-14053591 CTGACCAGGGAGAACTGGGATGG - Intergenic
1021498562 7:21303838-21303860 CTCAGGAGGCTGAAATGGGAGGG + Intergenic
1023500358 7:40843542-40843564 CTCACTGAGCAGAAATGTGAAGG + Intronic
1023687532 7:42751948-42751970 CTCAAGAAGGAGTAATGGATGGG + Intergenic
1023734494 7:43222925-43222947 TTCAAGAAGGAGATGTGGGATGG - Intronic
1024965155 7:55018176-55018198 CTCCCGCAGGAGAAATGCCAGGG - Intergenic
1026114709 7:67486520-67486542 CTCAGCTAGAAGAAATGGGAGGG - Intergenic
1027602435 7:80255650-80255672 CTCACAAAGGAGAAAGGGTTAGG - Intergenic
1027868780 7:83679955-83679977 CTCAAGAAAAAGAAATGGGCTGG + Intergenic
1028900990 7:96100408-96100430 CTCAAGAAGGAGAGAGGGAAAGG - Intronic
1030107695 7:106000382-106000404 CAGAGGAAGGAGAAATGGCAGGG - Intronic
1030303268 7:107995308-107995330 CTCTCAAAGGAAAAAAGGGAGGG + Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1031503266 7:122548263-122548285 CTCACGAGGCTGAGATGGGAGGG + Intronic
1032251323 7:130260467-130260489 CTCAGAAAGGACAAAAGGGATGG + Intergenic
1032577692 7:133072977-133072999 TTCAGGAAGTGGAAATGGGAAGG - Intronic
1033478666 7:141716378-141716400 GTGAGGAAGGAGAAAAGGGAGGG - Intronic
1033787407 7:144750375-144750397 TTCACGAATGAGAGATGGTAAGG + Intronic
1034552419 7:151830057-151830079 TTCTAGATGGAGAAATGGGATGG + Intronic
1035925193 8:3720656-3720678 GTCATGAAGGAGAAATGTGCTGG - Intronic
1036624305 8:10453978-10454000 CTCAGGAGGCAGAGATGGGAGGG - Intergenic
1037934484 8:22906062-22906084 TTCATGAAGGAGAAATGCTATGG + Intronic
1039328011 8:36505986-36506008 CTGACTATGGAGAAAAGGGAGGG + Intergenic
1041975475 8:63794474-63794496 TTCAGGAAGGAGAATTGGAAAGG + Intergenic
1042593187 8:70418099-70418121 ATTAAGAAGTAGAAATGGGAGGG - Intergenic
1044339140 8:91026799-91026821 CTTACCAATGGGAAATGGGATGG + Intronic
1045348386 8:101315690-101315712 CTTATGAAGGAGAAAGGAGATGG - Intergenic
1046104944 8:109653829-109653851 CTAAAGAACCAGAAATGGGAAGG - Intronic
1052976574 9:34415236-34415258 TTCACCAAAAAGAAATGGGAAGG + Intronic
1053169599 9:35869199-35869221 CCCATGAAGGAGAGATTGGAGGG + Intergenic
1053657077 9:40227805-40227827 CTTAAGAGGGAAAAATGGGAGGG + Intronic
1054357524 9:64076285-64076307 CTTAAGAGGGAAAAATGGGAAGG + Intergenic
1054369195 9:64374086-64374108 CTTAAGAGGGAAAAATGGGAGGG + Intronic
1054527521 9:66148420-66148442 CTTAAGAGGGAAAAATGGGAGGG - Intronic
1054676825 9:67863833-67863855 CTTAAGAGGGAAAAATGGGAGGG + Intronic
1055112814 9:72576380-72576402 GTCAGAAAGGAGAAAGGGGAGGG - Intronic
1055171897 9:73268414-73268436 CTCACAATGGAGAAAAGGCAAGG - Intergenic
1057077605 9:92146967-92146989 CTCTGTAAAGAGAAATGGGAGGG - Intergenic
1059314576 9:113413051-113413073 CTAACGAAGGGGAAAAGGAAAGG + Intronic
1059353858 9:113684888-113684910 CTCAAGAGGGTGAAGTGGGAGGG - Intergenic
1060016179 9:120088273-120088295 CTGAGGATGGAGAAAAGGGAAGG + Intergenic
1061316308 9:129798292-129798314 CTCACGAGGCAGAAGTGGAAGGG + Intergenic
1061482324 9:130903249-130903271 CAGAGGCAGGAGAAATGGGATGG + Exonic
1061520580 9:131115151-131115173 CTCAGAAAGGTGAAATGGGCCGG + Intronic
1061770538 9:132916960-132916982 CTGAGGAAGGACATATGGGAAGG + Intronic
1062182239 9:135196696-135196718 AACGGGAAGGAGAAATGGGAAGG - Intergenic
1185463789 X:343900-343922 CTCACCAAGGAGAGGCGGGAGGG + Intronic
1187831031 X:23380963-23380985 CTCAAGAATGGGGAATGGGAGGG + Intronic
1188137303 X:26505196-26505218 CTCTCTCAGGTGAAATGGGAGGG - Intergenic
1188874186 X:35409952-35409974 CTCAAGTAGGAGAAAGGGAATGG - Intergenic
1190511037 X:51174714-51174736 CTGAAGAGGGGGAAATGGGAAGG + Intergenic
1196273333 X:113737464-113737486 TGCACGAAGGAGAAATCTGAGGG - Intergenic
1200245986 X:154525959-154525981 CTCAGGAAGCTGAGATGGGAGGG - Intergenic
1201737665 Y:17286761-17286783 GTGAGGAAGGAGAAATGGGGAGG + Intergenic
1202161648 Y:21941027-21941049 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202229708 Y:22645346-22645368 GTCAAGAAGGAGAAACAGGATGG + Intergenic
1202313448 Y:23550819-23550841 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202557355 Y:26119776-26119798 GTCAAGAAGGAGAAACAGGATGG + Intergenic